ID: 1106128909

View in Genome Browser
Species Human (GRCh38)
Location 13:26923118-26923140
Sequence CCTGTCCACAAGAAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106128903_1106128909 3 Left 1106128903 13:26923092-26923114 CCAACCACAGGCCACCCAGAGTA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1106128904_1106128909 -1 Left 1106128904 13:26923096-26923118 CCACAGGCCACCCAGAGTAAGAC 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1106128905_1106128909 -8 Left 1106128905 13:26923103-26923125 CCACCCAGAGTAAGACCTGTCCA 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106128909 Original CRISPR CCTGTCCACAAGAAGTTGTG AGG Intergenic
900235269 1:1586374-1586396 CCTCTCCACAGGAAGTCGTTTGG - Intergenic
901665915 1:10826062-10826084 CCTGCCCTCAGGAAGCTGTGGGG - Intergenic
901926668 1:12570581-12570603 CCTGTTCAAAAGTAGTTGTGGGG + Intronic
904946355 1:34201468-34201490 CCTTTCTACAAGATGTTGTGGGG - Intronic
906200702 1:43958411-43958433 CCTGGCCACATCTAGTTGTGGGG - Intronic
906533639 1:46539041-46539063 CCAGTCCACAAGCAGTTTGGGGG + Intergenic
909481162 1:76130056-76130078 CCTGTCCAAAACAAGTTGGAAGG - Intronic
909741064 1:79030227-79030249 TCTGTCCACTAGAAGTCCTGTGG - Intergenic
916175450 1:162034263-162034285 ACTTTCCACATGAAGTTTTGGGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918167300 1:181962126-181962148 CCTAGCCAAAAGAAGCTGTGAGG - Intergenic
918277929 1:182972109-182972131 TCAGTTCACAAGAAGGTGTGAGG + Intergenic
920205858 1:204291455-204291477 TCTGTCTACAAGTCGTTGTGTGG - Intronic
921061475 1:211588790-211588812 CCTGTCCTCAAGTAGCTTTGGGG - Intergenic
922396734 1:225209914-225209936 CCTAGCCAAGAGAAGTTGTGAGG + Intronic
1069389864 10:67923056-67923078 CCAGTCCACAGGAGGTGGTGAGG - Exonic
1069711880 10:70494747-70494769 CCCTTCCACAGGAAGCTGTGAGG - Intronic
1071997898 10:91164227-91164249 CCCTTCCACAATAACTTGTGGGG + Intronic
1075159011 10:120006304-120006326 GCTGACCCCAAGGAGTTGTGGGG - Intergenic
1076161908 10:128250940-128250962 CCATTCTACAAGAATTTGTGGGG - Intergenic
1076328346 10:129645706-129645728 CGTGTCCACAAGAAGTGGCAGGG - Intronic
1076786080 10:132750825-132750847 CCTGTCCTCAGGAAGCTGTCTGG + Intronic
1080261596 11:30355220-30355242 CCTGACCAATAGAAATTGTGAGG - Intergenic
1081789239 11:45771393-45771415 ACTGTCCACAAGAAGGTGCTCGG + Intergenic
1081799483 11:45847917-45847939 CCGTTCCACAGGCAGTTGTGAGG - Intronic
1090939809 11:131377217-131377239 CTTTTCTACAAGAGGTTGTGTGG - Intronic
1091469391 12:713732-713754 CATTTTCACAAGAATTTGTGTGG - Intergenic
1093846734 12:23980961-23980983 ACTCTACACAAGAAGATGTGAGG - Intergenic
1094221838 12:28002240-28002262 CATCTCCACAAGAAACTGTGGGG - Intergenic
1094741741 12:33296929-33296951 CCTTTCCACAGGTAGTTGAGTGG - Intergenic
1095849139 12:46781819-46781841 CCTGGACTCAAGAAGTTGAGTGG - Intronic
1096440968 12:51644234-51644256 GCTGATCACAAGAAGTAGTGTGG + Intronic
1101296020 12:103424588-103424610 CCTAGCCAAAGGAAGTTGTGAGG + Intronic
1102289457 12:111686961-111686983 CATGTCCTCATGCAGTTGTGAGG + Intronic
1103015434 12:117491032-117491054 CCTGTCTAAATGAAGTTCTGTGG + Intronic
1103031942 12:117622625-117622647 TCTCTCCACAAGATTTTGTGTGG - Intronic
1103119652 12:118371241-118371263 CCCCTCCACAAGAAGTTGAAAGG - Intronic
1103755435 12:123202163-123202185 CCTGTCTACAAGAATTTGATTGG + Exonic
1105966736 13:25391483-25391505 CCTTTCCCCAAGAAGTTCTTAGG + Intronic
1106128909 13:26923118-26923140 CCTGTCCACAAGAAGTTGTGAGG + Intergenic
1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG + Intergenic
1113736690 13:112684131-112684153 CCTGGGCACAGGAAGATGTGGGG + Exonic
1117312400 14:54541128-54541150 CCTGCCCACAGGCAGTTGAGAGG + Intergenic
1122371942 14:101233858-101233880 CCTGTTCACAGCAAGTGGTGAGG + Intergenic
1123986257 15:25648995-25649017 CCTGTCCACAATCAGTGATGAGG + Intergenic
1125142352 15:36423355-36423377 CCTGTCAACATCAATTTGTGAGG - Intergenic
1126388585 15:48120634-48120656 CCTTTCCCCTAGAAGTTGTTTGG - Intergenic
1129436643 15:75546732-75546754 ACTGTCCACAAGAATTTATCAGG - Intronic
1129720433 15:77875085-77875107 CCTGGACACAGGAAGGTGTGAGG - Intergenic
1144050598 17:11494477-11494499 CCTGTTCACTGGAAGTTCTGTGG - Intronic
1153939476 18:9965813-9965835 ACTGTCCACAAGAGGTAGTAAGG + Intergenic
1156681927 18:39600716-39600738 CATTTCCTCAAGAACTTGTGTGG - Intergenic
1163389293 19:17020637-17020659 CCTGTCCAAACTAAGCTGTGAGG + Intronic
1163849312 19:19654446-19654468 CCTGTCCCCAAGATGCTCTGAGG + Intronic
1166088635 19:40493512-40493534 CATCTCTACAAAAAGTTGTGGGG + Intronic
925897228 2:8481891-8481913 CCTGACCACAAGGAGCTATGGGG - Intergenic
931443958 2:62311168-62311190 CTTGTCCAAATGAAGCTGTGAGG + Intergenic
931891072 2:66672900-66672922 CCTGGCCACAAGAGTGTGTGCGG + Intergenic
948078818 2:235188764-235188786 CCTGTCACCAGGAAGGTGTGGGG + Intergenic
1170025987 20:11890694-11890716 CCTGTCCTCAAGCAGGAGTGAGG - Intergenic
1173146464 20:40528976-40528998 CCTGACCAAAGGAAGTTGAGAGG + Intergenic
1174225942 20:49000116-49000138 CCTGTCCACAAGAGGTAATGAGG - Intronic
1180150039 21:45942789-45942811 ACTGTCCCCAAGCAGGTGTGAGG - Intergenic
1182640921 22:31766956-31766978 CCTGTCCATGAGGAGATGTGAGG - Intronic
1182738209 22:32546473-32546495 CCGGTTCTCAAGAACTTGTGAGG - Intronic
1185153910 22:49182002-49182024 CCTGCCCACATTAAGTAGTGTGG - Intergenic
949217059 3:1583147-1583169 CCTGTGCACAAGGGATTGTGTGG - Intergenic
949514177 3:4792429-4792451 CCTGACCCCAAGAAACTGTGAGG - Intronic
949767955 3:7547907-7547929 CCTTTCCAGAAGAACTTGTTTGG + Intronic
949966703 3:9362972-9362994 CCTTTCCCCAAGACCTTGTGGGG + Intronic
951754183 3:26071565-26071587 ACTCTCCACAACAAGTTATGAGG + Intergenic
953694595 3:45147449-45147471 CCTGTCCACAAGGAGGATTGGGG - Intergenic
954377890 3:50204613-50204635 CCTGTCCACAAGAAGGGGGCTGG - Intergenic
954421689 3:50422220-50422242 CCAGTCCACAGGAAGTGGGGTGG - Intronic
958892821 3:99799619-99799641 CGTGACCACAAGAAGCTGTAAGG + Intergenic
961097791 3:124172765-124172787 GCTGTCCACAGGAAGTAATGGGG + Intronic
961475099 3:127141185-127141207 CCTGGCCACAAAGAGTTATGAGG - Intergenic
962900130 3:139754605-139754627 CCTCTCCCCAAGAAGGGGTGAGG - Intergenic
971943259 4:33241799-33241821 CCTGGCCAAAAGAAGCTGTGAGG - Intergenic
974070092 4:57115398-57115420 CCAGTCCACATGAAGATGCGTGG + Intergenic
987195413 5:15520854-15520876 CCTGTCCTCCAGGGGTTGTGTGG + Intronic
987304651 5:16625814-16625836 CCTCCCCAAAAGAAGCTGTGAGG - Intergenic
999452374 5:151687897-151687919 CTTGTCCTCAAAAAGTTTTGTGG + Intergenic
1004336257 6:14767244-14767266 CCTCTTCACAAAAAGTTGGGGGG + Intergenic
1009455200 6:63848597-63848619 CCTAGCCACAGGAAGCTGTGAGG + Intronic
1010227408 6:73503963-73503985 CCTGTCCAGAAGAAGTGGTCAGG + Intronic
1017137943 6:151164656-151164678 ACTGTCCAAAAGATGTTGGGTGG + Intergenic
1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG + Intronic
1019333867 7:473500-473522 CCTGCCCACAAGAAGCTCTGAGG + Intergenic
1020238715 7:6375515-6375537 CCTGTCGAAAATAAGTTGAGAGG - Intronic
1020333075 7:7039936-7039958 TCTTTCCACAAGAAAATGTGTGG + Intergenic
1022445777 7:30469625-30469647 CCTGACCAGAAGAAGATGTTTGG - Intronic
1023586148 7:41731839-41731861 ACAGTCCACAAGAAGTTCTCAGG - Intergenic
1024635044 7:51280356-51280378 CCAGTCCACAAGCAGTCCTGAGG + Intronic
1030054507 7:105571154-105571176 CCTATCCACATCAATTTGTGAGG + Intronic
1031862025 7:126991162-126991184 TATGGCAACAAGAAGTTGTGAGG - Intronic
1034324735 7:150220302-150220324 CATGTCCAGAGGAAGTTGAGGGG + Intergenic
1034768456 7:153748929-153748951 CATGTCCAGAGGAAGTTGAGGGG - Intergenic
1035893330 8:3370403-3370425 CCTCTCCACCTGCAGTTGTGAGG + Intronic
1036942129 8:13061757-13061779 CCTAAGCACAAGAAGCTGTGAGG - Intergenic
1047383288 8:124384568-124384590 CTTGAGCACAAGAATTTGTGAGG + Intergenic
1047806562 8:128367112-128367134 CCTGTCTACAAGAAGCTCTATGG - Intergenic
1048257387 8:132915411-132915433 CCTGTCAACAAGAAGATGGGAGG + Intronic
1052651246 9:31304441-31304463 CCTGGCCACAAAAAGACGTGTGG - Intergenic
1053513998 9:38713956-38713978 GCTCTGCATAAGAAGTTGTGAGG - Intergenic
1060360215 9:122948962-122948984 CCTGTCCACAAGTAGTTTGGGGG + Intronic
1060902371 9:127271039-127271061 CCTGTCCACAAGCATTGCTGAGG - Intronic
1203733826 Un_GL000216v2:116647-116669 AATGTCCACAGGAAGTTGTCTGG - Intergenic
1186585343 X:10867387-10867409 CCTGGCAGCAAGAGGTTGTGTGG - Intergenic
1189506516 X:41616513-41616535 ACCTTCAACAAGAAGTTGTGTGG + Intronic
1192397732 X:70799939-70799961 GCTGTACACAACAATTTGTGAGG - Intronic
1195733018 X:107984553-107984575 CCCTACCACAAGAAGCTGTGAGG - Intergenic
1196805115 X:119576615-119576637 CCAGTCCACAAAATGTTGTGAGG + Intronic
1197622838 X:128770418-128770440 CCTATCAACAAGCAGCTGTGTGG - Intergenic
1199593160 X:149486679-149486701 CCTGTCCACAAGGAGCCTTGTGG - Intronic
1199673477 X:150165778-150165800 CCACTCCACAAGAATGTGTGGGG - Intergenic
1199709550 X:150459481-150459503 CCTGTCCTCAAGCAGAAGTGGGG - Intronic
1200936399 Y:8742134-8742156 CCTTTCCAAAAGAGGCTGTGTGG + Intergenic