ID: 1106129980

View in Genome Browser
Species Human (GRCh38)
Location 13:26932112-26932134
Sequence TGTTACAGCCATGGGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106129976_1106129980 -3 Left 1106129976 13:26932092-26932114 CCTTCAATCAAGGGAGCTCCTGT 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1106129980 13:26932112-26932134 TGTTACAGCCATGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106129980 Original CRISPR TGTTACAGCCATGGGTCCTG AGG Intergenic
900351482 1:2237057-2237079 AGTTAGTGCCCTGGGTCCTGGGG - Intronic
900683160 1:3929010-3929032 GGTCACGCCCATGGGTCCTGGGG - Intergenic
901215917 1:7555386-7555408 TGCTCCCTCCATGGGTCCTGTGG + Intronic
904501166 1:30913587-30913609 TCTAGCAGCCATGTGTCCTGGGG - Intergenic
905879394 1:41453877-41453899 TGTTACACCCAAGTGTCATGTGG + Intergenic
906392212 1:45428223-45428245 TTTTACAGCCATGGAAACTGAGG + Intronic
907241494 1:53083718-53083740 GGCTGCAGGCATGGGTCCTGGGG + Intronic
909137013 1:71814231-71814253 TGAAACAGCCTTGTGTCCTGGGG + Intronic
910395835 1:86792960-86792982 TGTGTCAGCCAGGTGTCCTGTGG - Intergenic
913517637 1:119617975-119617997 AGTCACAGCCTTGGGGCCTGGGG + Intergenic
915006625 1:152644391-152644413 TGCTGCTGCCTTGGGTCCTGAGG - Intergenic
920056597 1:203197350-203197372 TGTTAGAGACCTGGGTCCTTGGG - Intergenic
921054018 1:211530694-211530716 TGTTTCAGCCATGGTTCGTGGGG - Intergenic
922561498 1:226572879-226572901 TTTTACAGACATGGGCACTGAGG + Intronic
1063973028 10:11394794-11394816 TGACAGAGCCATGGATCCTGAGG + Intergenic
1066801181 10:39192991-39193013 TGGTACAGCTTTGAGTCCTGTGG - Intergenic
1067666944 10:48287213-48287235 TTTTACAGCTATGGGTCCTTGGG - Intergenic
1069416550 10:68205728-68205750 TGCTACTGCCTTGGGTGCTGAGG - Intronic
1070364097 10:75719235-75719257 TGTTACTGCTATGGTTCCTCTGG - Intronic
1070678496 10:78432706-78432728 TGTTCCAGCCTTGGGCCTTGGGG + Intergenic
1070770429 10:79079270-79079292 TGTTTCACCCATGGGGGCTGTGG + Intronic
1072450871 10:95538508-95538530 AGTAAAAGCCAAGGGTCCTGGGG + Intronic
1072821611 10:98563847-98563869 TGTTATAAGCAGGGGTCCTGGGG + Intronic
1074720785 10:116263418-116263440 TTTTACACCCATGGAACCTGAGG + Intronic
1076361418 10:129892050-129892072 TGTCCCAGCCCTGGGTCCTCAGG - Intronic
1076476637 10:130758295-130758317 TGTTACAGCCATCTGGGCTGAGG - Intergenic
1076706299 10:132303577-132303599 TGTTAGCGGCATGTGTCCTGTGG - Intronic
1077139314 11:1016840-1016862 TGTTGCAGTCATAGGACCTGTGG + Exonic
1077139551 11:1018019-1018041 TGTTGCCGTCATGGGACCTGTGG + Exonic
1077489513 11:2854040-2854062 TGATACAGCCAAGGGTCAGGTGG + Intergenic
1078761217 11:14253454-14253476 TGTTACAGCTGTGTGTCCTTGGG - Intronic
1079029988 11:16979431-16979453 TTTTACAGACATGGGATCTGAGG + Intronic
1080333621 11:31171195-31171217 TGTTCCAGTGATGGATCCTGTGG - Intronic
1080856668 11:36117671-36117693 TGTGACAGCCGTGGCTGCTGTGG + Intronic
1081695515 11:45106508-45106530 TATTATAGCCATGGATTCTGTGG + Intronic
1081857128 11:46311060-46311082 TGTCACTGCCATGGCTGCTGGGG - Exonic
1082825156 11:57572119-57572141 TGTTAAAGCCATTTGGCCTGTGG - Intergenic
1083301265 11:61740681-61740703 TTTTACAGACAAGGGTGCTGGGG + Intronic
1084934480 11:72579557-72579579 TGTTGCAGCCGTGGGTGTTGAGG + Exonic
1085126484 11:74005875-74005897 GGTCACCGCCATGGCTCCTGTGG + Exonic
1085167487 11:74416282-74416304 TGTGACATCCAGGTGTCCTGGGG + Intergenic
1092006021 12:5071194-5071216 GGTTACAGCCAGGGATCCTCAGG - Intergenic
1092812551 12:12285344-12285366 TTTTACATCCGTGGGTGCTGAGG + Intergenic
1094155782 12:27335598-27335620 TGTTACTGGCATGGATCCTTGGG + Intronic
1103911457 12:124354692-124354714 TGTTCCAGCCAGGGCTGCTGAGG + Intronic
1104681923 12:130758005-130758027 TGTTTCAGCCAGGGGTCCCCAGG + Intergenic
1105249277 13:18682568-18682590 TGTTATTCCCATGGGTCCTCAGG - Intergenic
1106129980 13:26932112-26932134 TGTTACAGCCATGGGTCCTGAGG + Intergenic
1106809722 13:33348532-33348554 TGTTAAATCAATGGGTCCTCAGG - Intronic
1112591226 13:100764610-100764632 TGTTACAGCAATAGGCCATGCGG + Intergenic
1114831100 14:26142746-26142768 TGTTACTGCCATGAGTTGTGTGG + Intergenic
1115292876 14:31792788-31792810 TGTTAAAGCCTTAGTTCCTGAGG + Intronic
1119156662 14:72417834-72417856 TGTTACAGATATGGAACCTGGGG - Intronic
1124720009 15:32103801-32103823 TGTTAAAGCCATGGATCCATTGG + Intronic
1129929384 15:79397490-79397512 TGTTCCAGCCTTGAGTCCTAGGG - Intronic
1132655066 16:1038404-1038426 TGCTCCAGCCCTGGCTCCTGGGG + Intergenic
1133409639 16:5557762-5557784 ACTTACAGCCATGGGTCTTCAGG - Intergenic
1133500938 16:6365773-6365795 TTTTACAGACATGGATACTGAGG - Intronic
1135590030 16:23698499-23698521 TGATGCAGCCAGAGGTCCTGAGG + Intronic
1137078809 16:36015968-36015990 TTTTACAGCTATGAGGCCTGTGG + Intergenic
1142142491 16:88478827-88478849 TCTTAAACCCATGGGTCCTCAGG - Intronic
1142300585 16:89255635-89255657 TTTTCCAGCCCTGGATCCTGTGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142952873 17:3497947-3497969 TGTGACAGCCATGGTGCTTGAGG + Intronic
1147290360 17:39437431-39437453 TGTTACAACCATGTCCCCTGGGG - Intronic
1151235610 17:72717707-72717729 GGTTACAGTCACAGGTCCTGGGG + Intronic
1151268712 17:72976983-72977005 TGTCATAGTCATAGGTCCTGGGG - Intronic
1151459430 17:74245845-74245867 TTTGACAGCCATGGGGCCAGAGG + Intronic
1151725332 17:75880565-75880587 GGTCACAGCCACAGGTCCTGGGG + Intronic
1151792581 17:76318057-76318079 TGTCACAACCATGGGAGCTGGGG - Intronic
1152622470 17:81372229-81372251 TGTTCCAGCAAGGGGCCCTGAGG + Intergenic
1152768574 17:82154057-82154079 TGTTACATCCCTGGGTCCACTGG - Intronic
1154439614 18:14376670-14376692 TGTTATTCCCATGGGTCCTCAGG + Intergenic
1157568514 18:48696822-48696844 TGTTACACACAGGGGGCCTGTGG + Intronic
1158538664 18:58332107-58332129 TGTTACTGCCATGGATTCTGTGG - Intronic
1159748114 18:72264546-72264568 TGTCACAACCATGGGTCCCGAGG - Intergenic
1164832208 19:31331239-31331261 TTTTACAGACATGTTTCCTGAGG - Intronic
1168627776 19:57932707-57932729 TGTGACAGACATTGGGCCTGGGG - Intronic
928053044 2:28021318-28021340 TGGCAGAGCCATGGGTCATGTGG + Intronic
931182776 2:59919759-59919781 GGTTACAGCAAAGGGGCCTGAGG - Intergenic
933798979 2:85944610-85944632 TATTATACCCATGGGCCCTGTGG - Intergenic
933949488 2:87315770-87315792 TGTTACAGGCAAGGGAACTGAGG - Intergenic
936151260 2:110023523-110023545 TGTCCCAGTCAGGGGTCCTGGGG + Intergenic
936193415 2:110347846-110347868 TGTCCCAGTCAGGGGTCCTGGGG - Intergenic
936330705 2:111545827-111545849 TGTTACAGGCAAGGGAACTGAGG + Intergenic
937799984 2:126072147-126072169 TGTTGCAGCCATTGGTGGTGGGG - Intergenic
943655525 2:190504171-190504193 TTTTACAGAGGTGGGTCCTGAGG - Intronic
947028716 2:225768583-225768605 TGTTACAGATGAGGGTCCTGAGG + Intergenic
948115295 2:235490966-235490988 TGTTAAAGCCATGCAGCCTGTGG + Intergenic
1170043314 20:12060791-12060813 AGCTACAGCCATGGGTGGTGTGG + Intergenic
1170648093 20:18214413-18214435 TGTAACAGCCACAGGTGCTGGGG - Intergenic
1172163620 20:32885499-32885521 CCTCACAGCCATGGTTCCTGTGG - Exonic
1172443956 20:34983632-34983654 TCCTGCAGCCATGGCTCCTGCGG - Intronic
1173676578 20:44840932-44840954 GGTCACAGCCACGGTTCCTGTGG - Intergenic
1174236891 20:49101526-49101548 TTTTACAGCCCTGGCTCTTGTGG + Intergenic
1175875031 20:62225376-62225398 AGTTACAGCCAAGGCACCTGTGG + Intergenic
1176456128 21:6913067-6913089 TGTTATTCCCATGGGTCCTCAGG - Intergenic
1176834301 21:13778115-13778137 TGTTATTCCCATGGGTCCTCAGG - Intergenic
1176871675 21:14087582-14087604 TGATACCGCCATGCTTCCTGAGG - Intergenic
1178194968 21:30334215-30334237 TGTTACTGCCATCAGTGCTGTGG + Intergenic
1179187606 21:39096928-39096950 TGCTGCAGCTATGGGCCCTGGGG - Intergenic
1180100894 21:45584906-45584928 TGATACAGAAATGGGCCCTGGGG + Intergenic
1181920082 22:26313756-26313778 TTTTACAGCCATGTGTGGTGGGG + Exonic
1184728301 22:46358602-46358624 TGTGCCAGCCTTGGGTGCTGGGG - Intergenic
950215023 3:11153340-11153362 TGTTACCGACATGGGCCCTGAGG + Intronic
950425127 3:12921044-12921066 TGTCTCAGCCATGGCTACTGAGG + Intronic
955801243 3:62688890-62688912 TGGTACAGCAATGGGTAATGTGG + Intronic
957447948 3:80339064-80339086 TGTTACAGCCATTGCCACTGTGG - Intergenic
961331745 3:126146724-126146746 TGTTACACTCATGGATCATGTGG - Intronic
962579723 3:136787137-136787159 TCTTACACCCATGGATCCTTGGG - Intergenic
964034157 3:152175698-152175720 TGTTACATCCATGGGATTTGAGG + Intergenic
964397109 3:156257124-156257146 TGGTACACTCATGGGTCATGAGG - Intronic
964598693 3:158470037-158470059 TGTTACAGCCATGTATCTTAGGG - Intronic
968205347 3:196794766-196794788 GGTTCCTGCCAAGGGTCCTGTGG - Intronic
969507914 4:7599507-7599529 TGATCCAGGCATGGGGCCTGGGG - Intronic
970261575 4:14230484-14230506 AGTCACAGCCATTGGTCTTGTGG + Intergenic
971232056 4:24807900-24807922 GGGTGCAGCCATGGGTCCTCTGG + Exonic
975780995 4:77839676-77839698 TAGTACAGCCAGGGGTTCTGGGG + Intergenic
979392922 4:120148265-120148287 TCTTAGAGCCATGTGTCCTTGGG + Intergenic
985964259 5:3327853-3327875 TGTCACAGCCGCGGGACCTGGGG - Intergenic
986576186 5:9215131-9215153 TGTGAGAGTCATGAGTCCTGAGG - Intronic
987771127 5:22306652-22306674 TATTACAGCTCTGGGTTCTGGGG + Intronic
991588036 5:68219480-68219502 TGGTACAGCCCTTGATCCTGGGG - Intronic
993551021 5:89273854-89273876 TGTAACTGCCATGGATTCTGCGG + Intergenic
994788006 5:104188245-104188267 AGATAAAGCCATGGGGCCTGAGG + Intergenic
998923836 5:147100856-147100878 TGTGAAAGCCATGGGTCAGGTGG - Intergenic
999047629 5:148486342-148486364 TGTTAAAGCCATGTGCACTGAGG - Intronic
1007053108 6:38853197-38853219 TGTTATGGCCAAAGGTCCTGTGG + Exonic
1011084654 6:83525723-83525745 TGTTGCAGCCTTGGTTCCTAAGG - Intergenic
1017066320 6:150532600-150532622 TTTTACAGACTTGGGTGCTGTGG - Intergenic
1017087125 6:150723963-150723985 TGTAACAGCCAGGGTTCCTTGGG + Intronic
1017327059 6:153151880-153151902 AGATAAAGCCATGGGGCCTGAGG + Intergenic
1017614536 6:156230369-156230391 TGATGCAGGCAGGGGTCCTGTGG - Intergenic
1019560006 7:1651205-1651227 AGATACAGCCCTGGGTCCTCAGG + Intergenic
1019646429 7:2131803-2131825 TGTGACAGCCATCGCACCTGGGG + Intronic
1021382171 7:19981298-19981320 TGGTAAAGCCATGGGTCCCCAGG + Intergenic
1022680804 7:32543675-32543697 TGTGACAGCAATGGTTCCAGAGG - Intronic
1023031836 7:36096499-36096521 TGGCACAGCCATGGGGACTGGGG - Intergenic
1031146344 7:118001530-118001552 TGTTACTGGCATGGGCACTGAGG - Intergenic
1031979037 7:128112550-128112572 GGTTACAGCCAGGGGTCCCGGGG - Intergenic
1032703198 7:134399661-134399683 TGTTGCAGCCTTGAGTCCTCAGG + Intergenic
1034983921 7:155496117-155496139 TGTTCCAGGCATGGCCCCTGGGG + Intronic
1035732691 8:1863963-1863985 AGTCACAGCCGTGGCTCCTGTGG + Intronic
1036123102 8:6039155-6039177 TGATGCAGCCATGAGTCCAGAGG - Intergenic
1037210060 8:16375608-16375630 TGATTCAGGCATGGGTCTTGGGG + Intronic
1037653109 8:20858423-20858445 TGGTACAGCCAAGGCTCCGGGGG - Intergenic
1040393313 8:46968821-46968843 TGCTACAGTTATGTGTCCTGAGG + Intergenic
1042543515 8:69930639-69930661 AGTTAAGGCCATGGGACCTGGGG + Intergenic
1048275496 8:133062679-133062701 TGTCACAGGCATGCTTCCTGAGG - Intronic
1048275504 8:133062724-133062746 TGTCACACCCATGCTTCCTGAGG - Intronic
1048438225 8:134437631-134437653 TGTTACAGTCATGGGCTCTTGGG + Intergenic
1048978419 8:139688950-139688972 AGTTACATCCAGAGGTCCTGGGG - Intronic
1048988928 8:139750101-139750123 TGGGACAGCCAGGGCTCCTGTGG - Intronic
1049373328 8:142277974-142277996 TCTTGCAGCCAAGGGTCCTATGG - Intronic
1052595817 9:30557161-30557183 TGTCACAACCATGTGTCCTCAGG + Intergenic
1053402040 9:37833631-37833653 TGTTACAGTCATGTATGCTGGGG + Intronic
1056145291 9:83722892-83722914 TGTTTCAGCCTTGGGAACTGTGG + Intergenic
1056727314 9:89131579-89131601 TGTACCAGCCTTGCGTCCTGGGG - Intronic
1057722393 9:97543544-97543566 TTTTACAGCCATGGAAACTGAGG + Intronic
1058365429 9:104203137-104203159 TGTTACAGCAGTGTGTCTTGTGG + Intergenic
1058800793 9:108542908-108542930 TGTTAAAACCATGTGTCCTGAGG + Intergenic
1060180360 9:121529564-121529586 TGACAAAGCCATGCGTCCTGTGG + Intergenic
1060521607 9:124297211-124297233 TGTGACAGACATGGGGCCTGAGG - Intronic
1060634468 9:125189360-125189382 TGTTACAGCTGCGGGTCCTGGGG + Intronic
1061456449 9:130701612-130701634 TTTCACAACCCTGGGTCCTGCGG + Intronic
1061707868 9:132466832-132466854 TGTCACAGCCAGGTGTCCTGGGG + Intronic
1062524440 9:136972575-136972597 TGTGACTGCCAGGGGTCCTGGGG + Intergenic
1186528039 X:10267857-10267879 AGTTATAGCCATGGGACCAGAGG + Intergenic
1186780766 X:12909810-12909832 CTTTACAGACATGGGACCTGAGG - Intronic
1187564201 X:20432478-20432500 TTTTTCAGCCATGTGTCCTGGGG + Intergenic
1200729999 Y:6724426-6724448 TGTTACAGCGTGGGGGCCTGGGG + Intergenic
1201470326 Y:14326148-14326170 GGATAATGCCATGGGTCCTGGGG - Intergenic
1201531896 Y:15000074-15000096 TGTTGCAGCCAAGAGTACTGGGG - Intergenic