ID: 1106134164

View in Genome Browser
Species Human (GRCh38)
Location 13:26961908-26961930
Sequence GAAGGTGCACAGAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106134164_1106134176 23 Left 1106134164 13:26961908-26961930 CCATGCTGCCTCTGTGCACCTTC 0: 1
1: 0
2: 4
3: 37
4: 436
Right 1106134176 13:26961954-26961976 GCCACCCTCCCACCCTCTGTTGG 0: 1
1: 0
2: 7
3: 45
4: 316
1106134164_1106134171 0 Left 1106134164 13:26961908-26961930 CCATGCTGCCTCTGTGCACCTTC 0: 1
1: 0
2: 4
3: 37
4: 436
Right 1106134171 13:26961931-26961953 CCACGCCCACGGAGCCTCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1106134164_1106134172 1 Left 1106134164 13:26961908-26961930 CCATGCTGCCTCTGTGCACCTTC 0: 1
1: 0
2: 4
3: 37
4: 436
Right 1106134172 13:26961932-26961954 CACGCCCACGGAGCCTCTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1106134164_1106134169 -1 Left 1106134164 13:26961908-26961930 CCATGCTGCCTCTGTGCACCTTC 0: 1
1: 0
2: 4
3: 37
4: 436
Right 1106134169 13:26961930-26961952 CCCACGCCCACGGAGCCTCTTGG 0: 1
1: 0
2: 3
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106134164 Original CRISPR GAAGGTGCACAGAGGCAGCA TGG (reversed) Intergenic
900090658 1:919006-919028 GAAGGAGCAGGCAGGCAGCAGGG + Intergenic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
900823190 1:4905761-4905783 GAAGGTGCTCAAAGGAAGCAAGG - Intergenic
901069848 1:6511645-6511667 GATGGGGGACTGAGGCAGCAGGG + Intronic
901756055 1:11442277-11442299 GAAGGGGCATCGTGGCAGCATGG + Intergenic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902748856 1:18492602-18492624 GAAGGTTTCCAGAGGCAGCAAGG + Intergenic
902854134 1:19187637-19187659 GAAGGTCCACAGAGTCTGAAAGG - Intronic
903193221 1:21668280-21668302 GAAGGGGCACTGAGGCAGGAGGG - Intronic
904277698 1:29394978-29395000 GCAGGTGGACAGAGGCAGGAAGG + Intergenic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
904375826 1:30081885-30081907 GGAGGAGCAGAGAGGCAGAAAGG - Intergenic
904412516 1:30332961-30332983 GCAGGGGCACAGGGGCAGGAAGG + Intergenic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
904497100 1:30893181-30893203 GGAGGTGCACAGAGATTGCATGG - Intronic
904601789 1:31676998-31677020 GATGGTGCACAGAGGTGCCAGGG - Intronic
904726883 1:32555643-32555665 GAAGGGGCTCAGAGGAAGCATGG - Intronic
905632152 1:39524862-39524884 GCAGGTGGTCCGAGGCAGCACGG + Intronic
905960524 1:42038779-42038801 GAAGGTGCAGATAGGCAGCCTGG - Intergenic
906501244 1:46342885-46342907 GAAGGACCAGAGAGGCAGGAGGG - Intronic
906763661 1:48406093-48406115 CAAGGTGCACATGTGCAGCAGGG + Intronic
907011055 1:50963559-50963581 GAAATTGTACAGAGGCAACATGG - Intronic
907285937 1:53379605-53379627 GAAGGTGCAGGGAGGCAGGTTGG + Intergenic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
908014106 1:59814470-59814492 GAAGAGGCAGAGGGGCAGCAGGG - Intergenic
911779098 1:101852915-101852937 GAAGCAGCACAGTGGCAGCTGGG - Intronic
911846621 1:102760719-102760741 GAAGCTGAGCAGAGGAAGCAGGG - Intergenic
912451796 1:109771990-109772012 GTGTGTGCACAGAGCCAGCATGG + Intronic
912747620 1:112258497-112258519 CATGGTGCAGAGAGGAAGCAAGG - Intergenic
912756061 1:112325659-112325681 GCAGCTGCTCAGAGGCAGCGTGG - Intergenic
913252378 1:116922554-116922576 GGAGGGCCACAGAGGTAGCAAGG + Intronic
915227397 1:154421139-154421161 GAAGCAGCGCAGAGGCAGGAGGG - Intronic
916470756 1:165119947-165119969 CAAAGTGCACAGTGGGAGCAGGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917589907 1:176465788-176465810 GAAGGTGGAGAGTGGCAGGAGGG - Intronic
918071663 1:181137679-181137701 GAAGGAGCCCAGAGCCAGGAAGG - Intergenic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
919727848 1:200895410-200895432 GAAGGGGCACAGAGGGAGGGAGG - Intronic
920053028 1:203174892-203174914 GGAGGGGGACAGTGGCAGCAGGG + Intronic
920167514 1:204046074-204046096 GGAGGGGCTCAGTGGCAGCAAGG + Intergenic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920436547 1:205950513-205950535 CAGGGAGCTCAGAGGCAGCAGGG + Intergenic
920572378 1:207027388-207027410 GAAGGTGCAGTGAGCCAGGATGG + Intronic
920680021 1:208065086-208065108 GAAGGAGCTGAGAGGCTGCAGGG + Intronic
921073766 1:211683811-211683833 CAAGGTGCAAACAGGCAGGAGGG - Intergenic
921187877 1:212685396-212685418 GAAGGGGCTCAGATGCAGCGAGG - Intergenic
921268499 1:213446048-213446070 GAAGGCTCCAAGAGGCAGCATGG - Intergenic
921629556 1:217417340-217417362 TAAGGTGCTGAGATGCAGCATGG - Intergenic
924477446 1:244394600-244394622 GAAGCAGCACAGGGGCAGCTTGG + Intergenic
1062987823 10:1785700-1785722 GCAGGTGCACAGAGGCTGACGGG - Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1064763792 10:18650277-18650299 AAAGTTGCTTAGAGGCAGCATGG + Intronic
1065703621 10:28449105-28449127 GAAGGTACAAAGAGGCAAGAAGG + Intergenic
1066617208 10:37307620-37307642 GAAGGGGCTCAGAGGTAGGAGGG + Intronic
1067687149 10:48472647-48472669 GAAGCAGCACAGAGGCAGATGGG - Intronic
1067714947 10:48683648-48683670 GAACTTCCACAGAGGCAGGAAGG - Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1067944949 10:50683497-50683519 GAAGGTACACTGAGGCAGAGAGG - Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068657261 10:59588498-59588520 GACCATGCACAGAGTCAGCAGGG + Intergenic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1070383845 10:75905991-75906013 GAGGGTGCAGAAAGGTAGCATGG + Intronic
1070596857 10:77838533-77838555 GAGGGAGCAAAGAGGTAGCATGG - Intronic
1070665726 10:78342132-78342154 TAAGGTGCAGAGAGGCACCAAGG - Intergenic
1070677274 10:78420758-78420780 GAGGGGCCAGAGAGGCAGCATGG + Intergenic
1070841013 10:79487910-79487932 GAAGGAGCACAGAGGAGCCAGGG - Intergenic
1070866450 10:79710368-79710390 GAAGGTACACTGAGGCAGAGAGG - Exonic
1070880243 10:79848499-79848521 GAAGGTACACTGAGGCAGAGAGG - Exonic
1071633360 10:87232589-87232611 GAAGGTACACTGAGGCAGAGAGG - Exonic
1071646809 10:87364807-87364829 GAAGGTACACTGAGGCAGAGAGG - Exonic
1072284001 10:93895207-93895229 GAAAGTGCACAAAGGGAGGAGGG - Intronic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1072754835 10:98012428-98012450 GGAGGTCCACAAAGGCTGCATGG + Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1074982556 10:118631424-118631446 TAAGATGTACAGGGGCAGCAGGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075370766 10:121932957-121932979 GGAGGTGAACAGGAGCAGCAGGG + Intergenic
1075857025 10:125638222-125638244 GAAGGGGAGCAGGGGCAGCACGG - Intronic
1076208984 10:128625621-128625643 CACGGTGCACAGAGGCTGCCTGG + Intergenic
1076445839 10:130513264-130513286 CAAGGGGCTCAGTGGCAGCAGGG - Intergenic
1076570460 10:131429399-131429421 GAAGGAGCCAAGAGGGAGCAAGG - Intergenic
1076607672 10:131700160-131700182 GGAGGTGGACAGAGGCACCAGGG - Intergenic
1076638157 10:131896421-131896443 GAGGGTGCACAGGGTGAGCAGGG + Intergenic
1076692735 10:132232052-132232074 GCAGGTGCTCAGAGTCTGCAGGG - Intronic
1076813576 10:132902199-132902221 TCAGGAGGACAGAGGCAGCAGGG - Intronic
1078544751 11:12239292-12239314 GAAGGGAGGCAGAGGCAGCAGGG - Intronic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1078713597 11:13818175-13818197 GAAGGTGGACTGAGGAACCAAGG + Intergenic
1079132124 11:17753198-17753220 GGCAGTGCAGAGAGGCAGCAAGG + Intronic
1079714690 11:23730777-23730799 GAAGCTGGAGAGAGGCAGCGAGG + Intergenic
1080704696 11:34679451-34679473 GCATGTGCACAGAGACAGCCTGG - Intergenic
1082216084 11:49571467-49571489 GAAGGGGCTGTGAGGCAGCAAGG + Intergenic
1083224407 11:61275733-61275755 CAAGGGGCACAGAGTCAGCAGGG + Intronic
1083757991 11:64801709-64801731 GAAGATCCACAGAGACATCAAGG - Exonic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1086931708 11:92700457-92700479 GAGGGTGACCAGTGGCAGCAGGG + Intronic
1088831285 11:113539102-113539124 GAGGGGGCACAGAAGCAGCCTGG + Intergenic
1089282681 11:117385445-117385467 GAACTTGCACAGAGGCAACCTGG - Intronic
1089387393 11:118077284-118077306 GGAGGATCACAGAGCCAGCATGG + Exonic
1090393349 11:126403674-126403696 GAAGATGGAGAGAGGGAGCAGGG + Intronic
1091160708 11:133417042-133417064 TAAGGTGCCCAGAGAGAGCAGGG + Intronic
1091285532 11:134406502-134406524 GAAGGGTCACAGAGGTAGCCAGG + Intronic
1091554897 12:1565366-1565388 GAAGTTGCATTGGGGCAGCAGGG + Intronic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1092741063 12:11630091-11630113 GATGGGGCACAGAAGCAGGAAGG - Intergenic
1095282246 12:40367056-40367078 GAAGGTACACAAAAGCAGAAAGG + Exonic
1095557207 12:43522167-43522189 GAAGGTGAAGTGAGGAAGCAAGG + Intronic
1096598044 12:52709696-52709718 GCAGGAGCACAGAGGCACCTGGG - Intergenic
1096600558 12:52725565-52725587 GAGGGATCACAGCGGCAGCAGGG + Intergenic
1098190080 12:67938638-67938660 GAAGGGGGAAAGAGGCAGCGTGG + Intergenic
1100242389 12:92722567-92722589 GAATTTGCACATAGGGAGCAGGG - Intronic
1102537890 12:113594960-113594982 GAAGGTGGACAGTGGGAGGAGGG - Intergenic
1103052301 12:117790801-117790823 GAATGTGCACAGAGGTAGTGTGG - Intronic
1103217084 12:119210268-119210290 GAAGGGGCACAAAGGGAACAGGG - Intronic
1103249162 12:119485269-119485291 GATGGTGCAAAGAGCAAGCATGG + Intronic
1103725600 12:122996032-122996054 ATAGGTGCCCAGAGGCGGCAGGG - Intronic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1104260032 12:127173712-127173734 GAAGGTGAGCAGAGGCTGCCTGG - Intergenic
1104630231 12:130394355-130394377 GGAGGTGCACGGAGCCAGCCAGG + Intergenic
1105308416 13:19185291-19185313 GCAGGGCCAGAGAGGCAGCATGG + Exonic
1105956238 13:25285989-25286011 GAAGGTGCACAGAGGAAAAGAGG - Intronic
1106026432 13:25960084-25960106 GAAGGGGCCCAGAGGCAGGAGGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106147676 13:27064781-27064803 GCAGGTTCACAGAGGCCGCGGGG + Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1108530903 13:51326145-51326167 GAGGGTGCATAAAGGCAGGAGGG - Intergenic
1108559142 13:51626064-51626086 GAAGGAGGACAGATGCAGAAGGG + Intronic
1108917852 13:55637771-55637793 GAAGGAGCAAAGAGACAGAAAGG + Intergenic
1109270740 13:60252530-60252552 GAATTTGCATAGAGGCATCATGG + Intergenic
1109901607 13:68780208-68780230 GAGGGTGGACAGTGGGAGCAGGG + Intergenic
1111430782 13:88145989-88146011 TAAGGGGCCCAGAGGCAGGATGG + Intergenic
1113075309 13:106462205-106462227 GAAGTTGCAGAGAGACAGCTTGG + Intergenic
1113381226 13:109808032-109808054 CACGGTGCACAGAAGCAGCCTGG + Intergenic
1113936682 13:113998578-113998600 GAAGGGGCACTGAGTCACCAGGG + Intronic
1113941607 13:114021187-114021209 GCAGGTGAGGAGAGGCAGCAGGG - Intronic
1114195443 14:20472202-20472224 GCAGGTATACTGAGGCAGCAGGG - Intronic
1114550240 14:23528587-23528609 GATGGTTCACAGAGGCAGAGTGG - Intronic
1114555379 14:23559222-23559244 GAAGATGAGGAGAGGCAGCAGGG + Exonic
1116322608 14:43490107-43490129 GAATGTGCACATAGGAAACAAGG - Intergenic
1116439239 14:44932522-44932544 GAAGGTGCACAAAGGCACAGAGG + Intronic
1118038323 14:61892101-61892123 GAAGGGGCAGAGATGCAGAAAGG - Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119124427 14:72112419-72112441 AAAGGTGCTGAGTGGCAGCAGGG + Intronic
1120646926 14:87085418-87085440 GATGTTGCACAGGGGCATCAGGG - Intergenic
1121602224 14:95213790-95213812 GAAGGGACATCGAGGCAGCAAGG - Intronic
1121825687 14:97008027-97008049 GGAGCTGCACACTGGCAGCAGGG + Intergenic
1122370393 14:101226158-101226180 GAAAGGGCACAGCAGCAGCAGGG + Intergenic
1122474801 14:101999898-101999920 AATGGTGCACAGAGCCTGCAGGG - Intronic
1123132576 14:106000142-106000164 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1123448336 15:20345253-20345275 GATGGTGGAGAGAGGCAGAAAGG - Intergenic
1123582756 15:21731119-21731141 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1123619406 15:22173715-22173737 GAGGGTGCTCAGAAGCACCAGGG - Intergenic
1124664913 15:31584070-31584092 GAAAGAGCACAAAGACAGCAGGG + Intronic
1124831545 15:33154081-33154103 GCAGCTCCACAGAGGCAGGAGGG - Exonic
1127243869 15:57150189-57150211 GAAGGAGCAGAGAGAGAGCAAGG + Intronic
1127309139 15:57737021-57737043 AAAGTTGCAAAAAGGCAGCATGG + Intronic
1127332285 15:57950907-57950929 GCAGGGCCACAGAAGCAGCATGG + Intergenic
1127707660 15:61562976-61562998 GAAGGTGCAGAGAAAGAGCATGG - Intergenic
1127857731 15:62966559-62966581 GAAGGTGCTCAGAGGCAGGCTGG - Intergenic
1129485942 15:75872040-75872062 AAAGGTGCACACAGGGAGAAGGG + Intronic
1129854952 15:78816970-78816992 GAAGGAGCACTGAGGGACCAGGG - Intronic
1130054616 15:80511785-80511807 GAAGGAGCAGAGAGGCAGGTGGG + Intronic
1130265920 15:82403062-82403084 AAAGGTGCACACAGGGAGAAGGG + Intergenic
1130506101 15:84543823-84543845 AAAGGTGCACACAGGGAGAAGGG - Intergenic
1131436816 15:92429573-92429595 GAAATTCAACAGAGGCAGCAAGG - Intronic
1132212705 15:100036206-100036228 GAGGGTGCAGAGAGGCAGCAAGG + Intronic
1132552713 16:560057-560079 GGGGGTGCACAGAGGCCGCCAGG - Intergenic
1135074720 16:19383364-19383386 GAGGGTGCACGGAGGGAGCCGGG - Intergenic
1135248799 16:20882214-20882236 GAAGGTGCTCAGGGGCAGAGAGG - Intronic
1137252197 16:46748522-46748544 GAATCTGCCCAGAGCCAGCAGGG + Intronic
1137543723 16:49383165-49383187 AAAGGTGCTCAGAGGCATCTAGG + Intronic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1140581237 16:76233691-76233713 GTAGATGCAGATAGGCAGCAAGG - Intergenic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142113217 16:88342926-88342948 GGAGGGGCACAGGGGCAGCAAGG + Intergenic
1142267731 16:89072244-89072266 GAAGGGACACCGAGGCACCAAGG + Intergenic
1142975182 17:3639164-3639186 GACTGTGTACTGAGGCAGCACGG + Intronic
1143135863 17:4711910-4711932 GGAGGTGCCCAGTGGGAGCAGGG - Intronic
1143622207 17:8087166-8087188 GAAGGTGCGCAGGGGGAGCCAGG - Intronic
1143971292 17:10797831-10797853 GAAGCAGCAGAGAGACAGCAAGG - Intergenic
1144234079 17:13239882-13239904 GCAGGTGCACAGAGGTGGAAGGG - Intergenic
1144571906 17:16405591-16405613 GAGGGTGCAAAGGGGCACCAGGG + Intergenic
1144866178 17:18337423-18337445 GGAGGAGCACAGAGGCAACGGGG + Intronic
1144874138 17:18388391-18388413 GACACAGCACAGAGGCAGCAGGG - Intronic
1145238114 17:21223316-21223338 GAAGGTGCAATGAGGCCACAGGG - Intergenic
1145747252 17:27329439-27329461 GAAGGACCACAGAGGCCACACGG + Intergenic
1145905450 17:28513853-28513875 GAAGGTGCCCAGAGGCAGCCAGG + Intronic
1146689807 17:34865505-34865527 GAAGGTGGAGAGAGGCAGCCTGG + Intergenic
1147219437 17:38919776-38919798 GGAGCTGCACAAAGTCAGCAGGG + Exonic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1147925201 17:43941607-43941629 GCAGGTGGACAGGAGCAGCAGGG + Exonic
1150459609 17:65337734-65337756 GAAGGGGCAGAGAGGAAGAAAGG + Intergenic
1150632863 17:66892272-66892294 GAAAGGGCTCAGAGGCAGAAGGG - Intergenic
1151059650 17:71077304-71077326 GAATGGGCACAGATGCAGAAAGG - Intergenic
1151464293 17:74274565-74274587 CAGGGTGTACAGAGGCTGCAGGG - Intronic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1152467727 17:80475469-80475491 GCAGGTGCAGGCAGGCAGCACGG + Intronic
1152750881 17:82061956-82061978 GACGGTGCACGGACGCACCAAGG - Exonic
1152876656 17:82790294-82790316 TCAAGGGCACAGAGGCAGCATGG - Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1157731928 18:50011487-50011509 GAAGGTGCACAGGCGCTCCAAGG + Intronic
1157733217 18:50022776-50022798 GAAGGGTCACAGAGGAACCAAGG + Intronic
1159527826 18:69616388-69616410 GAAGGAGCACAGGGCCAGCTAGG - Intronic
1160311059 18:77790630-77790652 GTAGGTGCTCAGAGGGAGAAAGG + Intergenic
1160824590 19:1073827-1073849 CAAGGCGCACAGGGGAAGCAGGG - Intronic
1161028612 19:2047916-2047938 GTAGGTGCACAGAGCTGGCAGGG - Intronic
1161041049 19:2110968-2110990 TAATGACCACAGAGGCAGCAGGG + Intronic
1161467951 19:4442606-4442628 AAGGCTGCACTGAGGCAGCAAGG + Intronic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162723207 19:12674580-12674602 CAAGGTGGAAAGAGGAAGCATGG + Intronic
1162753538 19:12843494-12843516 CAAGGTGCTCAGAGGCCACAAGG - Intronic
1163541915 19:17916593-17916615 CAAGGTGAACAAAGGCTGCAGGG + Intergenic
1163690031 19:18733513-18733535 GAGGGAGCAAGGAGGCAGCAGGG + Intronic
1164064772 19:21706440-21706462 GAAGGAGCACGGAGTCACCATGG + Intergenic
1164155864 19:22596524-22596546 GAGGGAGCCCAGAGGCAGCTGGG - Intergenic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1165306359 19:35005248-35005270 GAAGGTCCCGGGAGGCAGCAGGG + Intronic
1165844034 19:38806643-38806665 GAAGGTACAAACAGGAAGCAAGG + Intronic
1166179154 19:41094885-41094907 GAAAGTACACAGGGGCTGCAGGG - Intronic
1166960906 19:46495319-46495341 GAACGTGCCCAGGGGCAGGAGGG + Exonic
1166966778 19:46533794-46533816 GAACGTGCCCAGGGGCAGGAGGG - Intronic
1167384337 19:49155350-49155372 GAAGGTGGACAGAGACCGAAAGG - Exonic
925048131 2:789965-789987 GGAGGTGGGCTGAGGCAGCAGGG - Intergenic
925084518 2:1097470-1097492 GGGGGCGCACAGAGGCAGCCTGG - Intronic
925207629 2:2020917-2020939 GGAGCTGCTCAGAGGCAGCTGGG - Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925871957 2:8279235-8279257 GAAGCTTGGCAGAGGCAGCAGGG - Intergenic
925999596 2:9319518-9319540 GCAGGTGCGCACAGGGAGCAGGG + Intronic
926698565 2:15787482-15787504 GAAAGTCCACAGAGAAAGCAGGG + Intergenic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927490583 2:23518573-23518595 GAAGGTGCACAGAGCCTTCCCGG - Intronic
927699448 2:25258670-25258692 GAAGGAACTCAGAGGCAGCTGGG + Intronic
927913054 2:26915122-26915144 GGAGGTGCACAGAGGTGGCTGGG - Intronic
928165155 2:28965860-28965882 GAAGGGTAACAGAGGAAGCAAGG - Intronic
928284110 2:29974080-29974102 GCAGGAGCACAGAATCAGCATGG + Intergenic
928651834 2:33411914-33411936 GAAAGTGCACAGAGACCACAGGG - Intergenic
929180319 2:39030999-39031021 GAAGCTAGGCAGAGGCAGCAGGG + Intronic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
929810449 2:45185074-45185096 GAAGCTTCACAGAGGAAGGAAGG - Intergenic
930165182 2:48197397-48197419 GAGGCTGCACACAGGCACCAAGG + Intergenic
931218695 2:60269729-60269751 CAAGGGGCACACAGGCAGCCAGG + Intergenic
932571065 2:72938634-72938656 GCAGGTGGACAGATGCAGAATGG + Intergenic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935171405 2:100613619-100613641 GAAGGCACAGAGAGGCAGAAGGG - Intergenic
935228484 2:101075651-101075673 GAAGGTGCAAAGGAGAAGCAAGG - Intronic
935434014 2:103008721-103008743 GACGGGGAGCAGAGGCAGCAAGG - Intergenic
936283139 2:111160124-111160146 GAAGCTGGGCAGAGGCAGCAAGG - Intronic
937714319 2:125014275-125014297 CACAGTGCACAAAGGCAGCAAGG - Intergenic
938723101 2:134083767-134083789 GAAGGAGGTCAGAGGTAGCAGGG + Intergenic
940284471 2:152020060-152020082 GAATGTACACATAGGCTGCAGGG - Intronic
941262518 2:163315554-163315576 GATGGAGCAGAGAGGTAGCATGG - Intergenic
942440278 2:176027837-176027859 GAAGGTACAATGAGGCAGAAAGG + Intergenic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
942990510 2:182195370-182195392 GAAGGTGTATAGAGACAGGAAGG + Intronic
943044680 2:182846016-182846038 GAAGCTACTCTGAGGCAGCAAGG - Intronic
943137750 2:183937310-183937332 GATGGTGCACACAGGCACAATGG - Intergenic
946023819 2:216659918-216659940 GCAGGTACACAGTGACAGCAGGG + Intronic
946175444 2:217919545-217919567 GAAGGTGGCGAGAGGCAGGAAGG + Intronic
948113531 2:235476501-235476523 GAAGGGGGAGGGAGGCAGCATGG + Intergenic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
948727202 2:239942110-239942132 GAAGGTGGACAAAGGCAGTCCGG - Intronic
948858449 2:240741465-240741487 AAAGGGACTCAGAGGCAGCAAGG + Intronic
948859426 2:240745709-240745731 GCAGGGACACAAAGGCAGCAGGG + Intronic
949018629 2:241727919-241727941 GATGGTGCACAGTGGCAGGCAGG - Exonic
1169461830 20:5802234-5802256 GAAGGTGCAAAGAGCAAGCATGG - Intronic
1169758087 20:9064650-9064672 GTGGGGTCACAGAGGCAGCAGGG - Intergenic
1171027127 20:21641028-21641050 GCAGGTGCTCAGATGCAGCCTGG - Intergenic
1171321486 20:24248280-24248302 GAAGGTGCGGAGAGGCTTCATGG + Intergenic
1171412933 20:24958718-24958740 GAAGGGGCACAAACCCAGCACGG + Intronic
1171420197 20:25012750-25012772 GCAGGTCCACAGGGGCATCATGG + Intronic
1172261165 20:33566740-33566762 GAAGGAGCATAGTGGCAGGATGG + Intronic
1173033964 20:39390708-39390730 CCAGGAGCACAGAGGCAGCATGG - Intergenic
1173192221 20:40885472-40885494 GGGGGAGCACAGAGGCAGCTCGG - Intergenic
1173369992 20:42426746-42426768 GAATGTGCACAGTGGCTGAACGG + Intronic
1174533320 20:51231764-51231786 GAAGGTGCTCAGAGGATGGAAGG + Intergenic
1177803751 21:25854021-25854043 GAAGGAAGACAGAAGCAGCAGGG + Intergenic
1178218281 21:30625601-30625623 AAGGCTGCACAGGGGCAGCAGGG + Intergenic
1179501975 21:41815780-41815802 GAAGCTGCACAAGGGCATCAAGG - Exonic
1179971377 21:44838058-44838080 GAAGGTGCACACAGCGCGCAGGG + Intergenic
1180230155 21:46422232-46422254 GCAGGTGCTCAGAGGCACCCAGG - Intronic
1181050222 22:20234826-20234848 GGAGGGGCACAGAGACAGCCTGG - Intergenic
1181661612 22:24354537-24354559 GAAGGTGCATTGAGAAAGCAAGG - Intronic
1181772311 22:25134695-25134717 AAAGCTGCAGAGCGGCAGCATGG - Intronic
1182097097 22:27633344-27633366 GGAGGTGGACAGCGGGAGCAGGG + Intergenic
1182098081 22:27639268-27639290 CGGGGTGCAGAGAGGCAGCAGGG - Intergenic
1182245235 22:28951997-28952019 CAAGGAGCACTGAGCCAGCATGG + Intronic
1182249300 22:28987296-28987318 GAAGGAGCACTGTGCCAGCATGG - Intronic
1182494341 22:30695442-30695464 GAAGCTGTCCAGAGGCAGTAAGG - Exonic
1182781228 22:32869599-32869621 TACGCTGCAGAGAGGCAGCAGGG + Intronic
1182787170 22:32917631-32917653 GAAAGTGCACAGGGTCAGCGGGG + Intronic
1182880049 22:33725289-33725311 GCAGGAGCACAGAGGCGACAGGG + Intronic
1182942406 22:34289307-34289329 ACAGTTGCACAGGGGCAGCATGG + Intergenic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183080760 22:35454541-35454563 GAAGGTGGACACAGTCAGGAGGG + Intergenic
1183345803 22:37307063-37307085 GGAGGGACACAGAGCCAGCAGGG + Intronic
1183661605 22:39224759-39224781 CACTGTGCACAGAGGCACCAGGG + Exonic
1183782036 22:40005123-40005145 GGAGGTGCTGAGACGCAGCAAGG - Intronic
1183835162 22:40446521-40446543 GGAGGGCCACAGAGGCAGGAGGG + Intronic
1184171987 22:42765287-42765309 GGAGTCGCACAGAGGCCGCATGG + Intergenic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
1184654355 22:45933613-45933635 GAAGGGCCACAGAGGGATCATGG + Intronic
1184735686 22:46396571-46396593 GAAGGTGCAGGGAGGCACCAGGG + Intronic
1184957573 22:47901965-47901987 GAAGGGGCATGGAGGCAGCGGGG - Intergenic
949163363 3:908921-908943 GAAGGGGCGAGGAGGCAGCAAGG + Intergenic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
950646780 3:14382079-14382101 GGTGGGGCACAGAGGGAGCAAGG + Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951064076 3:18243820-18243842 TGAGGAGCACAGAGGCACCAAGG - Intronic
952728994 3:36619533-36619555 GAAGGAGCACAAAGGCAGGGTGG - Intergenic
953638539 3:44684433-44684455 GGAAGTGCAAAGAGGCATCAGGG - Intergenic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
955693501 3:61612980-61613002 GAAGGTGAGCACAGACAGCAAGG - Intronic
959562636 3:107799933-107799955 GGAGGTGCTGAGAGGCAGAAAGG - Intronic
961268701 3:125671527-125671549 GGAGGTGCCAAGAGCCAGCAAGG - Intergenic
961429105 3:126867786-126867808 GAGGGAGGACAGAGACAGCATGG - Intronic
961558794 3:127714733-127714755 GAGTGTGCAAAGAGGCAGGAGGG + Intronic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
965295367 3:166938556-166938578 GAAGGTGGAGGGAGGTAGCAGGG - Intergenic
966009954 3:175062850-175062872 GAAAGTGCTCATAGGCTGCAAGG + Intronic
966321439 3:178705340-178705362 GCTGCTGCACAGTGGCAGCATGG - Intronic
967044998 3:185728242-185728264 GAAGGGGCCCAGGAGCAGCAAGG - Intronic
967522699 3:190453153-190453175 GAAGGTCCAAAGAGCAAGCAAGG + Intergenic
968439180 4:612933-612955 GCAGCTGCACACAGGCAGGAAGG + Intergenic
969065638 4:4478350-4478372 GAAGGTTCACAAATACAGCAAGG + Intronic
969618174 4:8265659-8265681 GAAGGTGGACAGAGGCCGAGCGG + Intergenic
970093646 4:12437480-12437502 AAAGGTGGACAGAGGGAGCGGGG + Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
972190361 4:36584067-36584089 TAAGATGCACAGAGACAGCGTGG + Intergenic
973824062 4:54687536-54687558 GAAGATGCAAAGGGGCAGAAAGG - Intronic
976898555 4:90142698-90142720 GAAGGTAGCCAGAGGCTGCAGGG - Intronic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
978389066 4:108205556-108205578 GAAGGTGCTGAGAAGCAACATGG - Intergenic
978631602 4:110753409-110753431 GAAGGTGAGCAGAGCCAGCATGG + Intergenic
978953904 4:114593202-114593224 GAAAGTTCCTAGAGGCAGCAGGG - Intergenic
980178853 4:129380004-129380026 GAAGGAGAATTGAGGCAGCATGG + Intergenic
982147918 4:152417830-152417852 GGAGAAGCCCAGAGGCAGCAAGG - Intronic
983584179 4:169338223-169338245 GAAGTTTAACAGAAGCAGCAGGG - Intergenic
985904442 5:2822735-2822757 GGAGGGGCACAGAGTCAGGAGGG - Intergenic
986168585 5:5296934-5296956 GAAGGGGCACAGAAGCGGCAAGG + Intronic
988991641 5:36677257-36677279 GAAGGTGCCACGAGGCAGGATGG + Intronic
989574590 5:42978709-42978731 GACGGTGCAAAGAGGGAGAAGGG - Intergenic
989989876 5:50749497-50749519 GTAAGTACATAGAGGCAGCAGGG + Intronic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
995402374 5:111757519-111757541 GCGGCTGCACAGTGGCAGCAAGG - Intronic
996538072 5:124599431-124599453 GAAGCTGAACAGAAGCTGCAGGG - Intergenic
999254686 5:150203706-150203728 GAAGGGTGACAGAGGCAGCATGG - Exonic
1001056426 5:168453908-168453930 GCAGGTGAACAGAGGCAGAGCGG + Intronic
1001419739 5:171577585-171577607 GATGATGCAGAGAGGCAGCCTGG + Intergenic
1001483883 5:172106118-172106140 TCAAGTGCACAGAGGCAGCACGG + Intronic
1002174544 5:177394094-177394116 GCAGGTGCACAGCAGCACCAGGG - Exonic
1002326860 5:178415462-178415484 GCCTGTGCAGAGAGGCAGCAGGG - Intronic
1002809432 6:612981-613003 GGAGGTGCCCAGAGGCACCAAGG + Intronic
1002820977 6:724380-724402 GAAAGAGCACAAAGTCAGCATGG + Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003329484 6:5117946-5117968 GAAGGTACTCAAAGGCAACAGGG - Intronic
1003442215 6:6153645-6153667 GCAGGTGCACCTAGACAGCATGG + Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1005700218 6:28393354-28393376 AAAGGTGAAAAGAGGCAGAAAGG + Intronic
1006499359 6:34448149-34448171 GCAGGTGCACATAGGCAGAAAGG + Intergenic
1006952230 6:37832283-37832305 AAAGGAGAAGAGAGGCAGCAGGG + Intronic
1007029479 6:38615130-38615152 GAAGGTGAAAAGAAGAAGCATGG - Intronic
1007928082 6:45665994-45666016 GGTGGTGGAGAGAGGCAGCAGGG + Intergenic
1009985912 6:70780768-70780790 GAAGAGACACAGAGACAGCATGG - Intronic
1010041682 6:71391959-71391981 GATGCTGCAAAGAGGCATCAAGG - Intergenic
1012628266 6:101431023-101431045 GGAGGTGTACAGGGACAGCATGG + Intronic
1013432241 6:110065401-110065423 GAAGGGTCACCAAGGCAGCAAGG + Intergenic
1016005175 6:139082161-139082183 GAGGGTGCAGAGAGCCAGAAAGG + Intergenic
1016914193 6:149229594-149229616 GATCCTGCACAGAGTCAGCAGGG + Intronic
1017720870 6:157242282-157242304 GAAGCTGCCCTGGGGCAGCATGG - Intergenic
1017805241 6:157940076-157940098 GCTGGTGCTCAGGGGCAGCAAGG + Intronic
1017949787 6:159127078-159127100 GACAGTGCACAGTGGCAGCCAGG + Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019192312 6:170259411-170259433 GAAGGTGCCCAGACGCCCCAGGG - Intergenic
1019528671 7:1493042-1493064 GTAGGTGCACAGATTCAGAACGG + Exonic
1020021953 7:4874480-4874502 GAAGGTTCACTGAGGCGGCCGGG - Intronic
1020732234 7:11894838-11894860 GAATTTGCACACAGGCAACATGG + Intergenic
1021243561 7:18234718-18234740 GTAGGTTCACAGAGACAGCTGGG + Intronic
1021967711 7:25937914-25937936 GAGGGTGGACAGTGGCAGAAAGG + Intergenic
1022963841 7:35454988-35455010 GGAGGTGCAGAGAGGCCGCTGGG - Intergenic
1024207229 7:47174219-47174241 TTGGGTGCACAGAGACAGCATGG - Intergenic
1024238181 7:47413945-47413967 GGAGGTGTACACAGGCTGCATGG + Exonic
1024270980 7:47641265-47641287 GAAGCTGCTGAGAGACAGCAGGG - Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1024960450 7:54969332-54969354 GGAGGTGACCAGAGGCTGCAGGG + Intergenic
1028727099 7:94100746-94100768 GGAGGTGCCCAGAGCGAGCAAGG - Intergenic
1029186226 7:98740788-98740810 GAAAGTGCTCACAGACAGCACGG - Intergenic
1029987405 7:104934699-104934721 GGAGGTGGACAGAAGCAGCCAGG - Intergenic
1030090070 7:105850632-105850654 GAACGAGCACAGAGCGAGCATGG + Intronic
1031633625 7:124074867-124074889 GAAGGTGGACAGAGTCAGACAGG + Intergenic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1033547502 7:142414796-142414818 GTAGGAGCACAGAGACATCAGGG + Intergenic
1034132715 7:148735324-148735346 GCAGGTGCAGAGCTGCAGCAGGG - Intronic
1035322741 7:158044215-158044237 TAAGTGGCACAGAGGCAGGAGGG + Intronic
1036218831 8:6903603-6903625 GAAGGAGCCCAGGGGCAGCAGGG + Intergenic
1037887933 8:22604858-22604880 GAAGGGGCAGAGGGGCGGCAGGG - Intronic
1038492410 8:27980585-27980607 GAGGGGGTACAGAGGCACCAGGG - Intronic
1038609155 8:29043410-29043432 GACAGAGCACTGAGGCAGCATGG - Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1040026471 8:42786628-42786650 GGAGGTGCCGAGAGGGAGCAAGG - Intronic
1040396975 8:47009589-47009611 GAAGGAGTACCCAGGCAGCAAGG - Intergenic
1040703786 8:50100925-50100947 GAAGGTGGACAGTGGGAGGAGGG - Intronic
1040891455 8:52321238-52321260 GGAGGAGCACAGAGGAAGCTGGG + Intronic
1040903080 8:52437439-52437461 GAAGAACAACAGAGGCAGCAGGG + Intronic
1041424356 8:57703486-57703508 CCAAGGGCACAGAGGCAGCAGGG + Intergenic
1041734823 8:61098754-61098776 GAAGGTTCAGAGAGGCAGACTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045905467 8:107339658-107339680 TCAGCTGCACAGAGGCAGGAAGG + Intronic
1046010725 8:108543479-108543501 GGAGGGGCAGACAGGCAGCAGGG + Intergenic
1046260388 8:111759263-111759285 GGAGGTGCTCAGAGCAAGCAAGG + Intergenic
1047001586 8:120578593-120578615 GAAGGTGAAGAAAGGCAACAGGG + Intronic
1047704431 8:127483646-127483668 AGAGGTGCAAAGAGGCATCAGGG - Intergenic
1047821122 8:128521973-128521995 GAAGGTGCACAGTGACTTCAAGG - Intergenic
1048366797 8:133745445-133745467 AAAGGGGCACAGAGGCAGGTAGG - Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048784983 8:138040960-138040982 AAAGGTCCCCAGAGGAAGCATGG + Intergenic
1049181017 8:141222228-141222250 GCAGCTTCACAGAGGCAGGAAGG + Intronic
1049858898 8:144883703-144883725 GAAGGTGCAGAGGGGCATGATGG + Intronic
1050222534 9:3409974-3409996 GAAGGCACTCAGAGGTAGCAAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055300526 9:74877765-74877787 GAAGCTGTAAACAGGCAGCAGGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055733427 9:79302853-79302875 GAAGGTGAACTGAGGAAGTAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056769143 9:89464440-89464462 GGAGGTGGCCAGAGGCAGCCTGG - Intronic
1057182129 9:93035891-93035913 GAAGGCAGAAAGAGGCAGCATGG + Exonic
1057227877 9:93302042-93302064 CCAGGGGCACAGAGGCAGGAGGG - Intronic
1057353997 9:94320585-94320607 GAAGGTACACTGAGGCAGAGAGG + Exonic
1057653768 9:96937050-96937072 GAAGGTACACTGAGGCAGAGAGG - Exonic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059429846 9:114243457-114243479 GAAGCTGGACAGGGGCAACATGG - Intronic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1060662205 9:125411055-125411077 GGAGGTGCACAGTAGCTGCAGGG + Intergenic
1060983571 9:127807365-127807387 GAGGGTGCCCAGAGGCCGCATGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061285829 9:129621935-129621957 GAAGCGGCCCAGAGGCAGCCGGG - Intronic
1061826223 9:133259955-133259977 GAAGGGGCACAGCGTCAGCCTGG + Intronic
1062525126 9:136975155-136975177 CAAGGTGGACAGGGGCAGGAGGG - Intergenic
1185729660 X:2451267-2451289 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185730361 X:2456649-2456671 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1187236093 X:17468964-17468986 GCAGGTGGACAGAGACAGGAAGG - Intronic
1189110872 X:38287138-38287160 GAAGGTGCATGGAGGAAGAAAGG - Exonic
1189129689 X:38485377-38485399 GAGGGTGGGGAGAGGCAGCATGG + Intronic
1189792642 X:44618670-44618692 GATGGGGCAAAGGGGCAGCAGGG - Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1191058543 X:56269957-56269979 GTAGGTGCTCAGAGAAAGCATGG - Intronic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192198309 X:69047170-69047192 GCAGGAGCAGAGAGGCTGCAGGG - Intergenic
1192359859 X:70432628-70432650 GAAGGTCCACAAAAGCAGCATGG - Exonic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1193495669 X:82208506-82208528 CAAGTTTCACAGAGGAAGCAAGG - Intergenic
1197262808 X:124334784-124334806 GAAGGTCCAGAGAGGCCCCAGGG + Intronic
1197637262 X:128929004-128929026 GAATGAGCACAGAGGAAGCATGG - Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1198525799 X:137499366-137499388 GAAGGTGGAGAGTGGCAGGAGGG + Intergenic
1198686350 X:139231717-139231739 GGAGGTGCACAAAGATAGCATGG - Intergenic
1198932790 X:141879051-141879073 TCAGTTGCACAGAGGCAGGAAGG + Intronic
1199700964 X:150375244-150375266 GAAGGTGCACAGGATCAACAAGG - Intronic
1199968851 X:152843851-152843873 GTAGGTGTACAGCGACAGCATGG - Intronic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200280884 X:154775951-154775973 GAAGGAGCACAGCAGCAGCACGG - Intronic
1201729997 Y:17192760-17192782 GAAGGTGCCCAAAGCAAGCAAGG + Intergenic
1201888928 Y:18920288-18920310 GAAGTTGCAGTGAGCCAGCATGG + Intergenic