ID: 1106136325

View in Genome Browser
Species Human (GRCh38)
Location 13:26976265-26976287
Sequence CTGCTGGTACAGATGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106136325_1106136329 5 Left 1106136325 13:26976265-26976287 CCTCATTCCATCTGTACCAGCAG 0: 2
1: 0
2: 1
3: 13
4: 182
Right 1106136329 13:26976293-26976315 AGAGCGCACATTTCACACACAGG 0: 1
1: 1
2: 0
3: 7
4: 111
1106136325_1106136330 6 Left 1106136325 13:26976265-26976287 CCTCATTCCATCTGTACCAGCAG 0: 2
1: 0
2: 1
3: 13
4: 182
Right 1106136330 13:26976294-26976316 GAGCGCACATTTCACACACAGGG 0: 1
1: 1
2: 1
3: 5
4: 103
1106136325_1106136331 15 Left 1106136325 13:26976265-26976287 CCTCATTCCATCTGTACCAGCAG 0: 2
1: 0
2: 1
3: 13
4: 182
Right 1106136331 13:26976303-26976325 TTTCACACACAGGGACATTGAGG 0: 1
1: 0
2: 0
3: 78
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106136325 Original CRISPR CTGCTGGTACAGATGGAATG AGG (reversed) Intergenic
900785924 1:4650493-4650515 CTCCGGGTACAGATGGAAAGAGG - Intergenic
902822781 1:18953722-18953744 CTGCTGAGACAGGTGGAGTGCGG - Intronic
903001602 1:20270108-20270130 CTGCTGGTTCACAGAGAATGAGG - Intergenic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
905146801 1:35893477-35893499 CTGCAGGGACAGATGGGATGAGG - Intronic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
909965803 1:81908662-81908684 TTGCTGGTAGAAATGGAAAGTGG - Intronic
910431545 1:87164502-87164524 CACCTGGTATAGATTGAATGTGG + Intronic
911864809 1:103004608-103004630 CTCCTGGTGATGATGGAATGAGG - Exonic
912541443 1:110419242-110419264 CTGATGGTCCAGAATGAATGTGG - Intergenic
913555230 1:119959744-119959766 CTGATGGTGCAGAGGCAATGGGG + Intronic
915849918 1:159310400-159310422 CTCTTGGTCCAGAGGGAATGTGG + Intergenic
916023017 1:160810693-160810715 CTTCTGGTATTGTTGGAATGTGG - Intronic
919529585 1:198700561-198700583 CAGCTGGACTAGATGGAATGAGG - Intronic
919538207 1:198814672-198814694 CTGCTGGTATAGTTGCAGTGAGG - Intergenic
920097349 1:203495120-203495142 CTGTGGGTACAGAATGAATGAGG - Intronic
920128919 1:203715856-203715878 CTACTGGTACAGCTGGAAGGAGG - Intronic
920567371 1:206985568-206985590 GTGATGATGCAGATGGAATGTGG - Intergenic
920977718 1:210801474-210801496 GTGCTGGTCCAGATGGAAGAGGG - Intronic
1063034894 10:2276664-2276686 CTGCTTCTCCAGATGGAAGGCGG + Intergenic
1066110606 10:32193083-32193105 CTGCTGGTAAAAATGTAAAGTGG - Intergenic
1068829768 10:61480069-61480091 CTGCTAGAACACATGAAATGTGG + Intergenic
1069461837 10:68602716-68602738 TTGCTGTTGCAGATGAAATGTGG - Intronic
1069611433 10:69775189-69775211 CTGCTGGAAGAGATTGATTGCGG + Intergenic
1071270843 10:84005935-84005957 GTGGTGGTATAAATGGAATGGGG + Intergenic
1071398054 10:85242469-85242491 CTGCTGTTTCACAAGGAATGAGG - Intergenic
1071543296 10:86507619-86507641 CTGGTGGCTGAGATGGAATGCGG - Intronic
1072976173 10:100060624-100060646 CAGCTGTTACAGAAAGAATGGGG + Intronic
1073418721 10:103406363-103406385 CTGCTGGTTCAGAAGCCATGGGG - Intronic
1074960121 10:118437076-118437098 CTGCTGGAACAACTGGACTGGGG - Intergenic
1077864371 11:6210755-6210777 CTGGTGAAAGAGATGGAATGAGG + Intronic
1078640391 11:13090100-13090122 CTGCTGGTGCAAATGGAAATCGG - Intergenic
1081633916 11:44708074-44708096 CTGCTGCTTCAGGTGGAAGGAGG - Intergenic
1084218161 11:67662765-67662787 GTGCTGGTGCAGTTGGGATGGGG + Exonic
1088546048 11:110959978-110960000 CTTCTGGAACAGATGGAAGCTGG - Intergenic
1088716068 11:112551034-112551056 CTGGTGGGACAGATAGCATGTGG + Intergenic
1088993506 11:114975321-114975343 CTGATGCTACTGATGGAATGAGG + Intergenic
1096156194 12:49342633-49342655 CGGCAGGTACAGATGGAACCAGG + Intergenic
1096596550 12:52699545-52699567 CAGCTAGCACCGATGGAATGAGG + Intronic
1097777994 12:63669517-63669539 CGGCTGGCACAGATGCACTGGGG + Intergenic
1098348255 12:69528948-69528970 ATGCTGGTATAGCTTGAATGGGG + Intronic
1098869880 12:75804901-75804923 ATGCTGGTTCAGTAGGAATGAGG + Intergenic
1102992370 12:117324329-117324351 CTGCTGGTCCAGATGGACACTGG + Intronic
1103855329 12:123964909-123964931 CTGCTGGTACAAAGGGAATTAGG - Intronic
1104658316 12:130590807-130590829 TTGCTGGTAAAAATGGAAGGTGG - Intronic
1106136325 13:26976265-26976287 CTGCTGGTACAGATGGAATGAGG - Intergenic
1106927428 13:34628084-34628106 CTTCTGCTACAGAGGCAATGGGG - Intergenic
1107432500 13:40352533-40352555 CTGCTGGGATTGATGGATTGAGG - Intergenic
1113555910 13:111234350-111234372 ATGCTGGGGCAGATGGAAGGTGG - Intronic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1115384263 14:32777430-32777452 CTGCTTGAACATATGGAATGCGG - Intronic
1118491980 14:66269949-66269971 CTGCAGGTAAAGATGAGATGAGG + Intergenic
1120226598 14:81797466-81797488 CTGCTGATACAGATTCATTGAGG + Intergenic
1125095162 15:35842263-35842285 CTAGTGGTACAGCTGGAATCAGG - Intergenic
1126986942 15:54322509-54322531 CTTCTGGTACTGATGGATAGTGG + Intronic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1128763054 15:70231647-70231669 CTCATGGTACAGATATAATGAGG - Intergenic
1129056040 15:72821315-72821337 CTGCAGGTAGAGACTGAATGTGG + Intergenic
1129372532 15:75106447-75106469 CTCCTGGTAAACATGGAATATGG - Intronic
1130655975 15:85792466-85792488 CTGGTGGTACAGAGGGACTAGGG + Intronic
1131067749 15:89444723-89444745 CTGCTGCTTCAGATGGAGTGGGG - Intergenic
1131310336 15:91284858-91284880 CTGCAAGTCCCGATGGAATGAGG - Intronic
1132292109 15:100711072-100711094 ATCCTGGTTCAGATGGAATTGGG - Intergenic
1133617891 16:7496067-7496089 CTGCTGATAGAGACAGAATGTGG - Intronic
1133740558 16:8647973-8647995 CTGCTGCTCCAGCGGGAATGTGG - Exonic
1134323643 16:13187121-13187143 CTGCTAGGGCACATGGAATGGGG - Intronic
1135808865 16:25569364-25569386 CTGCTGGTAGAAATGGACTAGGG - Intergenic
1135972040 16:27079278-27079300 CAGTTGGGACTGATGGAATGTGG - Intergenic
1138337748 16:56266552-56266574 CTGCTGCACCAGATGGAAGGAGG + Intronic
1138433400 16:56983598-56983620 CTGCTGCTGCAGATGGACTTTGG + Exonic
1141541130 16:84722496-84722518 CTGCTGGTGCAGATAGAAAACGG - Intronic
1141566032 16:84902692-84902714 CTGCTGGCTCAGAGGGACTGGGG + Intronic
1143496614 17:7316121-7316143 CTGCTGGTACGGGTGGAATGAGG - Exonic
1147813286 17:43189154-43189176 GTGTTGGCACAGGTGGAATGTGG + Intronic
1148606492 17:48933246-48933268 CAGCTGGAACAGACTGAATGAGG + Exonic
1148823600 17:50376065-50376087 GTGCTCTTACAGATGGAAGGTGG + Exonic
1148957310 17:51364520-51364542 CTGATTGTTCAGATGGAAAGTGG + Intergenic
1151622981 17:75258327-75258349 CACCTAGTACAGAAGGAATGAGG + Intronic
1153756418 18:8288142-8288164 CTGCTGCTTCTTATGGAATGAGG - Intronic
1154248064 18:12717408-12717430 CAGCTGGTAAATCTGGAATGTGG - Intronic
1156636658 18:39039045-39039067 CTGCTGGTACACATCATATGTGG - Intergenic
1157333690 18:46721676-46721698 CTGCTGGTACAGATGGAATGAGG - Intronic
1159345597 18:67199549-67199571 CTAGTGGTACACATGGGATGGGG + Intergenic
1160965990 19:1747190-1747212 CTGCAGGTACAGTGGGGATGGGG + Intergenic
1161673149 19:5625421-5625443 CTGCTGGTAAAGATGAGATGTGG + Intronic
1162068288 19:8138623-8138645 GTGCTGCTACAGCTGGAATTTGG - Intronic
1165632257 19:37311855-37311877 CTGCTGGGACAAATTGCATGAGG - Intergenic
924987125 2:282105-282127 CTACTGGGAAAGATGGAGTGGGG + Intronic
926647153 2:15302360-15302382 CAGCTGCTCCAGATGGAAAGAGG - Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930846398 2:55909485-55909507 ATTCTAGGACAGATGGAATGTGG + Intronic
931478434 2:62614777-62614799 CTTCTGGTACAGAGTGAATTGGG - Intergenic
932276527 2:70455972-70455994 CTTCTGGTGCTGATGGAAGGAGG + Intronic
933291056 2:80438735-80438757 CTAAAGGAACAGATGGAATGAGG - Intronic
937296966 2:120815333-120815355 CTCCTGTTACAGATGGGTTGTGG - Intronic
938449362 2:131402918-131402940 CTGCTGGTAAAGATGGGAGGTGG + Intergenic
940933775 2:159467684-159467706 CTGCTGGTAATGGTGGAGTGAGG + Intronic
943307169 2:186277204-186277226 CTGCTGGTACATATGTAAATTGG + Intergenic
947272456 2:228352370-228352392 CAGCTGGAACAGACTGAATGAGG + Intergenic
1170914873 20:20613253-20613275 CTGTTGGAGCACATGGAATGAGG + Intronic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1175747023 20:61464209-61464231 CTGCTGCTACAGATGCAGAGAGG + Intronic
1176132789 20:63503309-63503331 CAGCTGGTCCAGAGAGAATGGGG + Intergenic
1178514690 21:33236616-33236638 CTGCTGCTACTGTTGGCATGGGG - Intronic
1180699377 22:17773393-17773415 CTGTGGGTGGAGATGGAATGTGG + Intronic
1184583203 22:45430706-45430728 CAGCTGGGCCACATGGAATGAGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950094195 3:10319145-10319167 GTGCTGGAAAAGATGAAATGGGG - Exonic
950945607 3:16942557-16942579 CTGCTAGGACAGAAGAAATGTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
961535949 3:127570665-127570687 CTGCTGCTGCACATGGACTGTGG - Intergenic
965601384 3:170457852-170457874 CTGCTGGTCCTGATGGATGGTGG + Intronic
967201072 3:187073079-187073101 CTGCTAGTCCAGATGAAATGGGG - Intronic
969216743 4:5729208-5729230 CTGCTATTACAAATGGGATGTGG + Intronic
969569663 4:8001162-8001184 ATGCTGGTTCAGCTGGACTGGGG + Intronic
969576091 4:8036547-8036569 CTCCTGGTATAGGTGAAATGGGG + Intronic
969595236 4:8145001-8145023 CGGCTGGTAAAGATGGGAGGTGG - Intronic
974336017 4:60545370-60545392 CTGCTAGTACAGATCCCATGAGG + Intergenic
976675553 4:87698092-87698114 CTGCAGGCACAGAGGGTATGGGG + Intergenic
978773971 4:112487139-112487161 CTGTTGGTATAGTTAGAATGGGG - Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
982055705 4:151546949-151546971 CTGCTGGAACTGATGAAGTGGGG - Intronic
982189063 4:152834933-152834955 CAGCTGGCACAGCTGGGATGTGG + Intronic
982202744 4:152975431-152975453 CTGCTGGCACTGAGGGACTGCGG - Exonic
982451674 4:155560088-155560110 CTGCTGGGAAAGATGTTATGTGG - Intergenic
983922818 4:173365718-173365740 CTCCTGGTTCAGAGGAAATGGGG + Intergenic
984521105 4:180801937-180801959 CAAGGGGTACAGATGGAATGGGG - Intergenic
989740233 5:44762375-44762397 CTGCATGTGCAGGTGGAATGTGG - Intergenic
993567352 5:89491571-89491593 TTGCTGGTAGAGATGCAATATGG - Intergenic
994678182 5:102851021-102851043 CTGCTGGAACAGGAGGAAAGAGG + Intronic
995836479 5:116404950-116404972 CTTCTGGTACAGATGTGATTTGG - Intronic
998234694 5:140388383-140388405 CTGATGGTACAAAAGCAATGGGG - Intergenic
1000207017 5:159071489-159071511 CTTCTGGGACAGATGCAAAGCGG + Intronic
1000398087 5:160797001-160797023 CAGCTGGAACAGATTGTATGTGG - Intronic
1000920135 5:167128426-167128448 CGGCTGATTCAGTTGGAATGAGG + Intergenic
1002312633 5:178323911-178323933 CAGCTGGAACAGCTGGTATGTGG + Intronic
1003702922 6:8490461-8490483 CTGCTGGTACAGGTGAGGTGCGG + Intergenic
1005124718 6:22433630-22433652 CTGCTTGTACTGCAGGAATGAGG + Intergenic
1006249717 6:32771590-32771612 CTTCTGCTGCAGATGGATTGTGG - Intergenic
1007167327 6:39837969-39837991 CTGGTGGTACAGGTGGTTTGAGG - Intronic
1008601864 6:53104235-53104257 CTGCTGGGATAGAGGCAATGTGG - Intergenic
1012919735 6:105209129-105209151 CAGCTGGGACAGCTAGAATGGGG - Intergenic
1012927999 6:105286928-105286950 CTGCTGGGACCAAGGGAATGGGG + Intronic
1013500662 6:110747193-110747215 CTGCAGGTAAACATAGAATGGGG - Intronic
1013706045 6:112835313-112835335 CTGCTGGTCCAGGAAGAATGAGG - Intergenic
1015961270 6:138651535-138651557 CTGCTGCTACATCTGGAAAGAGG - Intronic
1017285976 6:152676991-152677013 CAGCTGGTAGAGTTGGAATCAGG - Intergenic
1021251138 7:18326968-18326990 TTGCTTTTACAGATGTAATGAGG - Intronic
1021422451 7:20461101-20461123 ATCCTGGTACAGATGGATTGAGG - Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022701420 7:32763407-32763429 CGGCTGGCACAGATGCACTGGGG + Intergenic
1022936923 7:35187182-35187204 CGGCTGGCACAGATGCACTGGGG + Intergenic
1028960622 7:96745792-96745814 CTGCTGGTAGGGATGGAAACAGG + Intergenic
1029833161 7:103281289-103281311 CGGCTGGCACAGATGCACTGGGG + Intergenic
1029974055 7:104815988-104816010 GTGCTGGTCTATATGGAATGTGG - Intronic
1031113937 7:117646645-117646667 CTGCTGCTGCTGATGGCATGGGG + Intronic
1032668491 7:134062341-134062363 TTGCTGGTACAAGGGGAATGTGG - Intronic
1034722220 7:153304173-153304195 CTGCTGGTCCAAAGAGAATGTGG + Intergenic
1035061525 7:156073024-156073046 CTGCTGGCACAGAGGGCAGGCGG + Intergenic
1038086342 8:24201370-24201392 CTGCTGGATCAGATGATATGAGG + Intergenic
1038956906 8:32477962-32477984 ATTCTGTTACAGATGGACTGTGG - Intronic
1041590375 8:59573653-59573675 CTGCTGGGACATATGGTAAGTGG - Intergenic
1041784357 8:61615159-61615181 TTGCTGGTAAAGAAGGTATGAGG - Intronic
1042640356 8:70927482-70927504 CTGCTGGTGCAGATTGACTCTGG - Intergenic
1046871623 8:119210068-119210090 ATTCTAGTACAGGTGGAATGCGG - Intronic
1048561085 8:135538221-135538243 CTGCTGGTTCAGATTGAAGATGG + Intronic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1049027366 8:140003734-140003756 CTGCTAGTAGAGATGGAAAATGG + Intronic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1057287664 9:93773231-93773253 GTGATATTACAGATGGAATGAGG + Intergenic
1059746171 9:117203967-117203989 CTGCTGGTCCACAGAGAATGTGG + Intronic
1060103332 9:120858276-120858298 CTTCTGATACAGATGGACAGTGG - Exonic
1060850673 9:126872526-126872548 CTGCTAGTACAGAGGGATAGAGG + Intronic
1062324197 9:136004587-136004609 CTGCTGTTACAGAGGGGCTGGGG - Intergenic
1185846241 X:3440830-3440852 CTGCTGGTCCACATAGACTGTGG + Intergenic
1186814325 X:13221183-13221205 CTGCTGGTCCAGAGAGAGTGAGG - Intergenic
1187211397 X:17235887-17235909 CTTCTGTTATAGATGGAATGGGG + Intergenic
1187901204 X:24028204-24028226 GTGCTGGTGGAGTTGGAATGAGG + Intergenic
1190171770 X:48116574-48116596 CTGCTGGGAAAGATGGTGTGGGG - Intergenic
1190177397 X:48162208-48162230 CTGCTGGAAAAGATGGTGTGGGG - Intergenic
1190189329 X:48263337-48263359 CTGCTGGGAAAGATGGTGTGGGG - Intronic
1190196479 X:48323618-48323640 CTGCTGGGAAAGATGGTGTGGGG - Intergenic
1190199732 X:48350551-48350573 CTGCTGGGAAAGATGGTGTGGGG + Intronic
1190204171 X:48388903-48388925 CTGCTGGGAAAGATGGTGTGGGG - Intronic
1190206365 X:48406500-48406522 CTGCTGGGAAAGATGGTGTGGGG + Intronic
1190655320 X:52607102-52607124 CTGCTGGGAAAGATGGTGTGGGG + Intergenic
1190658094 X:52629826-52629848 CTGCTGGGAAAGATGGTGTGGGG - Intergenic
1190660364 X:52648815-52648837 CTGCTGGGAAAGATGGTGTGGGG + Intronic
1190663201 X:52673984-52674006 CTGCTGGGAAAGATGGTGTGGGG - Intronic
1190666504 X:52701007-52701029 CTGCTGGGAAAGATGGTGTGGGG + Intronic
1190672914 X:52757403-52757425 CTGCTGGGAAAGATGGTGTGGGG - Intronic
1190676222 X:52784498-52784520 CTGCTGGGAAAGATGGTGTGGGG + Intronic
1191883437 X:65864618-65864640 CAGCTGGTGCTGATGGAAAGGGG + Intergenic
1192266214 X:69539587-69539609 CTGCTGGTACAGGAGGCAGGAGG + Intergenic
1197841627 X:130753885-130753907 CTGCTGGATCATATGGAAAGGGG + Intronic
1199564412 X:149199287-149199309 CTGCTGATACACAGAGAATGTGG + Intergenic
1200818266 Y:7555574-7555596 CTGCTGGTCCACATAGACTGTGG - Intergenic
1200857681 Y:7957161-7957183 TTGCTGGTTCAGATAGAGTGAGG + Intergenic