ID: 1106138282

View in Genome Browser
Species Human (GRCh38)
Location 13:26990693-26990715
Sequence CGGGCGTGTGAGGGTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 387}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106138282_1106138292 5 Left 1106138282 13:26990693-26990715 CCCACCACACCCTCACACGCCCG 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1106138292 13:26990721-26990743 CCACCTTCTGTGCAGGGCCATGG 0: 1
1: 0
2: 2
3: 27
4: 321
1106138282_1106138289 -2 Left 1106138282 13:26990693-26990715 CCCACCACACCCTCACACGCCCG 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1106138289 13:26990714-26990736 CGTCACTCCACCTTCTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1106138282_1106138293 6 Left 1106138282 13:26990693-26990715 CCCACCACACCCTCACACGCCCG 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1106138293 13:26990722-26990744 CACCTTCTGTGCAGGGCCATGGG 0: 1
1: 0
2: 1
3: 17
4: 194
1106138282_1106138295 18 Left 1106138282 13:26990693-26990715 CCCACCACACCCTCACACGCCCG 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1106138295 13:26990734-26990756 AGGGCCATGGGCAGCACTCCTGG 0: 1
1: 0
2: 2
3: 31
4: 245
1106138282_1106138290 -1 Left 1106138282 13:26990693-26990715 CCCACCACACCCTCACACGCCCG 0: 1
1: 0
2: 1
3: 38
4: 387
Right 1106138290 13:26990715-26990737 GTCACTCCACCTTCTGTGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106138282 Original CRISPR CGGGCGTGTGAGGGTGTGGT GGG (reversed) Intergenic
900177387 1:1296917-1296939 CGCGCGTGTGGGAGTGTGCTCGG - Intronic
900215643 1:1480190-1480212 CGGGGGTGTGTGGGGGTGGGGGG - Intronic
901115224 1:6838393-6838415 GGGGCGAGTGAGGGTGAGGCAGG + Intronic
901323938 1:8356048-8356070 AGGCCGTGTGAGGGTTGGGTTGG - Intronic
901502149 1:9659152-9659174 GGGGCTTGTGAGGGTGGGGTAGG + Intronic
901756603 1:11445023-11445045 AGGGCTTGAGAGGCTGTGGTTGG - Intergenic
902282221 1:15382998-15383020 TGCGCGTGTGTGTGTGTGGTGGG - Intronic
903332236 1:22602047-22602069 CGTGCATGTGTGTGTGTGGTGGG + Exonic
903693983 1:25194247-25194269 TGTGGGTGTGAGGGTGTGGGTGG - Intergenic
904006103 1:27364147-27364169 GGGGCTGGTGAGGGTATGGTGGG - Intronic
904597252 1:31654660-31654682 CAGGCCTGTGAGTGTGTGGAGGG + Intronic
905892734 1:41527438-41527460 CAGGGGTGTGAGGGTGAGGGTGG - Intronic
905892805 1:41527845-41527867 CAGGGGTGTGAGGGTGAGGGTGG - Intronic
905893177 1:41529625-41529647 GGGGTGTGTGAGGGTGTGGGGGG - Intronic
907355042 1:53865584-53865606 GGGGGTTGTGGGGGTGTGGTTGG - Intronic
908609355 1:65839421-65839443 GGGGCCTGTCAGGGTGTGGAGGG - Intronic
908696309 1:66845839-66845861 CGTGTGTGTGTGTGTGTGGTGGG + Intronic
908806336 1:67936951-67936973 GGGGGGTGGGAGGGTGTGGTGGG + Intergenic
909893599 1:81037697-81037719 TAGGAGTATGAGGGTGTGGTGGG - Intergenic
910204167 1:84731135-84731157 CGGTGGTCTGAGAGTGTGGTTGG + Intergenic
910748611 1:90601825-90601847 GGGGCCTGTCAGGGGGTGGTGGG + Intergenic
915118214 1:153613237-153613259 CGGGGCTGGGAGGGTGGGGTTGG - Intergenic
915735850 1:158084479-158084501 CCGGCATGTGAGGTTGTGGGGGG - Exonic
916560867 1:165933389-165933411 TGGGTGTGTAAGGGTGTGGGGGG + Intergenic
917377595 1:174365877-174365899 AGGGAGTGTGGGGGTGTGATTGG + Intronic
918650299 1:186954428-186954450 AGGGCCTGTCAGGGTGTGGGGGG + Intronic
918814229 1:189162428-189162450 GGGGCCTGTTAGGGTGTGGGGGG - Intergenic
922637467 1:227188932-227188954 TGTGCGTGTGTGTGTGTGGTGGG + Intronic
922726861 1:227926783-227926805 GGGCCATGTGAGGGTGTGGGGGG - Intronic
922784577 1:228276615-228276637 CGAGAGTGTGAGGGTGTGCATGG - Exonic
924828479 1:247567329-247567351 CGGGCCTGTTGGGGTGTGGGGGG - Intronic
924834577 1:247635825-247635847 CTGGCATGGGAGGGTGTGGGAGG + Intergenic
1063522859 10:6757029-6757051 TGGGAGTGTGGGGGTGTGGAGGG + Intergenic
1066758159 10:38730706-38730728 TGGGTGTGTGAGGGTGTGTATGG + Intergenic
1066963530 10:42242011-42242033 TGGGTGTGTGAGGGTGTGTATGG - Intergenic
1068487316 10:57676904-57676926 CTGGCATGTGAGTGTGTGTTGGG + Intergenic
1069833760 10:71296181-71296203 TGTGCGTGTGAGGGTGTGACAGG - Intronic
1069924110 10:71836452-71836474 AGGGCCTGCTAGGGTGTGGTGGG - Intronic
1069981756 10:72257496-72257518 GGGGTGTGTGTGGGTGTGTTGGG + Intergenic
1071504822 10:86226313-86226335 CTGGGGTGGGAGGGTGTGCTGGG - Intronic
1071504850 10:86226389-86226411 CTGGGGTGGGAGGGTGTGCTGGG - Intronic
1071504857 10:86226407-86226429 CTGGGGTGGGAGGGTGTGCTGGG - Intronic
1071504878 10:86226461-86226483 CTGGGGTGGGAGGGTGTGCTGGG - Intronic
1071504906 10:86226537-86226559 CTGGGGTGGGAGGGTGTGCTGGG - Intronic
1072727562 10:97823954-97823976 TGGGCGTGTGTGGGTGGGGCAGG + Intergenic
1072775178 10:98184058-98184080 CGTGTGTGTGTGTGTGTGGTGGG + Intronic
1076568874 10:131418805-131418827 CAGCAGTGTGAGCGTGTGGTTGG + Intergenic
1076870071 10:133188744-133188766 GGGGCGTGGGACGGTGTGGGGGG - Intronic
1077038639 11:507490-507512 CGGGCGCGTGTGCGTGTTGTGGG + Intergenic
1077101255 11:823599-823621 CGGGCGGGAGAGGGCGGGGTGGG + Intronic
1077282034 11:1750192-1750214 CGTGAGAGTGAGGATGTGGTGGG - Intronic
1077305577 11:1867341-1867363 TGTGTGTGTGTGGGTGTGGTGGG - Intronic
1077359898 11:2136258-2136280 TGGGCGTGTGTGTGTGTGTTTGG - Intronic
1078066606 11:8082894-8082916 CGCACGTGTGAGGGTGTTGCTGG - Intronic
1078650089 11:13182462-13182484 CGTGCGTGTGTGTGTGTTGTGGG + Intergenic
1079801812 11:24878772-24878794 AGGGCCTGTTAGGGTGTGGGGGG - Intronic
1081049696 11:38322966-38322988 CGTGTGTGTGTGTGTGTGGTGGG + Intergenic
1083507644 11:63174053-63174075 AGGGCCTGTCAGGGGGTGGTGGG - Intronic
1084086247 11:66856663-66856685 TGGGCATGTGTGGGTGTGTTGGG + Intronic
1086350996 11:85943134-85943156 CAGGCTTGTGAGAGTGTGATGGG + Intergenic
1086551314 11:88056018-88056040 CGTGTGTGTGTGTGTGTGGTGGG + Intergenic
1087791957 11:102415484-102415506 CTGTGGTCTGAGGGTGTGGTTGG - Intronic
1087824745 11:102752387-102752409 CAGGTGTGTGTGTGTGTGGTGGG + Intergenic
1088863291 11:113821900-113821922 GGAGGGTGTGAGGGTGGGGTGGG + Intronic
1089324942 11:117650698-117650720 TGTGCGTGTGTGTGTGTGGTGGG + Intronic
1090091324 11:123701043-123701065 CGGCCTTGTGAGGCTGTGGCTGG + Intergenic
1090165390 11:124541446-124541468 CGTGTGTGTGTGTGTGTGGTGGG - Intergenic
1091497177 12:982775-982797 CGGGGGTGTGGGGCTGAGGTGGG - Intronic
1092428008 12:8389588-8389610 CGGGCCTGTGAGTGTGGGATGGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094843204 12:34350487-34350509 CGGCAGAGTGAGGGTGGGGTTGG + Intergenic
1095356940 12:41285840-41285862 GGGGCCTGTCAGGGGGTGGTGGG + Intronic
1095812328 12:46383733-46383755 CGGGTGTGTGGGGGTCGGGTCGG + Intergenic
1096257153 12:50070403-50070425 GGGGCGTGTGTGTGTGTGTTGGG + Intronic
1096502611 12:52074082-52074104 CGGGCGCGTGTGTGTGTGGTGGG + Intronic
1098772353 12:74568408-74568430 TGGGAGAGTGAGGGTGAGGTAGG - Intergenic
1099052180 12:77793474-77793496 AGGGCCTGTCAGGGTGTGGGGGG - Intergenic
1100101607 12:91113753-91113775 CGGGCCTGTCAGGGGTTGGTGGG + Intergenic
1101258411 12:103003648-103003670 GGGGCCTGTCAGGGTATGGTTGG - Intergenic
1103746890 12:123130967-123130989 TAGGCATGTGAGGGTGGGGTGGG - Intronic
1104223949 12:126813033-126813055 CGCTGGTGTGCGGGTGTGGTGGG + Intergenic
1104656121 12:130575070-130575092 AGGGCGTCTGGGGGTGGGGTTGG - Intronic
1104954475 12:132457608-132457630 CGGGCGAGTGAGTGGGTGGGTGG + Intergenic
1104954539 12:132457802-132457824 CGGGCGGGTGAGTGGGTGGGTGG + Intergenic
1104954622 12:132458058-132458080 CGGGCGGGTGAGCGGGTGGGTGG + Intergenic
1104978553 12:132562733-132562755 CCGGCGCGTGTGGGTGTGGCAGG + Intronic
1105443552 13:20434587-20434609 GGGGCGCGTGTGGGTGTGGGTGG - Intronic
1105638417 13:22238510-22238532 AGTGTGTGTGAGTGTGTGGTTGG + Intergenic
1106138282 13:26990693-26990715 CGGGCGTGTGAGGGTGTGGTGGG - Intergenic
1106390317 13:29329283-29329305 CGGGCCTGTCAGGGGGTGGGGGG - Intronic
1106776787 13:33016721-33016743 CGGGGGTGCCAGGGGGTGGTGGG - Exonic
1108224989 13:48279990-48280012 GGTGGGTGTGTGGGTGTGGTTGG + Intergenic
1108718463 13:53105592-53105614 CTGGCGTGTGTGTGTGTGGCAGG + Intergenic
1109385353 13:61623075-61623097 AGGGCTTGTCAGGGAGTGGTGGG - Intergenic
1109592789 13:64508904-64508926 CGGGCCTGTCGGGGTGTGGGGGG - Intergenic
1113386758 13:109856041-109856063 CGTGTGTGTGAGGGTGTGTGTGG - Intergenic
1113761961 13:112854546-112854568 CGGGAGTGTGGGGGTGGGGGCGG - Intronic
1114518458 14:23317367-23317389 CAGGAGTTTGAGGGTGTGGTCGG + Intronic
1115734028 14:36304119-36304141 TGTGCGTGTGAACGTGTGGTGGG - Intronic
1116233600 14:42249509-42249531 CCGGCGGGTGGGGGTGGGGTCGG - Intergenic
1116657937 14:47674845-47674867 CGTGCGTGTGAGTGTGTGTCAGG - Exonic
1117225554 14:53654659-53654681 CTGGTGTGTGAGTGTGGGGTGGG - Intergenic
1118047996 14:61993252-61993274 GGGGCCTGTGGGGGTGTGGGGGG + Intergenic
1118609358 14:67528104-67528126 TTGGAGTGTGAGGGTGAGGTAGG + Intronic
1119731999 14:76956881-76956903 TGGGTGTGTGCGGGTGTGGCAGG + Intergenic
1120703619 14:87725264-87725286 TGGGGGTGTGAGGGTGTGGTGGG - Intergenic
1122020715 14:98835807-98835829 CAGGTGTGTGAGTGTGTGGGGGG - Intergenic
1122209937 14:100167400-100167422 GGGGCGTGTGTGTGTGTGTTGGG - Intergenic
1122210125 14:100168179-100168201 CAGGGGTGTGTGGGTGTGTTGGG - Intergenic
1122405382 14:101497688-101497710 CGGGGGTGGGAGGGTGGGGGTGG - Intergenic
1122530734 14:102424772-102424794 CACACCTGTGAGGGTGTGGTCGG + Intronic
1122597365 14:102902731-102902753 TGGGAGTGTGAGGGTGAGGTCGG + Intronic
1122659767 14:103287482-103287504 AGGGCATGTGAGGTTGTGCTGGG + Intergenic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1123054546 14:105562873-105562895 GGGGTGTGTGAGGGTGTGTGAGG + Intergenic
1123054595 14:105563155-105563177 AGGGCATGTGAGGGTGTGTAAGG + Intergenic
1123054766 14:105564089-105564111 GGGGTGTGTGAGGGTGTGTGAGG + Intergenic
1123079162 14:105683444-105683466 AGGATGTGTGAGGGTGTGTTTGG + Intergenic
1123079199 14:105683622-105683644 GGGGTGTGTGAGGGTGTGTGAGG + Intergenic
1123722279 15:23069760-23069782 GGGGTGTGGGGGGGTGTGGTGGG + Intergenic
1124421780 15:29529224-29529246 GGGGTGTGTGAGGGTGTGGAGGG + Intronic
1124421786 15:29529244-29529266 GGGGTGTGTGAGGGTGTGGAGGG + Intronic
1125130701 15:36280788-36280810 CGGGAGTTTGAGGCTGTGGCAGG - Intergenic
1125753988 15:42049836-42049858 CGGGCGTGTGAGCTTCTGGGAGG - Intronic
1126532572 15:49727260-49727282 GGGGCCTGTGGGGGTGTGGAGGG + Intergenic
1127076052 15:55326723-55326745 CGGGCGTGGGAGGCTGAGGCAGG + Intronic
1127280775 15:57490394-57490416 CGTGCGTGTGTGTGTGTGTTTGG - Intronic
1128637424 15:69312107-69312129 GGGGAGTGTGTGGGTGTGTTTGG + Intronic
1128678789 15:69631292-69631314 CGTGCATGTGTGTGTGTGGTGGG + Intergenic
1130549943 15:84884098-84884120 CGGGCGTCTGCGGGTGTGCCGGG + Intergenic
1131435815 15:92420735-92420757 TGGGCGTCTGAGGGTGTTGCAGG - Intronic
1131990542 15:98088816-98088838 TGGGCGTGTGAGCGGGGGGTGGG - Intergenic
1132073004 15:98796270-98796292 TGGGGGTGTGTGGGGGTGGTTGG + Intronic
1132099601 15:99014480-99014502 TGGGCGTGTGAGCGGGGGGTGGG + Intergenic
1132552393 16:558971-558993 CGGGCGTGTGCGGCTGTGTCAGG + Intergenic
1132625442 16:889389-889411 CGTGGGTGTGAGGCTGTGGATGG + Intronic
1132668537 16:1093380-1093402 TGGGTGGGTGTGGGTGTGGTGGG - Intronic
1133318887 16:4900939-4900961 GGGGCGTGTGCTGGTGTGGTGGG - Intronic
1133981914 16:10639361-10639383 CTGGTGTGTGAGTGTGTGGATGG - Intronic
1135540271 16:23324694-23324716 GGGGCGTGTGTGTGTGGGGTGGG - Intronic
1136281316 16:29213116-29213138 CGGGCGTGTGATCCTGTGGGTGG + Intergenic
1136358293 16:29761040-29761062 CAGGTGTGTGAGGGTGAGGGTGG + Intergenic
1136476445 16:30516740-30516762 AGGGTGTGTGAGAGTGTGCTGGG + Intronic
1136719642 16:32310093-32310115 TGGGTGTGTGAGGGTGTGTATGG - Intergenic
1136724674 16:32348490-32348512 CGGGTGTGTGAGGGTGTGTATGG - Intergenic
1136838016 16:33516373-33516395 TGGGTGTGTGAGGGTGTGTATGG - Intergenic
1136843001 16:33554530-33554552 CGGGTGTGTGAGGGTGTGTATGG - Intergenic
1137273067 16:46915723-46915745 AGTGTGTGTGTGGGTGTGGTGGG - Intronic
1137719604 16:50620316-50620338 CTGGGGTGTGTGAGTGTGGTGGG + Intronic
1137983742 16:53090924-53090946 TGGGCGTGTGAGAGCATGGTGGG - Intronic
1139452483 16:67041718-67041740 AGCGCATGTGAGGTTGTGGTGGG + Intronic
1141834589 16:86530374-86530396 CCGCCGTCTGAGGGTGGGGTGGG + Exonic
1141889575 16:86917760-86917782 GGGGCCTGTGAGGGTGATGTCGG + Intergenic
1142085685 16:88179044-88179066 CGGGCGTGTGATCCTGTGGGTGG + Intergenic
1203001756 16_KI270728v1_random:169265-169287 CGGGTGTGTGAGGGTGTGTATGG + Intergenic
1203006789 16_KI270728v1_random:207676-207698 TGGGTGTGTGAGGGTGTGTATGG + Intergenic
1203133359 16_KI270728v1_random:1705671-1705693 CGGGTGTGTGAGGGTGTGTATGG + Intergenic
1203153166 16_KI270728v1_random:1854828-1854850 CGGGTGTGTGAGGGTGTGTATGG - Intergenic
1142899390 17:3002895-3002917 TGGGTGTGTGTGTGTGTGGTGGG + Intronic
1142915878 17:3137485-3137507 GGGGCCTGTGAGGGGGTGGGGGG - Intergenic
1143423740 17:6816383-6816405 GGGGCCTGTCAGGGTGTGGGGGG - Intronic
1144113316 17:12060748-12060770 CGCGCGTGTGTGTGTGTGGCTGG + Intronic
1144425038 17:15133651-15133673 CAGGGGTGTGGGGGTGTGGTGGG - Intergenic
1144648507 17:16991331-16991353 GGGGTGTGTGAGTGTGTGGGGGG - Intergenic
1144840665 17:18183914-18183936 CGGGCGTCCGAGGGTCTGGTCGG + Intronic
1146121334 17:30198197-30198219 TGGACGTGTGAGGATGTGGATGG - Exonic
1146453497 17:32992615-32992637 CGGGTGTGTGAGAGTGTGGGGGG + Intronic
1146618270 17:34374150-34374172 CGGGCTTGAGGGGCTGTGGTTGG - Intergenic
1146669938 17:34730222-34730244 CGGGCGTGTGTGTGTGTGTGCGG - Intergenic
1146928789 17:36763583-36763605 TGGGAGTGTGAGGGTGGGGGCGG - Intergenic
1148789788 17:50166737-50166759 AGGGTGTGTGAGGGTGTGTGAGG - Intronic
1148789794 17:50166771-50166793 AGGGTGTGTGAGGGTGTGTGAGG - Intronic
1149015057 17:51899404-51899426 CTGGGGTATGAGAGTGTGGTTGG + Intronic
1149049773 17:52290765-52290787 AGGGCCTGTTAGGGTGTGGGGGG + Intergenic
1149180467 17:53930811-53930833 GGGGCCTGTCAGGGTGTGGGGGG + Intergenic
1149608234 17:57939927-57939949 GGGGTGTGTGGGGGTGTGGTGGG - Intronic
1150814756 17:68384234-68384256 GGGGTGTGTGTGGGGGTGGTGGG + Intronic
1151210267 17:72539153-72539175 TGTGTGTGTGTGGGTGTGGTGGG - Intergenic
1152611653 17:81317792-81317814 CAGGCGTGTGCGGGTGGGGTGGG + Intronic
1152613656 17:81328359-81328381 CGGGCGGGTGAGGGTGGGCTGGG - Intronic
1153804835 18:8703204-8703226 CGGAAATGTGAGGGTGTGGGAGG + Intergenic
1154022845 18:10680120-10680142 TGGGGGAGGGAGGGTGTGGTGGG - Intronic
1157780772 18:50437099-50437121 AGGGCCTGTGAGGGAGTGGGGGG + Intergenic
1158770668 18:60513393-60513415 CGTGGGTGTGAGGGTAGGGTGGG - Intergenic
1160748832 19:724166-724188 TGGGCGAGTGAGCGTGTGGTGGG + Intronic
1161020927 19:2011194-2011216 AGGGCGTGGGGGGCTGTGGTGGG - Intronic
1161285213 19:3464873-3464895 CGGGCGGGGGAGGGGGTGGTCGG + Intronic
1161305710 19:3566417-3566439 AGGGAGAGTCAGGGTGTGGTTGG - Intronic
1161530429 19:4785771-4785793 CGGGAGGGAGAGGTTGTGGTGGG - Intergenic
1161596530 19:5153756-5153778 TGGGTGTGTGGGGGTGTGTTGGG - Intergenic
1163033477 19:14558978-14559000 CAGGCGTGTGTGTGTGTGGCAGG + Intronic
1163173384 19:15548469-15548491 TGGGCCTGTGAGGGTGCAGTTGG + Intronic
1163442873 19:17330325-17330347 AGGGCGGGTGAGGGTATGGGGGG + Intronic
1163463976 19:17455576-17455598 CAGGCGTGCGGGGGTGGGGTGGG + Exonic
1164046481 19:21547046-21547068 GGGGCCTGTCAGGGTGTGGGGGG - Intronic
1164693677 19:30228059-30228081 CGTGCGTGTGTGTGTGTGGAAGG + Intergenic
1166140870 19:40804471-40804493 GGGGCCTTTGAGGCTGTGGTTGG + Intronic
1166204734 19:41262369-41262391 CGGGCGTTCGCGGGTGTGGCCGG + Intergenic
1167446909 19:49543224-49543246 CGGGCCTCTGAGGCTGTGGCAGG - Exonic
1167721088 19:51181225-51181247 CGGGTGGGTGGGGGTGTGGGTGG + Intergenic
1168305772 19:55434261-55434283 CGCGTGTGTGTGTGTGTGGTGGG + Intronic
925140688 2:1548014-1548036 GGGGTGTGTGTGTGTGTGGTGGG - Intergenic
927734429 2:25506135-25506157 AGGGTGTGTGAGGGTGGGGAAGG + Intronic
928549617 2:32357689-32357711 CCGGCGAGTCAGGGAGTGGTGGG + Intronic
929011232 2:37447274-37447296 CGGGGGGGTGGGGGGGTGGTGGG + Intergenic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929464855 2:42135224-42135246 CAGGCATTTGAGGGAGTGGTGGG + Intergenic
931189616 2:59987562-59987584 AGGGCCTGTCAGGGGGTGGTGGG + Intergenic
931483259 2:62664916-62664938 CGGGCCAGTGAGCGTGTGCTGGG - Intergenic
931867599 2:66429127-66429149 CGGGGGTGGGAGGTGGTGGTTGG - Intergenic
933195569 2:79385685-79385707 CGGGCCTGTTGGGGGGTGGTGGG - Intronic
933426262 2:82115699-82115721 TGGCCATGAGAGGGTGTGGTGGG - Intergenic
933770976 2:85743711-85743733 GGGGAGTGTGAGGGTGGCGTGGG - Intergenic
934321473 2:91975146-91975168 TGGGTGTGTGAGGGTGTGTATGG + Intergenic
934695819 2:96399522-96399544 CGTGTGTGTGAGGGTGTGTGAGG - Intergenic
934893363 2:98089502-98089524 CGGGCTAGTGGGGGTGGGGTGGG + Intronic
935387226 2:102512954-102512976 CGAGCGAGTCAGGGTGTGGAGGG + Intronic
936388985 2:112055146-112055168 CGGGAGTGTGGGGGCGGGGTGGG - Intergenic
937604100 2:123775708-123775730 GGGGCTTGTCAGGGTGTGGGAGG - Intergenic
938386105 2:130868446-130868468 TGGGTGTGGGAGGGTGGGGTGGG + Intronic
939050699 2:137303960-137303982 AGGGCCTGTCAGGGGGTGGTGGG - Intronic
939649672 2:144745463-144745485 AGAGAGGGTGAGGGTGTGGTGGG - Intergenic
941043417 2:160648269-160648291 CGGCCGTGCGAGGGTGGGGGTGG - Intergenic
941277140 2:163503679-163503701 AGGGCCTGTCAGGGTGTGGGGGG + Intergenic
941891809 2:170590430-170590452 TAGGGGTGTGAGGGTGGGGTGGG - Intronic
941995284 2:171596223-171596245 CGTGCCTGTGAGGAGGTGGTGGG - Intergenic
942432675 2:175930671-175930693 TGGGTGTGTGTGGGTGTGGGTGG + Intronic
942444276 2:176067773-176067795 CGGGCCTGCGAGGGAGTGGCAGG + Intergenic
942453332 2:176122051-176122073 CGGGCGTGTGTGAGTGTGGCAGG + Intergenic
942803402 2:179902088-179902110 GGGGCCTGTCGGGGTGTGGTGGG - Intergenic
942920971 2:181373194-181373216 AGGGCCTGGGAGGGTGTGGCAGG - Intergenic
943084326 2:183294559-183294581 GGGGCCTGTCAGGGGGTGGTGGG - Intergenic
944327653 2:198425781-198425803 AGGGCCTGTGAGGGGGTGGGGGG - Intronic
944397592 2:199286596-199286618 CAGGCAAGTGAGCGTGTGGTGGG - Intronic
945133055 2:206595471-206595493 TAGGGGTGTGGGGGTGTGGTGGG + Intronic
947132668 2:226945311-226945333 CGGGCCTGTCAGGGCGTGGGAGG - Intronic
948038681 2:234881073-234881095 GGGAAGTGTGAGAGTGTGGTGGG + Intergenic
948874425 2:240819440-240819462 CTGGCGTGGGAGGGGGTGATGGG + Intronic
1169141375 20:3229066-3229088 AGGGTGGGTGAGGGTGGGGTGGG - Intronic
1169803659 20:9536890-9536912 GGGGCCTGTGAGGGTGTGGGTGG + Intergenic
1169997299 20:11572515-11572537 GGGGCCTGTCAGGGTGTGGCGGG + Intergenic
1172305645 20:33878354-33878376 AGGGGTTGTGAGGGTGTCGTGGG + Intergenic
1173097110 20:40045022-40045044 CAGGCCTGTCAGGGGGTGGTGGG - Intergenic
1173854323 20:46240352-46240374 CGTGGGTCTGAGTGTGTGGTTGG + Intronic
1174106212 20:48164224-48164246 TGTGCGTGTGAGGGTGTGTGAGG - Intergenic
1175960167 20:62631785-62631807 CGGCTGTGTGAGGGTGGGGGTGG + Intergenic
1176410679 21:6447971-6447993 CTGGCCTGTGGGGATGTGGTGGG + Intergenic
1178105596 21:29315620-29315642 AGGGTGTGTGTGTGTGTGGTTGG - Intronic
1178334360 21:31731244-31731266 CGGGCGTGTGGGGTTGGGGGCGG - Intronic
1179686173 21:43056293-43056315 CTGGCCTGTGGGGATGTGGTGGG + Intronic
1180065152 21:45408708-45408730 CGGGGGTGGGAGGGTGTTGTGGG - Intronic
1180309727 22:11159105-11159127 TGGGTGTGTGAGGGTGTGTATGG + Intergenic
1180548204 22:16520915-16520937 TGGGTGTGTGAGGGTGTGTATGG + Intergenic
1181045172 22:20210910-20210932 CAAGGGTGTGAGGGTGTGGGAGG + Intergenic
1181475395 22:23164897-23164919 GGGGCCTGTGGGGGTGGGGTGGG - Intergenic
1181853375 22:25765757-25765779 TGGGCATATGAGGGTGGGGTGGG + Intronic
1182211237 22:28679391-28679413 TGGGTGTGTGAGGGTGTGTATGG - Intronic
1183279461 22:36924251-36924273 GGGGAGTGTGAGTGTGGGGTGGG - Intronic
1183284150 22:36952066-36952088 GGGGAGTGTGAGTGTGGGGTGGG + Intergenic
1183482472 22:38072637-38072659 CTGGCGTGTGAGGGTGGGGAGGG + Intronic
1184160318 22:42693731-42693753 GGGCCGTGGGAGGGTGGGGTGGG + Exonic
1185336263 22:50272019-50272041 CGGGCGTGTGGGGTGGGGGTGGG + Intergenic
1185379043 22:50498581-50498603 TGGCTGTGTGAGGGTGGGGTTGG - Intergenic
950282621 3:11720270-11720292 CGGGGGTGAGCGGGTGTGGACGG - Intronic
950572677 3:13811743-13811765 CAGGCGGGTGAGGGTGTCTTGGG - Intergenic
950747019 3:15098946-15098968 GGGCCGTGTGTGGTTGTGGTGGG - Intronic
953381694 3:42477185-42477207 CTGGCTTGTGAAAGTGTGGTGGG - Intergenic
953669798 3:44952704-44952726 GGAGCGGGTGAGGGTTTGGTTGG - Intronic
954582328 3:51709715-51709737 CGGGTGTGTGTGGGTGTGTGGGG - Intronic
955286099 3:57643415-57643437 CAGGCGTGTGTGTGTGTTGTGGG - Intronic
957633257 3:82745769-82745791 CTGTGGTCTGAGGGTGTGGTTGG - Intergenic
958091571 3:88883305-88883327 GGGGCCTGTCAGGGTGTGGAGGG + Intergenic
958154992 3:89745425-89745447 CGGGGGTGTCAGGGGGTGGGGGG - Intergenic
959250046 3:103930339-103930361 AGGGCCTGTCAGGGTGTGGGGGG - Intergenic
961733775 3:128987420-128987442 TAGGGGAGTGAGGGTGTGGTGGG - Intronic
961818021 3:129561293-129561315 GGGGCGTCTGAGGGTGTGGAGGG + Intronic
962175032 3:133144124-133144146 AGGGCCTGTCAGGGTGTGGGCGG - Intronic
962296178 3:134189629-134189651 CGGGCGTGGGAGGCTGAGGCAGG + Intronic
964689229 3:159431283-159431305 TGTGTGTGGGAGGGTGTGGTGGG + Intronic
965002464 3:162972122-162972144 TGGGTGTATGAGGGTGAGGTAGG + Intergenic
966880115 3:184345313-184345335 GGGCTGTGTGAGGGTGGGGTGGG + Intronic
967129616 3:186458463-186458485 TGGGCGGGGGAGGGTGTAGTGGG + Intergenic
968045909 3:195623879-195623901 GGGGCGGGTGGGGGTGGGGTTGG + Intergenic
968086880 3:195877785-195877807 CAGGCCTGGGAGGGGGTGGTGGG + Intronic
968335074 3:197906759-197906781 CTGGGGTGTGAGGGTGTGGGGGG - Intronic
968930974 4:3578615-3578637 TGGGCGTGTTATGGGGTGGTTGG - Intronic
970232058 4:13921044-13921066 AGGGCGAGTGAGGATGTGGCTGG - Intergenic
970277114 4:14413088-14413110 GGGGCCTGTTAGGGTGTGGGGGG + Intergenic
971427953 4:26534309-26534331 CGGGCTAGGGTGGGTGTGGTGGG - Intergenic
973079341 4:45970597-45970619 CAGGCATGTGAGAGTGTGGCAGG + Intergenic
973104829 4:46322440-46322462 CGTGGGTGTGTGGATGTGGTGGG - Intronic
977243622 4:94603692-94603714 CGCGCGTGTGTGAGTGTGCTGGG + Intronic
978126808 4:105146074-105146096 CGGGCCTCTGAGGGTAAGGTGGG + Intronic
980729715 4:136810906-136810928 CGGCTGTGTGAGGCTGTGGTTGG + Intergenic
982831060 4:160061321-160061343 AGGGCCTGTCAGGGGGTGGTGGG - Intergenic
983006986 4:162495320-162495342 CGCGCGTGTGTGTGTGTGGTGGG - Intergenic
983943775 4:173564061-173564083 GGGGGGTGTGAGTGTGTGGGTGG - Intergenic
985171913 4:187159305-187159327 AGGGCGTGTCAGGGGGTGGGGGG - Intergenic
985555315 5:555270-555292 CAGGCGGTTCAGGGTGTGGTGGG + Intergenic
985818220 5:2142433-2142455 CGGGTGTGTGAGGGTGTGTGTGG + Intergenic
985956451 5:3269332-3269354 CGTGCGTGTGTGTGTGTGGGGGG + Intergenic
986311664 5:6555799-6555821 CAGGAGTTTGAGGCTGTGGTGGG - Intergenic
991110191 5:62891024-62891046 AGGGCCTGTCAGGGTGTGGGGGG - Intergenic
991232326 5:64349589-64349611 GGGGCCTGTCATGGTGTGGTGGG - Intronic
992446290 5:76837102-76837124 CAGGAGTGTGAGGCTGTAGTGGG - Intergenic
993030480 5:82700010-82700032 CGCGCGTGTGTGTGTGTGATAGG - Intergenic
993478529 5:88394599-88394621 CGTGCATGTGAGTGTGTGTTTGG - Intergenic
995206238 5:109484746-109484768 GGAGTGTGTGTGGGTGTGGTTGG + Intergenic
995810560 5:116102818-116102840 GGGGCCTGTCAGGGTGTGGGGGG - Intronic
996244783 5:121248714-121248736 GGGGCTTGTCAGGGGGTGGTGGG - Intergenic
996409114 5:123137628-123137650 CGGGCCTGTCAGGGGGTGGGGGG + Intronic
996596372 5:125207687-125207709 CGGGCCTGTTAGGGGGTGGGGGG + Intergenic
997903319 5:137788936-137788958 GGGGCCTGTCAGGGGGTGGTGGG + Intergenic
998372769 5:141671994-141672016 AGGGTGTGTGAGGGTGTGTGAGG + Intronic
998372773 5:141672004-141672026 AGGGTGTGTGAGGGTGTGAGGGG + Intronic
998586345 5:143431485-143431507 CGGGCCTGTCAGGGGGTGGGGGG + Intronic
998675904 5:144407696-144407718 AGGGCCTGTGAGGGGGTGGGAGG - Intronic
998732042 5:145089590-145089612 GGGGCTTGTGGGGGTGTGGGGGG + Intergenic
998827786 5:146121815-146121837 AGGGCCTGTCAGGGTGGGGTGGG + Intronic
1000351077 5:160353484-160353506 CGTGTGTGTGAGTGGGTGGTGGG - Intronic
1000981663 5:167823376-167823398 CGTGTGTGTGAGTGTGTGGGTGG - Intronic
1001640026 5:173237346-173237368 CGGGCGGGGGGGGGTGTCGTTGG + Intergenic
1001731586 5:173964447-173964469 AGGGTGGGTGAGGGTGGGGTGGG + Intergenic
1001958511 5:175865054-175865076 CGTGCATGTGAGTATGTGGTTGG - Intronic
1002419728 5:179139323-179139345 GGGGTGTGTGGGGGTGAGGTGGG + Intronic
1002851934 6:1004021-1004043 CGGGCGAGTGAGGGTCTTGCGGG - Intergenic
1003872623 6:10414229-10414251 GGGGTGTGTGGGGGTGGGGTGGG - Intronic
1005348412 6:24911483-24911505 GGGCGGTGTGAGGGTGAGGTTGG + Intronic
1007077409 6:39076675-39076697 TGTGTGTGTGAGGGTGTGGTGGG - Intronic
1007633570 6:43285452-43285474 CGGGCGCGTAAGGCTGTGCTGGG - Exonic
1009712923 6:67347853-67347875 CGGGCTTGTGAGAGTGTGACAGG + Intergenic
1009745239 6:67804805-67804827 AGGGCCTGTCAGGGAGTGGTGGG - Intergenic
1011291592 6:85782456-85782478 AGGGCCTGTCAGGGTGTGGGGGG - Intergenic
1011603651 6:89081522-89081544 CGGGCGGGTGGGGGCGGGGTGGG + Intronic
1012766108 6:103368867-103368889 CGGGCCTGTAAGGGTGTGGGGGG - Intergenic
1013465964 6:110417341-110417363 AGGGCCGGTGAGGGGGTGGTGGG + Intergenic
1014128565 6:117805156-117805178 GGGGCCTGTCAGGGGGTGGTGGG - Intergenic
1014256913 6:119169757-119169779 AGGGCCTGTCAGGGGGTGGTGGG + Intergenic
1014729571 6:125016773-125016795 GGGGCCTGTGAGGGGGTGGGGGG + Intronic
1015597362 6:134878539-134878561 TGGCTGGGTGAGGGTGTGGTGGG - Intergenic
1015987569 6:138899824-138899846 GGGGAGTGGGAGGGTGGGGTGGG + Intronic
1017508323 6:155089218-155089240 CGGGGGGGTGGGGGTGTGGGGGG + Intronic
1017509764 6:155104046-155104068 GGGGTGTGTGGGGGTGTGGGGGG - Intronic
1017592511 6:155992766-155992788 CGAGGGTGTGTGGGGGTGGTAGG - Intergenic
1018378870 6:163239946-163239968 TGGGAGTGTGAGTGTGTGGGGGG - Intronic
1019433753 7:1011477-1011499 TGGGCGTGTGAAGGTGTGTCTGG - Intronic
1020096682 7:5373556-5373578 CAGGTGTGTGAGCGTGTGCTTGG - Intronic
1022091988 7:27113880-27113902 CGGGGGTGTGGGGGAGGGGTGGG - Intronic
1022313291 7:29218195-29218217 CTGGCGAGTGAGGGGGTGGAAGG - Intronic
1024005851 7:45224537-45224559 GGGGCCTGAGAGGGTGTGGCAGG + Intergenic
1024051092 7:45623907-45623929 CTGCCCTGTGAGGGTGTGGGAGG + Intronic
1024473672 7:49788870-49788892 GGGGGGTGTGAGGGTGTGTGTGG + Intronic
1024866697 7:53911523-53911545 CGGGTGTGTGAGAGTGTGTGTGG - Intergenic
1025260298 7:57413852-57413874 CAGGAGTGGAAGGGTGTGGTGGG + Intergenic
1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG + Intergenic
1026468466 7:70674492-70674514 CGAGGGAGTGAGGGTGGGGTAGG + Intronic
1028033167 7:85944411-85944433 GGGGTGTGTGTGTGTGTGGTGGG - Intergenic
1028837287 7:95388928-95388950 GGGGCCTGTCAGGGTGTGGGGGG + Intronic
1029127031 7:98301682-98301704 CGCGCGTCTGTGTGTGTGGTGGG + Intronic
1030447609 7:109667142-109667164 GGTGAGTGTGAGGGTGTGGAGGG + Intergenic
1031267565 7:119600566-119600588 GGGGCCTGTAAGGGTGTGGATGG - Intergenic
1031705366 7:124974707-124974729 GGGGCCTGTTAGGGTGTGGGGGG - Intergenic
1031756835 7:125654877-125654899 GGGGCCTGTCAGGGTGTGGTAGG - Intergenic
1032020814 7:128406287-128406309 GGGGGGTGTGGGGGTGTGGGGGG - Intronic
1032197476 7:129797644-129797666 CGGGGGTGGGAGGGTGTTGGGGG + Intergenic
1032400851 7:131623286-131623308 CGGGCCCGTGGGGGTGTGGCTGG + Intergenic
1032863834 7:135906052-135906074 CGGGGGTGTGGGGGTGTAGGAGG + Intergenic
1033422507 7:141216542-141216564 CTGGTGTGTGTGTGTGTGGTAGG + Intronic
1035641935 8:1190629-1190651 CGAGGTTGTGAGTGTGTGGTTGG + Intergenic
1035717762 8:1766830-1766852 CAAGAGTGAGAGGGTGTGGTTGG + Intronic
1037607546 8:20450224-20450246 CGGGTGTGTGAGGGTAGGGGAGG + Intergenic
1040355494 8:46613869-46613891 GGGGCCTGTCAGGGGGTGGTGGG + Intergenic
1041837897 8:62237676-62237698 AGGGCCTGTCAGGGTGTGGGGGG - Intergenic
1043368585 8:79564203-79564225 GGGGCCTGTGAGGGGGTGGGGGG + Intergenic
1043818003 8:84826760-84826782 CGGGGGCGTGGGGGTGTGTTTGG - Intronic
1044313219 8:90719335-90719357 AGGGCCTGTCAGGGTGTGGGGGG + Intronic
1046291236 8:112164593-112164615 GGGGCCTGTCAGGGTGTGGGGGG - Intergenic
1046944547 8:119962435-119962457 TAGGCATGGGAGGGTGTGGTGGG + Intronic
1048292972 8:133194464-133194486 GGGGTGTGTGTGTGTGTGGTGGG + Intronic
1048624290 8:136167721-136167743 AGGGCCTGTCGGGGTGTGGTAGG + Intergenic
1049312324 8:141939644-141939666 AGGGCGTGGGTGGGTGTGGGTGG - Intergenic
1049491801 8:142908149-142908171 CGGGAGTGTAGGGGTGTGGGTGG - Intronic
1049504768 8:142990312-142990334 TGCGTGTGTGTGGGTGTGGTAGG + Intergenic
1049504785 8:142990454-142990476 GTGGTGTGTGTGGGTGTGGTAGG + Intergenic
1049504800 8:142990545-142990567 CATGTGTGTGGGGGTGTGGTAGG + Intergenic
1049908671 9:244272-244294 CGTGTGTGTGTGTGTGTGGTGGG - Intronic
1051386570 9:16515454-16515476 AGGGCGGGTGAGGGTGAGGGAGG - Intronic
1051727417 9:20102481-20102503 GGGGCCTGTGAGGGGGTGGGGGG + Intergenic
1052131747 9:24856992-24857014 GGGGCGTGTCATGGTGTGGGGGG - Intergenic
1052508643 9:29385391-29385413 GGGGCCTGTCAGGGGGTGGTGGG + Intergenic
1053542656 9:38991056-38991078 CTGTGGTGTGAGAGTGTGGTTGG + Intergenic
1054489455 9:65762702-65762724 CGGGGGGGTGGGGGTGTGGGGGG - Intergenic
1057117724 9:92541425-92541447 TGGGGGTGTGGGGGTGTGGGCGG - Intronic
1057211682 9:93204036-93204058 CTGGTGTGTGTGTGTGTGGTGGG + Intronic
1057222316 9:93263846-93263868 GGGGTGTGTGGGGGTGTGGCGGG + Intronic
1057263975 9:93601931-93601953 CGGGGGTGGTAGGGTGGGGTGGG + Intronic
1057271073 9:93651810-93651832 AGGACGTTTGAGGGTGTGGTGGG + Intronic
1060176405 9:121500061-121500083 CGGGCGTTGGAGGATGGGGTGGG + Intergenic
1060788331 9:126468241-126468263 CGGGGATGTGAGGGTGAGTTTGG - Intronic
1061008338 9:127941195-127941217 CTGGCGTGGGAGGATGTGGCAGG + Exonic
1061192156 9:129088174-129088196 GGGGGGTGGGAGGGTGTTGTGGG + Intronic
1061306473 9:129735874-129735896 GGGGTGGGTGAGGGTGTTGTGGG - Intergenic
1061403912 9:130383310-130383332 CGGGCGTGTGAGGTTGGTGTTGG - Intronic
1061839205 9:133347904-133347926 GGCGGGTATGAGGGTGTGGTGGG - Intronic
1062414953 9:136443780-136443802 TGGGCGTGTTAGGGTCTCGTAGG + Intronic
1062587279 9:137255124-137255146 AGGGCGGGTGAGGGCGTGGGGGG - Intergenic
1203364313 Un_KI270442v1:243779-243801 TAGGCGAGTGACGGTGTGGTGGG - Intergenic
1186175230 X:6919745-6919767 CGGGCGTGGGAGGCTGAGGCAGG + Intergenic
1186435932 X:9543246-9543268 TGTGCGTGTGAGTGTGTTGTGGG + Intronic
1187116484 X:16357429-16357451 GGGGCGGGTGAGGGGGAGGTGGG - Intergenic
1188410017 X:29860512-29860534 CGGGCCTGTCAGGGGGTGGAGGG - Intronic
1191113475 X:56827524-56827546 CGGGCCTGTCAGGGTGTGGGGGG - Intergenic
1192109476 X:68349898-68349920 CGGGCCTGTCAGGGGGTGGGGGG + Intronic
1192141954 X:68653608-68653630 GGGGTGTGTGTGTGTGTGGTGGG - Intronic
1193527956 X:82617003-82617025 GGGGCCTGTGAGGGGGTGGAGGG - Intergenic
1195285217 X:103376860-103376882 TGGGCGTTCGAGGGTGGGGTGGG + Intronic
1196199243 X:112867020-112867042 AGGGCCTGTGAGGGTGGGGTGGG + Intergenic
1196387864 X:115177795-115177817 GGGGCCTGTGGGGGTGTGGGGGG - Intronic
1196480414 X:116141387-116141409 TGGGCCTGTGATGGTGAGGTGGG - Intergenic
1196553684 X:117061398-117061420 AGGGCCTGTCAGGGTGTGGAGGG - Intergenic
1196606967 X:117668305-117668327 GGGGCGTGTCAGGGGGTGGGGGG - Intergenic
1198652406 X:138877103-138877125 AGGGCCTGTCAGGGGGTGGTGGG + Intronic
1199573413 X:149290334-149290356 TGGGCCTCTGAGGGGGTGGTGGG - Intergenic
1200080267 X:153572746-153572768 TCGGTGTGTGAGTGTGTGGTTGG - Intronic
1200122551 X:153798007-153798029 CTGGCGTGTGGGGGTGGGGAGGG - Intronic
1200652942 Y:5864467-5864489 AGGGGGTGTGGGGATGTGGTAGG + Intergenic
1201188959 Y:11430271-11430293 TGGGTGTGTGAGGGTGTGTATGG + Intergenic