ID: 1106140148

View in Genome Browser
Species Human (GRCh38)
Location 13:27005201-27005223
Sequence CCACTGAGATTACGATAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106140143_1106140148 -8 Left 1106140143 13:27005186-27005208 CCATCTCTTCTTGTCCCACTGAG 0: 1
1: 0
2: 4
3: 29
4: 451
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140142_1106140148 0 Left 1106140142 13:27005178-27005200 CCTCAGTTCCATCTCTTCTTGTC 0: 1
1: 0
2: 3
3: 44
4: 350
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140136_1106140148 20 Left 1106140136 13:27005158-27005180 CCCCATTCCCACCAATCGTGCCT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140141_1106140148 9 Left 1106140141 13:27005169-27005191 CCAATCGTGCCTCAGTTCCATCT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140140_1106140148 12 Left 1106140140 13:27005166-27005188 CCACCAATCGTGCCTCAGTTCCA 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140137_1106140148 19 Left 1106140137 13:27005159-27005181 CCCATTCCCACCAATCGTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140139_1106140148 13 Left 1106140139 13:27005165-27005187 CCCACCAATCGTGCCTCAGTTCC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140138_1106140148 18 Left 1106140138 13:27005160-27005182 CCATTCCCACCAATCGTGCCTCA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1106140135_1106140148 26 Left 1106140135 13:27005152-27005174 CCTCTGCCCCATTCCCACCAATC 0: 1
1: 0
2: 4
3: 48
4: 518
Right 1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106140148 Original CRISPR CCACTGAGATTACGATAAAG GGG Intergenic
905419621 1:37831662-37831684 GCAATCAGATTAAGATAAAGTGG + Intronic
907332617 1:53681113-53681135 CCTCTGAAATTAAGTTAAAGAGG + Intronic
910070685 1:83209616-83209638 ACACTTGGATTACTATAAAGTGG - Intergenic
924813149 1:247420877-247420899 CTGCTGAGATTCAGATAAAGAGG - Intronic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1065181691 10:23132524-23132546 CCACTGAAATTAGAATAAAGAGG - Intergenic
1065835904 10:29658302-29658324 TCACTGAGTTTACGATGAATGGG - Intronic
1076551512 10:131281101-131281123 CCATTGAGATTATGAGAAAGAGG - Intronic
1078493798 11:11795997-11796019 CCACTGAGAAAAAGATAAACCGG - Intergenic
1081729398 11:45358818-45358840 CCACTGAAACTACGATGAAGTGG + Intergenic
1098091577 12:66907679-66907701 CCAATGAGATGACGATAGAAGGG + Intergenic
1101701056 12:107174362-107174384 CCACTGAGAGCAGGATAAACTGG + Intergenic
1106140148 13:27005201-27005223 CCACTGAGATTACGATAAAGGGG + Intergenic
1107005106 13:35600834-35600856 CCAGTGAGTTGAAGATAAAGGGG - Intronic
1110491758 13:76118058-76118080 CCCCTGAGATTATGGTACAGTGG + Intergenic
1110783407 13:79493086-79493108 CCACTGAGTTTACAATCTAGTGG - Intronic
1114295386 14:21324682-21324704 CCATGGAGATGAGGATAAAGTGG + Exonic
1115525141 14:34272405-34272427 CCACTGAGGATACGAGAAGGTGG - Intronic
1117026174 14:51622392-51622414 CCAGTGAAATTAGGATAAAATGG + Intronic
1120838201 14:89059949-89059971 CCACTGAGATTTACATCAAGGGG + Intergenic
1122573791 14:102727448-102727470 TCACTGAGATTAGGAGACAGGGG + Exonic
1124907169 15:33880783-33880805 CCACAGAGATTAAGATATTGGGG + Intronic
1137759758 16:50930865-50930887 CCACTGAGTTTATGATGAGGAGG + Intergenic
1141981854 16:87555462-87555484 CCACTGAGATTAGGACAGCGAGG - Intergenic
1143991381 17:10966036-10966058 CCACTGAGTTTAAGAGAAATGGG - Intergenic
1149548843 17:57524821-57524843 CCACTGAGTGTATGTTAAAGAGG + Intronic
1157568076 18:48693532-48693554 CACCTGAGATGAGGATAAAGGGG - Intronic
1157855757 18:51104253-51104275 CCACTGAAAATACAACAAAGAGG - Intergenic
1160273269 18:77407611-77407633 CCACTGAGATAACAATAAGCAGG + Intergenic
1167379693 19:49131528-49131550 TCACTGGGATTAGGATAAAGCGG - Intronic
1167773299 19:51537214-51537236 CCCTTGAGAATACGATCAAGTGG + Intergenic
926911039 2:17852580-17852602 CCACTGAGAGCAAGAGAAAGTGG + Intergenic
932316578 2:70788387-70788409 CCACTGAGTTAATGATATAGAGG + Intronic
932672398 2:73749722-73749744 CCACTGAGATTATCATGAAAAGG - Intergenic
938395602 2:130945441-130945463 CCACTGCCATTACCATAATGAGG + Intronic
943175188 2:184463774-184463796 CCACTGAGAGAAGGATCAAGTGG + Intergenic
1170211205 20:13847832-13847854 CAACTGATATTAAGATTAAGTGG - Intergenic
1170701295 20:18706029-18706051 TCACTCAGATTTGGATAAAGAGG + Intronic
1173176029 20:40765589-40765611 CCACTGATCTGAAGATAAAGGGG + Intergenic
951625349 3:24656057-24656079 ACACTGAGGTTACAATAAAAAGG - Intergenic
954896951 3:53983732-53983754 CCACTAAAATTACTATAAAAAGG - Intergenic
960825610 3:121780454-121780476 CCTCTGTGATTACCATAAAGAGG - Intronic
971055534 4:22908944-22908966 TCAATGAGATGACGATGAAGGGG - Intergenic
971354537 4:25883264-25883286 CCAATGAGAATATGATAAAAAGG + Intronic
978911922 4:114073976-114073998 CTACTGAAACTAGGATAAAGGGG + Intergenic
985968303 5:3354248-3354270 CAACTGAGATCATGATAAATTGG - Intergenic
986335479 5:6752100-6752122 CCACTGTGATGACCATAAAAAGG - Intronic
990617856 5:57525650-57525672 GCACTGAGATTACTATGAGGTGG - Intergenic
1005144156 6:22668390-22668412 CCACAGAGATACCGATAGAGAGG - Intergenic
1008295386 6:49769385-49769407 CCCCTGAGATTCAGATATAGGGG + Intergenic
1027288405 7:76674479-76674501 ACACTTGGATTACTATAAAGAGG - Intergenic
1027719223 7:81717623-81717645 CCACTGGGATTACCAAATAGAGG - Intronic
1031028923 7:116713461-116713483 CCACTGGGATTACGATCCTGTGG - Intronic
1031545525 7:123047638-123047660 CCACTTATATAATGATAAAGGGG - Intergenic
1038756669 8:30347853-30347875 CCACTAAGATCACGACAAAAAGG - Intergenic
1040003441 8:42598509-42598531 CCATTGAGATTAAGATAATTAGG + Intergenic
1040514234 8:48121489-48121511 TAAATGAGATTATGATAAAGAGG + Intergenic
1041195430 8:55397303-55397325 CCACTGAGATTACACAATAGAGG - Intronic
1042740877 8:72044659-72044681 ACACTGAGATTAAGACAAACTGG - Intronic
1043219432 8:77640775-77640797 ACACTGAGAATACAATAAATGGG + Intergenic
1044325133 8:90850315-90850337 TTACTGAGATTATGATCAAGGGG - Intronic
1047605018 8:126466273-126466295 ACACTGAGTTTACGCTAATGAGG + Intergenic
1048733807 8:137474815-137474837 CCTTTGTGATAACGATAAAGTGG + Intergenic
1053524765 9:38817293-38817315 CCACTAAGATGACAATAAGGGGG - Intergenic
1054197000 9:62041709-62041731 CCACTAAGATGACAATAAGGGGG - Intergenic
1054641406 9:67546985-67547007 CCACTAAGATGACAATAAGGGGG + Intergenic
1196055577 X:111351529-111351551 CCACTGAGTTTGCAATTAAGTGG + Intronic
1199298155 X:146182527-146182549 AAACTGAGATCAAGATAAAGAGG + Intergenic