ID: 1106142560

View in Genome Browser
Species Human (GRCh38)
Location 13:27023474-27023496
Sequence CTACTCTGCCTGGCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106142558_1106142560 4 Left 1106142558 13:27023447-27023469 CCAAAGTATTGGGATTATAGGCG 0: 48
1: 1592
2: 27382
3: 187637
4: 305362
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348
1106142553_1106142560 14 Left 1106142553 13:27023437-27023459 CCTCAGCCTCCCAAAGTATTGGG 0: 334
1: 10461
2: 110789
3: 230243
4: 244570
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348
1106142550_1106142560 18 Left 1106142550 13:27023433-27023455 CCCGCCTCAGCCTCCCAAAGTAT 0: 255
1: 8048
2: 83422
3: 205084
4: 248618
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348
1106142551_1106142560 17 Left 1106142551 13:27023434-27023456 CCGCCTCAGCCTCCCAAAGTATT 0: 247
1: 7301
2: 78685
3: 163903
4: 158838
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348
1106142557_1106142560 5 Left 1106142557 13:27023446-27023468 CCCAAAGTATTGGGATTATAGGC 0: 107
1: 3473
2: 49922
3: 286434
4: 269458
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348
1106142555_1106142560 8 Left 1106142555 13:27023443-27023465 CCTCCCAAAGTATTGGGATTATA 0: 141
1: 4512
2: 63717
3: 362860
4: 241947
Right 1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG 0: 1
1: 0
2: 5
3: 53
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106142560 Original CRISPR CTACTCTGCCTGGCCAAAAC TGG Intergenic
900983125 1:6057861-6057883 CCACTGTGCCTGGCCATGACTGG - Intronic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
901707833 1:11089668-11089690 CCACTGTGCCTGGCCAGAGCTGG - Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
904124713 1:28229958-28229980 CTACTCCGCCTGGCCAAGTCAGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905598873 1:39233319-39233341 CCACTGTGCCTGGCCAACCCAGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
907944671 1:59124580-59124602 CTACCCTGCCTGGGTCAAACAGG + Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
909815120 1:79983254-79983276 CCACTGTGCCTGGCCACAAAAGG - Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
920500822 1:206484276-206484298 CCACTGTGCCAGGCCTAAACTGG + Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922697620 1:227739310-227739332 CCACTGTGCCTGGCCAGGACGGG + Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
923708316 1:236363876-236363898 CCACTAAGCCTGGCCAAGACTGG - Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
1063231688 10:4071816-4071838 CCACTGTGCCCGGCCAAAAATGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1064212331 10:13370514-13370536 CTACTGTGCCTGGCCTAAAATGG + Intergenic
1064294133 10:14062774-14062796 CCACTGTGCCTGGCCAGGACTGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064655758 10:17554005-17554027 CTTCTCTGCCTGGCCATACCAGG - Intergenic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065359683 10:24877906-24877928 CCACTGTGCCTGGCCAGAATAGG + Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067765059 10:49079117-49079139 CCACTGTGCCTGGCCAGAAATGG + Intronic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1071129242 10:82372156-82372178 CTACTCTTGCTGGCCAACAAAGG + Intronic
1071671447 10:87612735-87612757 CCACTGTGCCCGGCCAAGACTGG - Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073990347 10:109254850-109254872 CCACTGTGCCCAGCCAAAACTGG + Intergenic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078208762 11:9253138-9253160 CTACCATACCTGGCCACAACAGG + Intronic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1082026285 11:47574925-47574947 CCACTGTGCCTGGCCTAACCTGG - Intronic
1082070221 11:47933606-47933628 CTACTGCACCTGGCCAAATCTGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082760261 11:57120548-57120570 CTACTTTGCCTTTCCAAAAGGGG - Intergenic
1083131268 11:60624906-60624928 CCACTGTGGCTGGCCAAAATAGG - Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1089360341 11:117881662-117881684 CTAATCTCCTTGGCCAGAACTGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089937323 11:122377724-122377746 CTGCTCTGTCTGTCCAAATCGGG - Intergenic
1092340965 12:7675781-7675803 CCACTGTGCCCGGCCAAAATTGG - Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092977490 12:13759411-13759433 CCACTCTGGCTGGCTACAACAGG - Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1095106981 12:38245899-38245921 CTACTATAGCTGACCAAAACTGG - Intergenic
1095511928 12:42960451-42960473 ATAGTGTGCCTGTCCAAAACAGG + Intergenic
1096486960 12:51989570-51989592 CCACTGTGCCTGGCCTAAATTGG + Intronic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1098296366 12:69008173-69008195 CTACACTCCCAGGACAAAACAGG - Intergenic
1099225244 12:79961217-79961239 CCACTGCGCCCGGCCAAAACCGG + Intergenic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1100034712 12:90236497-90236519 CCACTATGCCCGGCCAAAATTGG - Intergenic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1101685200 12:107012349-107012371 CTACTCTGCCTGTGCAGAACAGG + Intronic
1101960570 12:109246375-109246397 CTCCTCTGCCATGCCAATACGGG - Exonic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1103374172 12:120442270-120442292 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1105625212 13:22106267-22106289 TTACTCTGCCTTGGCAAAGCGGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106391336 13:29338077-29338099 CCACTGTGCCTGGCCATGACCGG + Intronic
1107332288 13:39314148-39314170 CCACTATGCCTGGCCAATAAAGG - Intergenic
1108326244 13:49334495-49334517 CTTCTCTGCCTGTTCAAACCTGG + Intronic
1109043691 13:57378532-57378554 CTACTGCGCCAGGCCAAGACTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109393303 13:61721358-61721380 CCACTGTGCCCGGCCAAAATTGG + Intergenic
1110409996 13:75194480-75194502 CCACTCTACCTGGCCAAGATGGG + Intergenic
1110742878 13:79018503-79018525 CCACTCAGCCTGACCTAAACAGG - Intergenic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1113466924 13:110519597-110519619 CCACTCTGCCTGGCCACAGAAGG + Intergenic
1113800518 13:113084022-113084044 CTACACTGACTGCCCAGAACTGG + Exonic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1115965238 14:38880179-38880201 CCACTGCACCTGGCCAAAACAGG + Intergenic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116523120 14:45873202-45873224 CCACTGTGCCTGGCCACAAGTGG - Intergenic
1117682882 14:58223423-58223445 CCACTGCACCTGGCCAAAACAGG + Intronic
1118227304 14:63913988-63914010 CCACTGTGCCTGGCCATAAATGG + Intronic
1118659722 14:67995455-67995477 CTACTCCACATGTCCAAAACTGG + Intronic
1119012438 14:71008367-71008389 CCACTGCGCCCGGCCAAAACAGG - Intronic
1119050041 14:71358147-71358169 CCACTGTGCCCGGCCAACACTGG + Intronic
1119263017 14:73249384-73249406 CCACTGTGCATGGCCATAACAGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1125487051 15:40118758-40118780 CCACTGAGCCTGGCCAACACTGG - Intergenic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126607086 15:50488858-50488880 CCACTGTGCCCGGCCAAACCTGG + Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127837087 15:62798644-62798666 CTAGTCTGTCTGGACAAAACTGG + Intronic
1127897143 15:63311229-63311251 GTACTGTGCCTGGCCAAGAGAGG + Intergenic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1128624421 15:69185014-69185036 CAACTCTGAGTGGCAAAAACTGG - Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1128694395 15:69749575-69749597 GTACTCAGCCTGGCCAAACCTGG + Intergenic
1128947576 15:71839695-71839717 CTACTGTGCCTGGCCTGAATCGG + Intronic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1131711272 15:95059318-95059340 GTACTCATCCTGGCCAACACAGG - Intergenic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133641359 16:7720505-7720527 CTACTGTGCCTGGCCAGATGTGG - Intergenic
1133730277 16:8572721-8572743 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1133785278 16:8968485-8968507 CCACTGTGCCTGGCCACACCCGG - Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134607479 16:15582498-15582520 CTTGTCTGCCTGCCCAAGACTGG - Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135147636 16:19976560-19976582 CCACTGTGCCTAGCCAAAATTGG + Intergenic
1137552676 16:49451250-49451272 CTAGTCTGGCTGGCCGGAACAGG + Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139328859 16:66172275-66172297 CTTCTATGCCTGACCAAAAGCGG + Intergenic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139468180 16:67165039-67165061 CTTCTCTGAATGGCCAAATCCGG - Intronic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139659527 16:68411332-68411354 CCACACTGCCTGGCCAGAGCTGG + Intronic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1141939904 16:87268633-87268655 CCACTGTGCCTGGCCAGGACAGG - Intronic
1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG + Intronic
1143094363 17:4469372-4469394 CCACTGTGCCTGGCCTCAACTGG + Intronic
1143544536 17:7588603-7588625 CTACCCTGTCTGCCCAGAACTGG - Intronic
1145056339 17:19706355-19706377 CTGCTCTGCCTGGCCCATGCTGG + Intronic
1145075847 17:19854009-19854031 CCACTGTGCCTGGCCAGAATTGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146412402 17:32598084-32598106 CCACTGTGCCTGGCCCTAACAGG - Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147023926 17:37564132-37564154 CCACTGTGCCTGGCCAACCCTGG + Intronic
1147398141 17:40161262-40161284 CCACTGTGCCAGGCCAAAATAGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147532027 17:41288379-41288401 CCACTGTGCCAGGCCAAAATGGG - Intergenic
1147617533 17:41838537-41838559 CCACTGTGCCTGGCCAACTCTGG + Intronic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148507386 17:48138655-48138677 CCACTGCGCCTGGCCACAACTGG + Intronic
1149749993 17:59136449-59136471 CCACTGTGCCTGGCCAGTACTGG + Intronic
1149937417 17:60821920-60821942 CTACTTTGGCAGGCCAAAGCAGG - Intronic
1150149180 17:62794985-62795007 CTACTCTTCACAGCCAAAACAGG - Intronic
1150482412 17:65520680-65520702 CTACCCAGCCTGGGCCAAACTGG - Intergenic
1150765257 17:67997030-67997052 CCACCCTGCCTGGCCTCAACAGG - Intergenic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151477033 17:74350084-74350106 CTACTGTGCCTGGCCACAGACGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153299342 18:3579495-3579517 CTACTGTGCCTGGCCACGCCTGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161751756 19:6102835-6102857 CCACTGTGCCTGGCCATAAGAGG - Intronic
1161899668 19:7109192-7109214 CCACTGTGCCCGGCCAAAAGTGG + Intergenic
1162165255 19:8748473-8748495 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162166320 19:8755927-8755949 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162167386 19:8763383-8763405 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162168327 19:8769683-8769705 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162170074 19:8782448-8782470 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162171155 19:8790101-8790123 CTACTGTGCGTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1164845911 19:31432441-31432463 CTACTCTGCCTGGACACAACAGG + Intergenic
1165502854 19:36203864-36203886 CTACTGTGCCTGGCCTAACAAGG + Intronic
1165507465 19:36243319-36243341 CCACTGTGCCAGGCCCAAACTGG + Intronic
1165653267 19:37510071-37510093 CCACTGTGCCTGGCCAAACAAGG - Intronic
926035855 2:9635101-9635123 CCACTGTGCCTGGCCTAAATCGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
927352911 2:22138902-22138924 CTACTCTGCTTTGTCAAAAGTGG + Intergenic
927556247 2:24034860-24034882 CCACTGTGCCTGGCCAAACATGG + Intronic
927675659 2:25104058-25104080 CCACTGTGCCTGGCCACCACGGG - Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930813905 2:55571905-55571927 CCACTGCGCCTGGCCAACACTGG + Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
931235493 2:60409379-60409401 CTGCCCTGCCTGCCCTAAACCGG - Intergenic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932049070 2:68381006-68381028 CCACTCTGCCAGGTCAATACTGG + Intronic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
934886321 2:98028661-98028683 CTCCTCTGCCCTGCCAAACCAGG + Intergenic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936240191 2:110781352-110781374 CGACTGTGCCTGGCCAAGTCTGG - Intronic
937001999 2:118476372-118476394 CTACTTTTCTTGGCCAAAAATGG + Intergenic
937260277 2:120581083-120581105 CTTCTCTTCCTGGCCAACGCAGG - Intergenic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938250339 2:129810920-129810942 CTACTCTGGCTGGGGAGAACAGG + Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
943704212 2:191017912-191017934 CCACTGTGCCTGGCCTCAACTGG + Intronic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
944156087 2:196609217-196609239 CCACTGCACCTGGCCAAAACTGG - Intergenic
944233354 2:197417946-197417968 CCACTGTGCCTGGCCATTACAGG - Intronic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
947151438 2:227120648-227120670 CCACTGTGCCTGGCCAGCACTGG - Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948047864 2:234957555-234957577 CTACTCTTGCTGGCCAAATTCGG - Intronic
948303765 2:236931265-236931287 CTACTATGCCTGGAAACAACTGG - Intergenic
1169060160 20:2655224-2655246 CTACTCTGCCTGGAGGAAATGGG - Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1170699173 20:18687809-18687831 CCACTGTGCCTAGCCAAAATAGG + Intronic
1171451012 20:25236478-25236500 CTGCTCTTCCTGCCTAAAACGGG - Intergenic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172864752 20:38087245-38087267 CCACTGCGCCTGGCCACAACTGG + Intronic
1174007411 20:47421439-47421461 CCACTGTGCCTGGCCACAAATGG + Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1179142025 21:38734059-38734081 CGCCACCGCCTGGCCAAAACTGG - Intergenic
1180213302 21:46309029-46309051 CCACTGCGCCTGGCCAAATCTGG - Intronic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1181291582 22:21798429-21798451 CCACTGTGCCTGGCCACATCTGG - Intronic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181579826 22:23821988-23822010 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1181718124 22:24750289-24750311 CTGCCCTGGCTGGCCAAAAGTGG + Intronic
1181766109 22:25093251-25093273 CTAGGCTGCCTGCTCAAAACTGG - Intronic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1183920506 22:41163460-41163482 CCACTGTGCCCGGCCAAACCTGG - Intronic
1183971057 22:41477777-41477799 CCACTGTGCCCGGCCACAACTGG - Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
949312357 3:2714133-2714155 CAACACTGCCTGGCCAACAGGGG - Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
950066839 3:10118773-10118795 CCACTGTGCCTGGCCATAAGTGG + Intronic
950174774 3:10865374-10865396 CCACTGTGCCTGGCCACCACAGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954680902 3:52345442-52345464 AGACCCTGCCTGGCCAAACCAGG - Intronic
955291336 3:57695012-57695034 CCACTGTGCTTGGCCACAACTGG - Intergenic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956506006 3:69940792-69940814 CTAAACTGCCTGCCCTAAACAGG - Intronic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960907017 3:122611624-122611646 CTACTGTGCCTGGCCTTAAGAGG + Intronic
961736741 3:129006601-129006623 CCACTGTGCCCGGCCAAAAGTGG + Intronic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962530232 3:136273664-136273686 CTACTTTGCGAGGCCAAGACGGG + Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG + Intergenic
965069009 3:163892519-163892541 CCACTGTGCCTGGCCATAAATGG + Intergenic
965803211 3:172515545-172515567 CTCCTCTGGCTGGCAAAATCTGG + Intronic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
973323897 4:48837576-48837598 CCACTGTGCCTGGCCAGAATGGG + Intronic
974901769 4:68008352-68008374 CCACTGTGCCCGGCCAAAAGAGG - Intergenic
975247272 4:72133975-72133997 CCACTCTGCCTGGCCAAGGATGG - Intronic
975718323 4:77227120-77227142 GTACTCACCCTGGCCAACACAGG - Intronic
976800785 4:88989312-88989334 CCACTGTGCCTGGCCAACTCAGG - Intronic
977550169 4:98433524-98433546 GTGCTCTGACAGGCCAAAACAGG - Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978506626 4:109464505-109464527 CTACTGTGCCTGGCCCAATGTGG + Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
980906324 4:138951786-138951808 CTACTCCTCCTGGCCAATACAGG + Intergenic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
982051424 4:151506193-151506215 CCACTGTGCCTGGCCTAAATGGG + Intronic
982125730 4:152182403-152182425 CCACTGTGCCTGGCCAACTCTGG + Intergenic
982229564 4:153196095-153196117 CCACTGTGCCTGGCCAGAAAAGG + Intronic
984165935 4:176303331-176303353 CTATTCTGCCTTGCCAAGAATGG - Intergenic
986352749 5:6895579-6895601 CTACTGTGCCTGGCCAAATTAGG + Intergenic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990909500 5:60839528-60839550 CAACTGTGCATGGTCAAAACTGG + Intronic
991938590 5:71828044-71828066 CTACTGTACCTGTCCAACACTGG - Intergenic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
998578783 5:143347886-143347908 CCAGTCTGCCTTTCCAAAACGGG + Intronic
998944170 5:147319427-147319449 CCACTGTGCCTGGCCACAATGGG + Intronic
1001482652 5:172099251-172099273 CCACTGTGCCGGGCCATAACGGG - Intronic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002515079 5:179751722-179751744 CTACTGTGCCTGGCCATAATCGG - Intronic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007539543 6:42628432-42628454 CCACTGTGCCTGGCCAGTACTGG - Intronic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010213595 6:73382501-73382523 CCACTGTGCCTGGCCACACCTGG + Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010966079 6:82210536-82210558 CCACTATGCCTGGCCAATAAAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1012469270 6:99552753-99552775 CCACTGTGCCTGGCCAGAAATGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013987910 6:116219000-116219022 CCACTGTGCCTGGCCACCACTGG - Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1020195122 7:6031884-6031906 CTACTGCGTCTGGCCAAAAAAGG - Intronic
1021314168 7:19125727-19125749 CCACTCTGCCTTGCCAGAAAAGG - Intergenic
1021527914 7:21609505-21609527 CCACTGTGCCCGGCCATAACTGG + Intronic
1021605587 7:22406196-22406218 CCACTGTGCCTGGCCATGACTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022255055 7:28647791-28647813 CCACTATGCCTGGCCCAAATTGG - Intronic
1023011056 7:35925101-35925123 CCACTGTGCCTGGCCAGAGCTGG - Intergenic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1027048620 7:75007642-75007664 CTCCTCTGCCTGACCCACACTGG + Intronic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029384387 7:100234007-100234029 CTCCTCTGCCTGACCCACACTGG - Intronic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1034010789 7:147527308-147527330 CAACTGTGCCCGGCCAAGACAGG + Intronic
1035056745 7:156040814-156040836 CTACCCTGCCTTGACTAAACAGG - Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1038656874 8:29460869-29460891 CCACTGTGCCTGGCCTCAACTGG - Intergenic
1038726377 8:30085928-30085950 CCACTGTGCCTGGCCACATCTGG - Intergenic
1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042674072 8:71299195-71299217 GTACTGACCCTGGCCAAAACTGG + Exonic
1044261300 8:90125951-90125973 GTACTTTTCCTGACCAAAACTGG - Intergenic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1044736679 8:95286035-95286057 CACATCTGCCTGGTCAAAACTGG - Intergenic
1045054873 8:98360225-98360247 CTATTCTGACTCCCCAAAACTGG + Intergenic
1045336639 8:101209960-101209982 CCACTGTGCCAGGCCAAAAAAGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1048497134 8:134944688-134944710 CAACTCTAACTGGCCTAAACAGG - Intergenic
1050052102 9:1613216-1613238 CCACTATGCCTGGCCATAATGGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1051296842 9:15605390-15605412 CCACTCTGCCCGGCCAAATTAGG - Intronic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052832215 9:33225238-33225260 CTACTGTGCCTGGCCATAAGAGG + Intronic
1053322709 9:37114412-37114434 CCACTGTGCCAGGCCAAAAGTGG + Intergenic
1056638493 9:88350433-88350455 CCACTGTGCCTGGCCACAAAAGG - Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1058910614 9:109517093-109517115 TTACTTTGCCTGGCCATAGCTGG + Intergenic
1059073014 9:111159452-111159474 CTACTGTGCCAGGCCAACATAGG - Intergenic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060121612 9:120996104-120996126 CCACTGTGCCTGGCCAGAAGTGG + Intronic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060460332 9:123847127-123847149 CCACTGTGCCTGGCCATAAATGG + Intronic
1060628007 9:125130768-125130790 CCACTGTGCCCGGCCAAGACTGG + Intronic
1060692689 9:125678203-125678225 CCACTATGCCAGGCCAACACAGG + Intronic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1061190421 9:129079562-129079584 CTACTTTGCCCGGCCCAATCTGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1062283576 9:135763013-135763035 CTGCTCTGCCTGCCCCACACGGG - Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1185945924 X:4376090-4376112 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187326984 X:18300024-18300046 CCACTATGCCTGGCCAGAAAAGG + Intronic
1189175675 X:38955062-38955084 AAACTCTGCCTGGCCAAACTAGG - Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1190273746 X:48886753-48886775 CCACTGTGCCCGGCCAACACAGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1200055633 X:153458732-153458754 CTCCTCATCCTGGCCAACACTGG + Intronic
1200238306 X:154479737-154479759 CCACTTTGCCTGGCCTAAACTGG - Intergenic
1201733042 Y:17226246-17226268 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1202023698 Y:20496096-20496118 CTACTGTGCCTGTCCTAAATAGG - Intergenic