ID: 1106148623

View in Genome Browser
Species Human (GRCh38)
Location 13:27075723-27075745
Sequence GGGTGCTCAAGAGTGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106148623 Original CRISPR GGGTGCTCAAGAGTGGTAGA GGG Intronic
902280537 1:15371178-15371200 AGGTGCTCAATAGTTGTTGAAGG - Intronic
903469367 1:23575059-23575081 GGGTCCTTAAAAGTGGGAGAGGG + Intergenic
905869984 1:41397857-41397879 GGGTGCTGAAGAGGGGCAGGAGG + Intergenic
907661322 1:56394998-56395020 AGGTGCTGGAGAGTGGTTGAAGG - Intergenic
910205263 1:84743200-84743222 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
910805728 1:91188486-91188508 GGGTGCTCAAGCTTGGTGGGGGG - Intergenic
912728211 1:112077723-112077745 GGGTGCTCAAGGGTGGTGATGGG + Intergenic
913518918 1:119627409-119627431 GTGTCCTCATGAGTGGAAGAAGG + Intronic
915649085 1:157294519-157294541 GGATGCTCAAGCTTGGTAGGGGG + Intergenic
916359554 1:163952847-163952869 GGATGCTCAAGCTTGGTGGAGGG + Intergenic
916826602 1:168447928-168447950 GGGTCCTTAAGAGTGGAAAAGGG - Intergenic
917609193 1:176669035-176669057 TGGTGTCCAAGACTGGTAGATGG + Intronic
919982470 1:202650913-202650935 GAGTGCTCCAGCGTGGAAGAAGG + Intronic
922994923 1:229948470-229948492 GGCTGCTCACGTGTGGTAGCAGG - Intergenic
924742173 1:246800907-246800929 GTGTGCTCAGGAGTGGCCGAGGG - Intergenic
1064526065 10:16258138-16258160 GGGTGATAAAGAGAGGTACATGG - Intergenic
1071883130 10:89921036-89921058 GGGAGCTGTAGAGTGGGAGAGGG + Intergenic
1074985168 10:118652121-118652143 GGATGCTCAAGCTTGGAAGAGGG - Intergenic
1075079707 10:119375207-119375229 GTGTGCTGAAGTGTGGGAGAAGG - Intronic
1075316807 10:121459625-121459647 GTGTGCTCAAGAATGGCAGGAGG + Intergenic
1076617848 10:131768586-131768608 GGGTGGTCAAGATTGGTCAAAGG - Intergenic
1076617863 10:131768676-131768698 GGGTGGTCTAGAGTGGTCAAGGG - Intergenic
1077443385 11:2579004-2579026 GGGTGGTCAAGAGCGGGAGGAGG - Intronic
1078814118 11:14801975-14801997 GGATGCTCAAGCTTGGTGGAAGG - Intronic
1078919287 11:15813340-15813362 GGGTTCTTAAAAGTGGAAGAGGG - Intergenic
1081844841 11:46232894-46232916 GGGTTCTTAAAAGTGGAAGAGGG + Intergenic
1082107697 11:48238239-48238261 GGATGCTCAAGAGCTGTGGAAGG + Intergenic
1083596843 11:63921713-63921735 GGGTGCTCAAGAGGGGAGCACGG - Intergenic
1084693624 11:70741119-70741141 GGGAGTTCAAAAGTGGGAGAAGG - Intronic
1085827661 11:79865008-79865030 GGATGCTCAAGTTTGGTTGAGGG + Intergenic
1086405737 11:86497738-86497760 GGGGGCCCAGGAGTGGGAGAGGG + Intronic
1088947195 11:114526032-114526054 TGGTCCTCAAAAGTGGAAGAGGG + Intronic
1089730557 11:120516310-120516332 GGGTGCTCAGGAATGGGGGAAGG + Intronic
1090062661 11:123477347-123477369 GGGTACTTGAGAGTGGTAAATGG + Intergenic
1093410420 12:18858601-18858623 GCCTGCTGAAGAGTGGCAGAAGG + Intergenic
1097022372 12:56029406-56029428 GGGAGCTCAAGATTGGGAAAAGG + Intronic
1097580845 12:61454618-61454640 GGGTTCTCATTAGTGGAAGAGGG - Intergenic
1098038338 12:66329386-66329408 GGGTGCTGGAGAGTAATAGATGG + Intronic
1098183180 12:67869720-67869742 GGATGCTCAAGCTTGGTGGAGGG - Intergenic
1104546396 12:129716735-129716757 GGGTGCTTAAGAGTGGAAGAGGG + Intronic
1104664284 12:130636285-130636307 TGGTGCTCAAGAGTGCCAGTAGG - Intronic
1105814637 13:24023638-24023660 GGGTCCTTAAAAGTGGAAGAGGG + Intronic
1106148623 13:27075723-27075745 GGGTGCTCAAGAGTGGTAGAGGG + Intronic
1109746096 13:66624535-66624557 GGGTGCCCAAGAGAAGTTGAAGG - Intronic
1110727637 13:78843732-78843754 GGGGACACAAGGGTGGTAGATGG - Intergenic
1114821428 14:26024112-26024134 GGGTGCTCAACTGTGTTAGGAGG - Intergenic
1117349356 14:54866258-54866280 GGATGCTGAAGAGGGATAGAGGG + Intronic
1117798521 14:59419242-59419264 GGCTGCTCATGAGTGGGTGAGGG - Intergenic
1119471013 14:74899138-74899160 TGGTGCTCTAGGGAGGTAGAAGG + Intronic
1119502532 14:75142517-75142539 GTGTGGACAAGAGTGGTTGAAGG - Intronic
1120558697 14:85962548-85962570 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
1120845329 14:89120059-89120081 TGGTGCTCAGTAGTGGTGGAGGG + Intergenic
1121193837 14:92052660-92052682 GTGTGCACAAAAGTGGTAAAGGG - Exonic
1122633573 14:103119304-103119326 GGGTGATCACGAGGGGCAGAGGG - Intergenic
1127056289 15:55135502-55135524 GGATGCTCAAGCTTGGTGGAGGG + Intergenic
1128271845 15:66317122-66317144 AGGTGATCAAGAGTGACAGAGGG - Intronic
1131375566 15:91920268-91920290 GGGAGCTCAAGGGTGGTGCACGG + Intronic
1133438065 16:5797063-5797085 TTGTGATCAAGACTGGTAGATGG + Intergenic
1134760619 16:16711245-16711267 GGGTCCTTAAGTGTGGAAGAGGG - Intergenic
1134985440 16:18647928-18647950 GGGTCCTTAAGTGTGGAAGAGGG + Intergenic
1137952378 16:52795936-52795958 GGGTCCTTAAAAGTGGAAGAAGG + Intergenic
1138174790 16:54886954-54886976 GGGTCCTCAAATGTGGAAGAAGG - Intergenic
1138649916 16:58454074-58454096 GGGTCATCAAAAGTGGAAGAGGG - Intergenic
1142968332 17:3594809-3594831 GGGTGCTGAAGAGGGGTCCATGG + Intronic
1143671337 17:8397989-8398011 GGGTGCTCAGGAGAGTCAGAGGG + Intergenic
1146453217 17:32991027-32991049 GGGTGCCCAAGGATGGTAGCAGG - Intronic
1147251068 17:39152572-39152594 GGGCGCTGGAGAGTGGGAGACGG + Intronic
1147544690 17:41392152-41392174 GGGTTCTTAAAAGTGGAAGAGGG - Intronic
1147728946 17:42585023-42585045 GGGTCCTCAAAAGTGGAAGTCGG - Intronic
1149104872 17:52950676-52950698 GGGTCCTTAAAAGTGGAAGAAGG + Intergenic
1151704184 17:75758083-75758105 GGCTGCTTGAGAGAGGTAGAAGG + Exonic
1153021181 18:630471-630493 GGGTCCTTAAAAGTGGAAGAAGG + Intronic
1155114228 18:22748927-22748949 GGATGCTCAAGCGTGGTGGGGGG + Intergenic
1156437647 18:37150423-37150445 TGGTTCTCAAGTGTGGTAGGAGG - Intronic
1158399035 18:57104323-57104345 GGATGCTCAAGCTTGGTGGAAGG - Intergenic
1163325962 19:16603439-16603461 GAGTGCTCATGAGTGCTTGAGGG + Intronic
1163887024 19:19975034-19975056 AGGTACTCAAGAGTGGCAGCAGG + Intergenic
1166321147 19:42019659-42019681 GGGTCCTTAGGAGTGGAAGAAGG + Intronic
1167730786 19:51252822-51252844 GGGTGGTCAAGAGTGGTCCCAGG + Intronic
925902209 2:8516633-8516655 GCGTGCACAAGAGTGGGAAAAGG - Intergenic
930323345 2:49882484-49882506 GGATGCTCAAGCTTGGTGGAGGG + Intergenic
931566445 2:63620316-63620338 GGATGCTCAAGCTTGGTAGGGGG + Intronic
931838653 2:66126622-66126644 GGGAGCTCAAGAGTAGGAGGTGG + Intergenic
933968586 2:87451489-87451511 GGGTGATGAAGAGAGTTAGAAGG - Intergenic
934994603 2:98945828-98945850 GGGTGTTTCAGAGTGGAAGAGGG + Intergenic
935207961 2:100913080-100913102 GGGAGCTGAAGAGAGGTGGAGGG - Intronic
935674433 2:105581987-105582009 GGGTCCTTAAAAGTGGAAGAAGG + Intergenic
936325208 2:111499016-111499038 GGGTGATGAAGAGAGTTAGAAGG + Intergenic
937175952 2:119935451-119935473 GTGGGCCCAAGAGTGGTAGGTGG + Intronic
937351605 2:121167800-121167822 GGGTACTCATAAGTGGAAGAAGG - Intergenic
938324462 2:130389156-130389178 GGGTCCTCAAATGTGGAAGAGGG - Intergenic
939000334 2:136727522-136727544 TGGTGCTGAAGAGTGGTGGCAGG + Intergenic
941342912 2:164329469-164329491 GCTTGCTCCAGAGTGGGAGAAGG - Intergenic
941642129 2:167999819-167999841 GGATGACAAAGAGTGGTAGAAGG + Intronic
942199904 2:173560208-173560230 GGATGCTCAAGCTTGGTAGGGGG + Intergenic
942781895 2:179653709-179653731 GGGTACTTCAGTGTGGTAGAAGG - Intronic
943119975 2:183723710-183723732 GGGTCCACAGGAGTGGTGGATGG + Intergenic
948114620 2:235485218-235485240 GGGTCCTGAAAAGTGGGAGAGGG + Intergenic
948446596 2:238038286-238038308 GGGTCCTCAAGAGAAGTAGCAGG + Intronic
1169397040 20:5241566-5241588 GGATGCTCAAGCTTGGTGGAAGG - Intergenic
1170042435 20:12052738-12052760 TGGTGCTCATGGGAGGTAGAAGG + Intergenic
1172350911 20:34239810-34239832 GGGTGCAGAAGAGTGGGATAGGG - Intronic
1174671256 20:52309841-52309863 GAGAGGTCAAGAGTGATAGATGG - Intergenic
1175643287 20:60649429-60649451 AGGTCCTCGAGAGTGGAAGAGGG - Intergenic
1177770739 21:25512803-25512825 GGGTTCTTAAAAGTGGAAGAGGG + Intergenic
1177783523 21:25644525-25644547 GGGTCCTGATGAGTGGAAGAAGG - Intronic
1180126032 21:45790831-45790853 GGGTGCTCTGGAGAGGGAGAAGG + Intronic
1181061669 22:20284848-20284870 AGTTTCTCAAGAGTGGTGGAAGG + Intergenic
1181992491 22:26847968-26847990 GGGTGCTGCAGAATGGAAGAAGG + Intergenic
1182000974 22:26919538-26919560 GCGTCCTCAAAAGTGGAAGAGGG + Intergenic
951913700 3:27777457-27777479 GGGTGCCCTAAAGTGGTACAGGG - Intergenic
952258986 3:31721051-31721073 GGGCCCTTAAGAGTGGAAGAGGG + Intronic
955598538 3:60618771-60618793 GGGTCCTTAAAAGTGGAAGAAGG + Intronic
956300223 3:67764320-67764342 GGATGCTCAAGCGTGGTTGGGGG - Intergenic
956788067 3:72659230-72659252 TGGCGTTCAAGAATGGTAGATGG - Intergenic
959125134 3:102282136-102282158 TGGTGCTTAAGAGTGTTAGCTGG + Intronic
961562228 3:127738556-127738578 GGGTGCTCCAGCCTGGCAGATGG - Intronic
961592457 3:127991084-127991106 GGGTCCTGAAAAGTGGAAGAGGG - Intergenic
962528538 3:136257212-136257234 GGGTCCTTAAAAGTGGAAGAGGG + Intronic
962908057 3:139823272-139823294 GGGTCCCCAAGAGGGGCAGAGGG + Intergenic
967431462 3:189391114-189391136 GGGTGCTCAGGAGTAGAAAAGGG - Intergenic
969835234 4:9835075-9835097 GGGTTCTAAAGTGTGGCAGATGG - Intronic
973606173 4:52589680-52589702 GGGTGCTGATGAGTGGTAGTTGG - Intergenic
974251779 4:59394351-59394373 GGATGCTCAAGCTTGGTAGGGGG - Intergenic
975662986 4:76705959-76705981 GGGTAGTCAAGAGTTGTAAATGG - Intronic
977151725 4:93520921-93520943 GGGGGCTCAAGGGTGGGAGCGGG + Intronic
977425542 4:96863163-96863185 GGGCACTCAAGCTTGGTAGAGGG + Intergenic
979918710 4:126472909-126472931 GGGACCTCAAGAGTTGTAAATGG - Intergenic
982390439 4:154857841-154857863 GGGTGCTCAAGATTTGGAGATGG - Intergenic
984618646 4:181927316-181927338 GGAAGCTCAAGCTTGGTAGAGGG + Intergenic
986099274 5:4591724-4591746 GGGTGCTCTAGAGAAGTACATGG - Intergenic
986386827 5:7242919-7242941 GGGTGCGCAAGAATGGAAGGGGG + Intergenic
987704615 5:21446864-21446886 GGATGCTCAAGCTTGGTGGAGGG - Intergenic
988948283 5:36229995-36230017 GTGAGATCATGAGTGGTAGAGGG - Intronic
988995033 5:36706507-36706529 GGGTCCTTAAAAGTGGAAGAAGG + Intergenic
989619042 5:43367079-43367101 GGGTGCTCAAGCTTGGTGGGAGG - Intergenic
990443619 5:55871266-55871288 AGGACCTCAAGAGTGGTTGATGG - Intronic
991292592 5:65047053-65047075 GGGGTCGCAAGAGTGGAAGAAGG - Intergenic
993250603 5:85516371-85516393 GGGTCCTTAAAAGTGGAAGAAGG + Intergenic
993373918 5:87126792-87126814 GGGTGGTAAAGAGTGTTAGAAGG - Intergenic
993986887 5:94607955-94607977 GGGTTCTCAAAAGTGGAAGAGGG - Intronic
995495093 5:112733394-112733416 GGTTACTTAAGAGTGGAAGAGGG + Intronic
996910880 5:128655819-128655841 GGATGCTCAAGCTTGGTAGGGGG - Intronic
997373151 5:133375158-133375180 GGGTGCTCAAGAGTGCTGCAGGG - Intronic
1003410884 6:5862075-5862097 GGGTCCTCACAAGTGGAAGAAGG + Intergenic
1003897322 6:10619982-10620004 GGGTCCTCAACATTGGAAGAAGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010390129 6:75327362-75327384 GGGTGGACAAGAGTGGAAGTTGG - Intronic
1011791443 6:90903285-90903307 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
1012127935 6:95454095-95454117 GGAGGCTCAAGCTTGGTAGAGGG - Intergenic
1013651693 6:112201483-112201505 AGATGCTTAAGAGTGGTTGAGGG - Intronic
1015291082 6:131538856-131538878 GGGTGCTCGAGGTTGGTTGAGGG + Intergenic
1016665280 6:146632359-146632381 GAGTGCTCAAAAGTGGAAGAAGG - Intronic
1016806283 6:148215514-148215536 GGGTGCTCTGGAGTGGAAAAAGG + Intergenic
1018939238 6:168297372-168297394 GGGTCCTCATGAGAGGAAGAGGG + Intronic
1019559700 7:1649888-1649910 GGGTGACCAGGAGAGGTAGAGGG + Intergenic
1020880942 7:13762889-13762911 GGTTGCTGGAGAGAGGTAGAGGG - Intergenic
1021905886 7:25332715-25332737 GGGAGCCCAAGACAGGTAGATGG - Intergenic
1024389886 7:48796205-48796227 GGGTGATTAGGAGTGGCAGAGGG - Intergenic
1026928113 7:74207721-74207743 GGGCGCTAAAGGGTGGGAGAAGG + Intronic
1027607547 7:80318758-80318780 GGATGGTCAAGGGTGGTACAAGG - Intergenic
1029655662 7:101922758-101922780 GGGTGCTGGGGAGTGGGAGATGG + Intronic
1030703075 7:112662408-112662430 GGATGCTCAACCTTGGTAGAGGG - Intergenic
1031446194 7:121857818-121857840 AGGTCCTTAACAGTGGTAGAGGG - Intergenic
1034960339 7:155360728-155360750 GGGTGCCCAAGAGGCGCAGATGG - Intronic
1045078991 8:98603999-98604021 GGGTCCTAAAAAGTGGAAGAGGG + Intronic
1047365234 8:124205204-124205226 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
1048372523 8:133791956-133791978 GAGTGCTGAAGAGTAATAGATGG + Intergenic
1049292230 8:141810297-141810319 GGGTTTTCCAGAGTGGGAGAAGG + Intergenic
1049798454 8:144506984-144507006 GGGTGCTCAGGAGTACTCGAGGG - Exonic
1050044359 9:1527695-1527717 GGGTGATAAAGAGTGATAGTAGG + Intergenic
1052363965 9:27590133-27590155 TGATGCTTAAGAGTGGTAGCTGG - Intergenic
1055811469 9:80153668-80153690 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
1056385141 9:86090584-86090606 GGATGCTCGAGCTTGGTAGAGGG - Intronic
1056636249 9:88333568-88333590 GGGTGGTCAGGAGTGGTGGCAGG + Intergenic
1057729530 9:97596624-97596646 GGGTGCTCCACATTGGGAGATGG + Intronic
1058093273 9:100829606-100829628 GGATGCTCAAGCTTGGTAGGGGG - Intergenic
1058510709 9:105713528-105713550 GGGTGCTGAAGAGTGCGGGAGGG + Intronic
1059420403 9:114186982-114187004 GGCTGCTCAAGAGTGGAACCAGG - Intronic
1059918480 9:119130952-119130974 GGGTTCTCTAGGGTGATAGAAGG + Intergenic
1060921418 9:127423149-127423171 GGGTCCTTAAAAGTGGAAGAGGG + Intergenic
1061486411 9:130922697-130922719 GGGTGTTGAAGAGAGGAAGACGG - Intronic
1062187545 9:135226819-135226841 GGCTGCACAAGGATGGTAGAGGG - Intergenic
1186170890 X:6875413-6875435 GTGTGCTCATGTGTGGGAGATGG - Intergenic
1186501588 X:10055178-10055200 GGGTCCTTATGAGTGGAAGAAGG + Intronic
1187735880 X:22303326-22303348 GGGTGCTGAAGGGTGGCAGCAGG + Intergenic
1190031830 X:46980911-46980933 GGGTTCTTAAAAGTGGAAGAGGG + Intronic
1190338313 X:49276732-49276754 GGGTGATCCAGTGGGGTAGAGGG - Intronic
1191796233 X:65024645-65024667 AGGTGCTCATTAATGGTAGATGG + Intronic
1192574900 X:72235692-72235714 GGGTGCTTAAAAGTGGAAGAGGG - Intronic
1197896469 X:131320719-131320741 GGGTGCTTAATAGTAGTAAAAGG - Intronic
1198495018 X:137183693-137183715 GGGTCCTTAAAAGTGGAAGAGGG - Intergenic
1198533089 X:137564059-137564081 GGGAGGTGAAGAGAGGTAGAGGG + Intergenic
1198663482 X:138996480-138996502 GGGTGCTCAAGCTTGGTGGGGGG + Intronic
1199951026 X:152706359-152706381 GAGTGTTCAAGAGAGGTAGCTGG - Intergenic
1199958658 X:152762102-152762124 GAGTGTTCAAGAGAGGTAGCTGG + Intergenic