ID: 1106152815

View in Genome Browser
Species Human (GRCh38)
Location 13:27122430-27122452
Sequence GGTCTTGGGTACATCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 1, 2: 10, 3: 101, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106152806_1106152815 28 Left 1106152806 13:27122379-27122401 CCTCCCCAGCCATGTGGAACTGT 0: 3882
1: 6620
2: 7728
3: 6299
4: 4106
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152808_1106152815 24 Left 1106152808 13:27122383-27122405 CCCAGCCATGTGGAACTGTAAGT 0: 1916
1: 5849
2: 7136
3: 7378
4: 5482
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152811_1106152815 1 Left 1106152811 13:27122406-27122428 CCAACTAAAACTCTTTTTCTTCA 0: 1
1: 1
2: 66
3: 1091
4: 1708
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152809_1106152815 23 Left 1106152809 13:27122384-27122406 CCAGCCATGTGGAACTGTAAGTC 0: 1834
1: 5465
2: 6859
3: 7257
4: 5406
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152805_1106152815 29 Left 1106152805 13:27122378-27122400 CCCTCCCCAGCCATGTGGAACTG 0: 44
1: 131
2: 170
3: 192
4: 392
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152810_1106152815 19 Left 1106152810 13:27122388-27122410 CCATGTGGAACTGTAAGTCCAAC 0: 39
1: 1380
2: 2547
3: 4207
4: 6538
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263
1106152807_1106152815 25 Left 1106152807 13:27122382-27122404 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG 0: 1
1: 1
2: 10
3: 101
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106152815 Original CRISPR GGTCTTGGGTACATCTTTAT TGG Intronic
900006806 1:62426-62448 GGTTTGGGGTAGATCATTATAGG + Intergenic
900603372 1:3512776-3512798 AGTCTTGGGTATGTCTTTATCGG + Intronic
901960763 1:12824855-12824877 GGTCTTAGGTACATCCTAAAGGG - Exonic
901967358 1:12879457-12879479 GGTCTTAGGTACATCCTAAAGGG - Exonic
901982758 1:13049721-13049743 GGTCTTAGGTACATCCTAAAGGG - Intronic
901986265 1:13077617-13077639 GGTCTTAGGTACATCCTAAAGGG + Exonic
901995547 1:13149150-13149172 GGTCTTAGGTACATCCTAAAGGG - Intergenic
901999331 1:13179197-13179219 GGTCTTAGGTACATCCTAAAGGG + Intergenic
902017814 1:13322329-13322351 GGTCTTAGGTACATCCTAAAGGG + Exonic
902715821 1:18271990-18272012 AGTCTTGGGTATGTCTTTATCGG - Intronic
903307625 1:22424348-22424370 AGTCTCGGGTATGTCTTTATTGG - Intergenic
904985563 1:34545550-34545572 GGTCTTGGATACATATTCAATGG - Intergenic
905290131 1:36915829-36915851 AGTCTTGGGTATGTCTTTATTGG + Intronic
905708623 1:40081717-40081739 AGTCTCGGGTATGTCTTTATCGG + Intronic
907671973 1:56483415-56483437 TGTCTGGGGTCCACCTTTATTGG - Intergenic
908091861 1:60694924-60694946 AGTCTTGGGTATGTCTTTATTGG - Intergenic
909244511 1:73261875-73261897 AGTCTTTTGTACATTTTTATTGG + Intergenic
909956823 1:81788564-81788586 AGTCTTGGGTATTCCTTTATAGG + Intronic
910381385 1:86630377-86630399 GGTATTGGGTTCATCTTACTAGG - Intergenic
910999446 1:93146848-93146870 GGACTTGGATATATCTTTTTCGG + Intergenic
911010821 1:93279378-93279400 AGTCTGGGGTATGTCTTTATTGG - Intergenic
911248317 1:95545291-95545313 GTTCTTGGGGACATCTTTCCTGG + Intergenic
911943459 1:104075766-104075788 AGTGTTGGGTATTTCTTTATGGG - Intergenic
915984476 1:160450303-160450325 AGTCTAGTGTACATATTTATGGG + Intergenic
917762167 1:178173533-178173555 GTTCTTGGGTACATTTTTCTGGG + Intronic
918049034 1:180958555-180958577 AGTCTCAGGTATATCTTTATTGG - Intergenic
918574183 1:186036261-186036283 AGTCTTGGGTATGTCTTTATCGG - Intronic
919832253 1:201550091-201550113 GGTGTTGGGTGCATCCTTATGGG - Intergenic
922447535 1:225710121-225710143 GATGTTGGGGACATATTTATGGG + Intergenic
922530730 1:226342978-226343000 GGTCTTGGGTATGTCTTTATTGG + Intergenic
923459274 1:234194652-234194674 GGTCTTGGGGACATCTCTGTGGG - Intronic
1065562797 10:26980475-26980497 ATTCTTGGGCAAATCTTTATGGG + Intergenic
1068519585 10:58063734-58063756 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1070225868 10:74504922-74504944 AGTCTTGGGCAGTTCTTTATAGG + Intronic
1071246729 10:83773300-83773322 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1071931182 10:90472204-90472226 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1072448840 10:95522671-95522693 TGTATTGGGTACCTGTTTATAGG + Intronic
1073474239 10:103742520-103742542 GGACTTGGATATATCTTTTTGGG + Intronic
1073806914 10:107108252-107108274 AGTCTCAGGTACTTCTTTATAGG - Intronic
1074577629 10:114685340-114685362 GCTGCTGGTTACATCTTTATTGG - Intergenic
1078481841 11:11683482-11683504 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1079542789 11:21595246-21595268 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1079879030 11:25900368-25900390 AGACTTGGGTATATCTTTATTGG - Intergenic
1080134316 11:28836609-28836631 GGTCTTGTGTGCGTCATTATTGG - Intergenic
1080451010 11:32378951-32378973 AGTCTTAGATACTTCTTTATAGG + Intergenic
1081002702 11:37694772-37694794 AGTCTTGAGTATGTCTTTATCGG + Intergenic
1081316668 11:41638501-41638523 AGTCTTGGGTGTATCTTTATCGG - Intergenic
1082143187 11:48633460-48633482 AGTCTTGGGTATTTCCTTATAGG + Intergenic
1083374103 11:62205699-62205721 GGTCTTGGAGCCATCTTTGTTGG - Intergenic
1084568786 11:69946808-69946830 AGTCTTGGGTATGTCTTTATAGG + Intergenic
1084663950 11:70565933-70565955 AGTCTTAGGTATATCTTTATCGG - Intronic
1084676814 11:70640120-70640142 GGACCTGGGCACATCTTTCTGGG - Intronic
1085419654 11:76344805-76344827 GGTATTGCTTACATCTTTTTTGG - Intergenic
1086187644 11:84038706-84038728 AGTCTTGGGTATATCTTTATTGG - Intronic
1086721523 11:90127562-90127584 AGTCTTGGGTATGTCTTTATTGG - Intergenic
1086952612 11:92906353-92906375 GTGCTTGGGTTCATCTTTAGTGG - Intergenic
1086969659 11:93066716-93066738 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1086991884 11:93312937-93312959 AGTCTCGGGTATGTCTTTATTGG - Intergenic
1087086991 11:94229895-94229917 AGTCTTGGATATGTCTTTATTGG + Intergenic
1089085590 11:115814520-115814542 GGTCTTGGGGACCTGTTTATTGG + Intergenic
1089651290 11:119915153-119915175 GGTCTTGGGTATATCTTTATTGG - Intergenic
1089864969 11:121623868-121623890 AGGCTTGGGTATGTCTTTATTGG - Intronic
1092250743 12:6894638-6894660 AGTCTTGGGCAGTTCTTTATAGG + Intronic
1092326448 12:7535779-7535801 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1092971082 12:13695688-13695710 GTTCTTGGGTACTTATTTATAGG - Intronic
1093092443 12:14936863-14936885 AGTTTTGGGTATGTCTTTATTGG + Intronic
1093350861 12:18102190-18102212 AGTCTTAGGTAGTTCTTTATAGG - Intronic
1094801032 12:34036289-34036311 AGTCTCGGGTATGTCTTTATTGG - Intergenic
1097065835 12:56319852-56319874 GGTCTTGGTTACCTCATTAAGGG + Exonic
1097509453 12:60518995-60519017 AGTCATCTGTACATCTTTATGGG - Intergenic
1097733196 12:63151955-63151977 AGTCGTGGGGACATCTTTTTGGG + Intergenic
1099293930 12:80806178-80806200 GGTTTTGGGTACATTTTTATCGG + Intronic
1099626018 12:85075327-85075349 AGTCTTGGGTATTTCTTTATAGG - Intronic
1100021193 12:90071262-90071284 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1100054225 12:90489866-90489888 AGTCTTGGGTACATCTTTAAGGG + Intergenic
1101396526 12:104353681-104353703 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1101676687 12:106923646-106923668 AGTCTTGGGTATGTCATTATTGG - Intergenic
1102211890 12:111133321-111133343 AGTTTTGGGTACATCTTTATCGG - Intronic
1102665177 12:114565694-114565716 GGTCTCTGGTATGTCTTTATTGG + Intergenic
1103895712 12:124271823-124271845 GGACTTGAGTATATCTTTAGGGG + Intronic
1104438813 12:128778487-128778509 AGTCTCGGGTATGTCTTTATTGG - Intergenic
1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG + Intronic
1106536246 13:30646221-30646243 GGTTTAGTGTACATCTTTAAAGG + Intronic
1106595033 13:31128424-31128446 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1107060226 13:36152303-36152325 AGTCTTGGATATGTCTTTATCGG + Intergenic
1107188532 13:37550929-37550951 AGTCTTGGGTATTTCTTCATAGG + Intergenic
1107438756 13:40404918-40404940 GGTCTTTGCTACATTTTTAAAGG - Intergenic
1108971172 13:56379571-56379593 GGTCTCGGGTATGTCTTTATTGG - Intergenic
1110001718 13:70211177-70211199 TGTATTGGGTGCATCTGTATTGG - Intergenic
1110383210 13:74877997-74878019 AGTCTTGGGTATGCCTTTATCGG + Intergenic
1110623552 13:77626040-77626062 AGTCTTGGATATGTCTTTATTGG - Intronic
1110865521 13:80390655-80390677 GGTCATGTGTATATCTTTGTGGG + Intergenic
1111239830 13:85458762-85458784 AGTCTTGGGCAGTTCTTTATAGG + Intergenic
1111685974 13:91501070-91501092 AGTCTTGGGTATGTCTTTATTGG + Intronic
1112007383 13:95266063-95266085 GGACTTGGGCATATCTTTTTGGG - Intronic
1113238836 13:108313967-108313989 AGTCTCGGGTGCGTCTTTATTGG + Intergenic
1113247641 13:108416321-108416343 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1115051967 14:29073547-29073569 AGTCTTGGGCAGTTCTTTATAGG - Intergenic
1115682005 14:35751075-35751097 GGTATTAGGAACATCTTTCTGGG + Intronic
1115859847 14:37672019-37672041 AGTCTTGGGCAGTTCTTTATAGG + Intronic
1116417933 14:44700663-44700685 TGTCTTGGCTACATTTTTCTTGG - Intergenic
1116887519 14:50235607-50235629 AGTATTGGGTATGTCTTTATTGG - Intergenic
1117624044 14:57617525-57617547 GGTATTGAGTAAATGTTTATTGG - Intronic
1117748756 14:58898690-58898712 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1117749385 14:58904154-58904176 AGTCTCAGGTATATCTTTATAGG + Intergenic
1118130201 14:62954697-62954719 AGTCTTGGGTATGTCTTTATCGG - Intronic
1119040282 14:71268539-71268561 AGTCTTGGGCACTTCTTTATAGG + Intergenic
1119141455 14:72271173-72271195 AGTCTTGGGTATGTCTTTATTGG - Intronic
1120366909 14:83582691-83582713 AGTCTTGGGTATGCCTTTATTGG + Intergenic
1120549909 14:85857941-85857963 AGTCTTGAGTATGTCTTTATCGG + Intergenic
1120688117 14:87562726-87562748 GGTCTTGGGTATGTCTTTATTGG + Intergenic
1121186203 14:91972385-91972407 GGAATTGGTTACATCTTTCTTGG - Intronic
1122440495 14:101728372-101728394 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1125074060 15:35592060-35592082 AGTCTTGGGTATGTCTTTATTGG - Intergenic
1127214591 15:56810960-56810982 AGTCTTGGGTATGTCTTTATCGG + Intronic
1133955940 16:10443960-10443982 GCTCTTGGGAACGTGTTTATTGG - Intronic
1134391517 16:13824290-13824312 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1135482795 16:22836287-22836309 AGTCTCAGGTACTTCTTTATCGG - Intronic
1138269763 16:55686866-55686888 GGTCTTCAGTAAATATTTATTGG + Intronic
1139172875 16:64651699-64651721 AGTCTTGAGTATGTCTTTATTGG - Intergenic
1141415275 16:83866685-83866707 GTTCTTGGATACATATTTTTTGG + Intergenic
1141466463 16:84208978-84209000 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1143274508 17:5700090-5700112 GGTCCTGGGTGCATCTTCTTTGG + Intergenic
1145017255 17:19407559-19407581 GGTCCTGGGTCCATGTCTATGGG - Intergenic
1151504599 17:74518927-74518949 AGTCTTGGGTATGTGTTTATCGG + Intergenic
1152292520 17:79448294-79448316 GGACTTGGACACATCTTTTTGGG - Intronic
1152848875 17:82619617-82619639 GGTCTTGGGCACCTCTTTCTTGG - Intronic
1153421005 18:4905196-4905218 GGTCTCAGGTATTTCTTTATAGG - Intergenic
1153810906 18:8750676-8750698 GGTCTTGAGAACATTTTTCTAGG + Intronic
1154396831 18:13998453-13998475 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1155364242 18:25034372-25034394 TACCTTGGGTACATCTTTAAGGG - Intergenic
1158337644 18:56431222-56431244 GCTCTTGAGTATATCTTTTTTGG - Intergenic
1158559108 18:58498881-58498903 AGTCTTGGGTATGTCTTTATCGG + Intronic
1159537807 18:69737172-69737194 AGTCTTGGGTATTTCTTTGTAGG - Intronic
1159982059 18:74794293-74794315 TGTCTTGAGTACATCCTTACTGG - Intronic
1160449164 18:78950374-78950396 GGACTTGAGCACATCTTTCTTGG - Intergenic
1163713428 19:18860470-18860492 GGTCTTGGGGACAGCTTGAGAGG + Intronic
1164651095 19:29891549-29891571 TGTCTTTGGTAAATGTTTATGGG - Intergenic
1164857766 19:31538361-31538383 AGCCTCGGGTACGTCTTTATTGG + Intergenic
925438198 2:3859830-3859852 AGTCTCGGGTATGTCTTTATTGG - Intergenic
925547936 2:5038644-5038666 AGTCTCGGGTATTTCTTTATAGG - Intergenic
925629349 2:5873489-5873511 AGTCTTGGGTATGTCTTTATTGG - Intergenic
925834636 2:7932133-7932155 AGACTTGGGTACGTCTTTATTGG + Intergenic
928268818 2:29835916-29835938 AGTCTTGGGTATGTCTTTATCGG + Intronic
929058522 2:37900206-37900228 AGTCTTGGGTATGTCTTTACTGG + Intergenic
929096297 2:38266412-38266434 AGTCTTGGGTATGTCTTTATTGG - Intergenic
930364019 2:50416562-50416584 AGTCTTGGGCATTTCTTTATAGG - Intronic
930497887 2:52172381-52172403 AGTCTCGGGTAAGTCTTTATTGG - Intergenic
932290556 2:70574165-70574187 GGTTTTGTGAACATCTTTATTGG - Intergenic
933098305 2:78216557-78216579 GATGTTGGGCACCTCTTTATAGG - Intergenic
934711129 2:96514895-96514917 AGTCTCGGGTATGTCTTTATCGG - Intergenic
934969656 2:98752780-98752802 AGTCTTGGGTATGTCTTTATTGG - Intergenic
935322033 2:101898450-101898472 AGTGTTGGGTATGTCTTTATCGG - Intergenic
935336136 2:102018692-102018714 GATCTTGGGAACATCCTTATGGG - Intronic
935419539 2:102853285-102853307 AGTCTCGGGTATGTCTTTATTGG - Intergenic
935475310 2:103513966-103513988 AGTCTTGGGCATGTCTTTATCGG - Intergenic
936736070 2:115445220-115445242 AGTCTTGGGTATGTCTTTATAGG + Intronic
936969792 2:118165830-118165852 AATCTTGGGTATGTCTTTATCGG + Intergenic
937448456 2:121978679-121978701 GGTCTCAGGTATGTCTTTATAGG - Intergenic
939154982 2:138514183-138514205 CGCCTTGGGTACATGTTTTTAGG - Intronic
939155727 2:138523098-138523120 GGTCTCAGGTATGTCTTTATAGG - Intronic
939860967 2:147420038-147420060 AGTTTTGGGTATGTCTTTATTGG - Intergenic
941075709 2:161004188-161004210 GGTCGTGGGGCCATCTTGATGGG - Intergenic
943565501 2:189510921-189510943 AGTCTCAGGTATATCTTTATCGG + Intergenic
944455004 2:199884133-199884155 AGTCTTGGGTATGTCTTTATTGG + Intergenic
944701086 2:202246683-202246705 AGTCTCGGGTATGTCTTTATCGG + Intergenic
946542636 2:220701950-220701972 GCTCTTGGGTAGAACATTATTGG + Intergenic
946920134 2:224571652-224571674 GTTCTTGTGTACATTTTTTTTGG - Intronic
947099621 2:226605865-226605887 GGTCTTGGGTATGTATTTAGTGG - Intergenic
948077391 2:235175589-235175611 GGTCTTGGGTAGAGAGTTATGGG - Intergenic
948749197 2:240120480-240120502 GGTCATCGGTACATCTTCTTTGG + Intergenic
1169561707 20:6808517-6808539 TGTCTTGGGTACATACTTAGGGG - Intergenic
1170444551 20:16412451-16412473 AGTCTTGGGTATATCTTTATTGG - Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175103918 20:56600497-56600519 GGACTTGCGAACATCTTTAGAGG - Intergenic
1175220355 20:57413003-57413025 GGTCTTGGGGACATCTCTGGGGG + Intergenic
1175249948 20:57603237-57603259 CGTCTTGGGTATATCTTTATCGG + Intergenic
1176585454 21:8580287-8580309 AGTCTTGGGCATATCTTTACCGG - Intergenic
1177041223 21:16114068-16114090 AGTCTTGGATATGTCTTTATCGG - Intergenic
1177055668 21:16298089-16298111 ATTCTTGGGTATATCTTTATTGG + Intergenic
1177266898 21:18797615-18797637 AGTCTTGAGTATGTCTTTATTGG + Intergenic
1177768247 21:25483852-25483874 GGTCTTGGATATTTCTTTACTGG - Intergenic
1177769807 21:25501949-25501971 AGTCTTGGGTATGTCTTTATTGG - Intergenic
1178188345 21:30250957-30250979 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1179128843 21:38616272-38616294 AGTCTTGGGTATTTCTTTATAGG + Intronic
1179130574 21:38632744-38632766 AGTCTTGAGTATGTCTTTATTGG + Intronic
1179282132 21:39942803-39942825 GGGCTTGGGTACATCGTTTAGGG + Intergenic
1180268262 22:10557186-10557208 AGTCTTGGGCATATCTTTACCGG - Intergenic
1180319292 22:11305984-11306006 AGTCTGGGGTATGTCTTTATTGG - Intergenic
1180701343 22:17783014-17783036 GCTCTTGGGATCATCTTTAGAGG + Intergenic
1182957847 22:34443738-34443760 GGTCTTGGACATATCTTTATGGG + Intergenic
1184054785 22:42038583-42038605 GGTCTTGGGCATTTCTTTGTTGG + Intronic
949270635 3:2212343-2212365 AGTCTTGCGTATGTCTTTATTGG - Intronic
949354686 3:3166429-3166451 AGTCTTGGTTATGTCTTTATCGG + Intronic
949623729 3:5845384-5845406 AGTCTTGGGTATGTCTTTATTGG - Intergenic
949818553 3:8089591-8089613 AGTCTCGGGTATGTCTTTATCGG + Intergenic
950152014 3:10695093-10695115 AGTCTTGGGTATATGTTTATCGG - Intronic
950724981 3:14911391-14911413 GGCCTAGGGTATATCTTTATCGG + Intronic
950832101 3:15885198-15885220 AGCCTTGGGTATGTCTTTATTGG - Intergenic
951622977 3:24626256-24626278 AGTCTTGGGTATGTTTTTATTGG + Intergenic
952928161 3:38336992-38337014 GGACTTGAGCACATCTTTTTGGG + Intergenic
953461604 3:43085636-43085658 AGTCTTGGGTATGTCTTTATCGG + Intronic
956359138 3:68428014-68428036 AGTCTTGGGTATTTCTTTATAGG + Intronic
958538422 3:95434402-95434424 TGTCTTGAGTACATCTATACAGG - Intergenic
958786073 3:98597486-98597508 GGTATTGGGTACATGTTTAATGG + Intergenic
958823594 3:99003643-99003665 AGTCTCGGGTATGTCTTTATTGG - Intergenic
958995315 3:100897697-100897719 GGTATTGGATACATGGTTATAGG + Intronic
959124192 3:102270594-102270616 GGTCTCGAGTATGTCTTTATAGG - Intronic
959439965 3:106362408-106362430 AGTCTTGGGTATGTCTTTATTGG + Intergenic
959896660 3:111614303-111614325 TGGCTTGGGTCCCTCTTTATGGG + Intronic
960842821 3:121977784-121977806 AGTCTTGGGTATGTATTTATCGG + Intergenic
963217202 3:142761697-142761719 GGTCTTGGGCACTTCTTTGATGG + Intronic
964732963 3:159886792-159886814 AGTCTTGGATATGTCTTTATCGG - Intronic
966863872 3:184245583-184245605 GGTTTCGTGTACATCTTTATGGG - Exonic
969596945 4:8154797-8154819 AGTCCTGGGTATGTCTTTATTGG - Intronic
970707844 4:18826505-18826527 AGTCTGGGGTATGTCTTTATTGG - Intergenic
970977541 4:22058284-22058306 GGTCTTGGGTATGTCTTTATCGG + Intergenic
971232671 4:24812648-24812670 AGTCTTGGGTATGTCTTTATTGG - Intronic
971734371 4:30427354-30427376 AGTCTTGTGTATGTCTTTATTGG - Intergenic
973698515 4:53514343-53514365 AGTCTTGGGTATGTCTTTATTGG - Intronic
973855570 4:55007219-55007241 AGTCTTGGGCAGTTCTTTATAGG + Intergenic
973860775 4:55062580-55062602 AGTCTTGGATATGTCTTTATTGG + Intergenic
974396109 4:61337201-61337223 GGTCAGGGGTACATCTTCCTTGG - Intronic
974857962 4:67483186-67483208 AGTCTTGGGCAGTTCTTTATAGG + Intronic
974900276 4:67988150-67988172 AGTCTGGGGTATGTCTTTATTGG + Intergenic
975257270 4:72252849-72252871 AGTCTTGGGCAGTTCTTTATGGG + Intergenic
978098818 4:104812063-104812085 AGTCTTGTGTATGTCTTTATTGG - Intergenic
978691658 4:111519989-111520011 GGGCTTGCGTAAATCTTTAATGG - Intergenic
979787617 4:124735624-124735646 AGTCTTAGGTAGTTCTTTATGGG + Intergenic
980614169 4:135196114-135196136 GGACTTGGATATATCTTTTTTGG + Intergenic
981354307 4:143769535-143769557 GATGTTGGGTACATCTTTTTTGG + Intergenic
981799189 4:148636422-148636444 AGTCTTGGGTATGTCTTTATCGG - Intergenic
982214743 4:153071334-153071356 AGTCTCGGGTATGTCTTTATTGG - Intergenic
982797340 4:159661926-159661948 AGTCTTGGGTATGTCTTTATTGG + Intergenic
983489344 4:168369422-168369444 AGTCTTGGGTATGTCTTTATCGG + Intronic
985729272 5:1538194-1538216 GGACTTGGACACATCTTTGTGGG + Intergenic
985852784 5:2400943-2400965 AGTCTTGGGTATGTCTTTACTGG + Intergenic
986179097 5:5376693-5376715 GGTTTTGTGTCCATCTTTATGGG - Intergenic
986676836 5:10193252-10193274 GGTCATGGGGATATCTTTTTGGG - Intergenic
986863262 5:11952738-11952760 AGTCTTGGGTATGTCTTTATCGG + Intergenic
987037633 5:14034399-14034421 AGTCTCGGGTATGTCTTTATCGG - Intergenic
987053402 5:14167265-14167287 GTTCTTGGGTATATTTTTACAGG + Intronic
987446025 5:18020900-18020922 AGTCTTGGGTATGTCGTTATTGG + Intergenic
988177713 5:27748614-27748636 AGTCTTGGGTATGTCTTTATTGG - Intergenic
988362746 5:30256446-30256468 AGTCTTGGATATGTCTTTATTGG - Intergenic
989479657 5:41915500-41915522 AGTCTTGGGTATGTCTTTATTGG - Intronic
990400924 5:55436538-55436560 AGCCTTGGGTATGTCTTTATCGG + Intronic
991202551 5:64010876-64010898 AGTCTCGAGTATATCTTTATTGG + Intergenic
992885508 5:81155631-81155653 GGTCTGGGGTAGCTCCTTATGGG - Intronic
992922074 5:81536060-81536082 GGTCTTTGGTCCATTTTTATTGG - Intronic
993798068 5:92295174-92295196 GGTTCTGGGGACATCTTTGTGGG + Intergenic
994041726 5:95266392-95266414 GGTTTTGTGTACATTTCTATGGG + Intronic
994799094 5:104347963-104347985 AGTCTTGGGTATGTCTTTATAGG - Intergenic
995244334 5:109919505-109919527 AGTCTTGGGCAATTCTTTATGGG + Intergenic
995601660 5:113804267-113804289 AGTCTTGGGTATGTCTTTATCGG + Intergenic
996522452 5:124442192-124442214 AATCTTGGGTATGTCTTTATCGG - Intergenic
997403851 5:133627210-133627232 AGTCTTGGGAATGTCTTTATTGG - Intergenic
998591048 5:143478655-143478677 AGTCTTGGGTATGTCTTTATTGG + Intergenic
998757778 5:145399692-145399714 AGTCTTGGGTATGTCTTTCTCGG - Intergenic
998963854 5:147516485-147516507 GGACTTCTGTACATCATTATTGG - Intergenic
1000088524 5:157910024-157910046 AGTCTTGGGTATGTCGTTATAGG + Intergenic
1000226703 5:159267911-159267933 AGTCTTGGGTATGTCTTTATTGG + Intronic
1000466107 5:161579314-161579336 AGTCTTGGGTATGTCTTTATTGG - Intronic
1000703401 5:164481048-164481070 AGTCTTAGGTATGTCTTTATTGG - Intergenic
1001515515 5:172352847-172352869 AGTCTGGGGTATATCTTTATCGG + Intronic
1001746609 5:174097248-174097270 AATCTTGGGTGCATCTTCATGGG + Intronic
1002878412 6:1231421-1231443 GGGCTTGGGTACAACGTTATTGG - Intergenic
1007318934 6:41012337-41012359 AGTCTTGGGTATGCCTTTATTGG - Intergenic
1009204971 6:60789985-60790007 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1010077218 6:71813420-71813442 GGTCCTGGGTTTTTCTTTATTGG - Intergenic
1010531110 6:76967849-76967871 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1010981962 6:82378632-82378654 GGTCTTGGTTTAATCTATATTGG + Intergenic
1011014460 6:82739711-82739733 GTTTTTGGGTCCATATTTATAGG - Intergenic
1011874708 6:91943549-91943571 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1012756790 6:103241394-103241416 GGTCTTGGGTATGTCTTTCTTGG + Intergenic
1013125009 6:107174502-107174524 GGGCTTGGGTAGACCTTTAGAGG - Intronic
1013951032 6:115781989-115782011 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1014239944 6:119005961-119005983 GGACTTCGGTATATCTTTTTGGG - Intronic
1015022964 6:128498922-128498944 AGTCTTGGATATATTTTTATTGG + Intronic
1015053949 6:128876322-128876344 AGTCCTGGGTATGTCTTTATTGG + Intergenic
1016537780 6:145127405-145127427 AGTCTCGGGTATATCTTTATCGG + Intergenic
1016595094 6:145789930-145789952 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1016639855 6:146336093-146336115 AGTCTTGGGTATGTCTCTATAGG + Intronic
1016749430 6:147616647-147616669 AGTCTCGGGTATTTCTTTATTGG - Intronic
1019896768 7:3989131-3989153 AGTCTTGGGTGTGTCTTTATTGG - Intronic
1020527510 7:9281364-9281386 AGTCTTGAGTATGTCTTTATCGG + Intergenic
1021048262 7:15950157-15950179 GGTCTCAGGTATGTCTTTATTGG + Intergenic
1021230004 7:18074725-18074747 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1021608949 7:22437889-22437911 GGTCAAGTGTACATCTTTTTGGG + Intronic
1021739889 7:23676335-23676357 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1021967955 7:25940579-25940601 GGACCTGGGTTCATCTTCATTGG - Intergenic
1023301250 7:38774344-38774366 AGTCTTGGGTATTTCTTCATAGG - Intronic
1023547088 7:41329660-41329682 GGACTTGAGTAAATCTTTATAGG - Intergenic
1024729167 7:52235558-52235580 AGTCTTGGGCAGTTCTTTATAGG + Intergenic
1024805682 7:53136343-53136365 AGTCTTGGGCATGTCTTTATCGG + Intergenic
1025474063 7:60897602-60897624 TGTCTTGGGGAGATTTTTATCGG - Intergenic
1025557485 7:62327319-62327341 TGTCTTGGGGAGATTTTTATCGG + Intergenic
1028110108 7:86930020-86930042 GGTCTCAGGTACTTCTTTATAGG + Intronic
1029600418 7:101559986-101560008 AGTCTCGGGTATATCTTTATTGG - Intergenic
1030369066 7:108676451-108676473 GGTCTTGGGTGTATCTGTGTGGG + Intergenic
1030461453 7:109841007-109841029 GTTCTAGGTTACATTTTTATAGG + Intergenic
1031290682 7:119929552-119929574 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1031650048 7:124277145-124277167 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1032053044 7:128661583-128661605 AGTCTCGGGTATGTCTTTATCGG + Intergenic
1032598730 7:133270263-133270285 AGTCTTGGGTATGTTTTTATCGG + Intronic
1034122328 7:148639120-148639142 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1034718208 7:153263378-153263400 AGTCTCGGGTACATCTTTATTGG - Intergenic
1036024088 8:4883448-4883470 GGTCATGGGTATTTCTTTTTGGG - Intronic
1036576903 8:10036101-10036123 AGTCTTGGGTATGTCTTTATCGG + Intergenic
1037075875 8:14717559-14717581 CGTCTTGGGGACAGCTTCATGGG + Intronic
1037161047 8:15772532-15772554 GGTCTTGGGTTTTCCTTTATTGG - Intergenic
1037474157 8:19239830-19239852 GGACTTGAATACATCTTTTTGGG + Intergenic
1038171606 8:25139723-25139745 AGTCTTGGGTATTTCTTCATAGG - Intergenic
1039118648 8:34121222-34121244 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1039175912 8:34805527-34805549 AGTTTTGGGTATATCTTTATTGG + Intergenic
1039192468 8:34992536-34992558 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1039511220 8:38093536-38093558 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1039763614 8:40604847-40604869 GGTCTTGGACATATCTTTGTTGG + Intronic
1040634221 8:49253684-49253706 GGCCTTCGGTACATCAATATAGG - Intergenic
1040816721 8:51515468-51515490 GCGCTTGGGTACATGTTTAGTGG - Intronic
1041844817 8:62316204-62316226 AGTCTCGGGTATGTCTTTATTGG + Intronic
1042521504 8:69716605-69716627 GGACATTGGTACATCTTTTTTGG + Intronic
1042825562 8:72975864-72975886 GAACTTGGGTGCATCTTGATGGG - Intergenic
1043714788 8:83467886-83467908 TCTCTTGGGTATATCTTTATAGG + Intergenic
1045018283 8:98018541-98018563 AGTCTCGGGTATGTCTTTATCGG - Intronic
1045237624 8:100368345-100368367 GGTCATGGGAACAGCTTTTTGGG + Intronic
1045581627 8:103487455-103487477 GGTCTTGGGCACATTTTGAGTGG - Intergenic
1045597039 8:103669031-103669053 AGTCTTGGGTATATCTTCATCGG - Intronic
1047153876 8:122295441-122295463 AGTCTTTGGTATGTCTTTATTGG - Intergenic
1047941278 8:129829794-129829816 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1048502089 8:134987579-134987601 AGTCTTGAGTAGATCTTTATAGG + Intergenic
1049751667 8:144287378-144287400 GGTCTGGTGTACATCTTTCTGGG - Intronic
1050444655 9:5706573-5706595 TGTTTTGGGTTCTTCTTTATTGG + Intronic
1050861573 9:10439501-10439523 GGTCTTGGACACATATTTAAGGG + Intronic
1050879407 9:10680356-10680378 AGTCTCGGGTATGTCTTTATCGG - Intergenic
1051688784 9:19686782-19686804 AGCCTTGGGTATGTCTTTATTGG + Intronic
1051891138 9:21944292-21944314 GGTCTTGGAAATATCTTTGTGGG - Intronic
1052179479 9:25506514-25506536 AGTCTTGGGTAGTTCTTTATGGG - Intergenic
1052267520 9:26591388-26591410 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1053470186 9:38340668-38340690 AGTCTTGGGTATATCCTTATTGG + Intergenic
1054829430 9:69607147-69607169 AGTCTTGGGTATGTCTTTATTGG - Intronic
1054873451 9:70070707-70070729 TATTTTGGGTCCATCTTTATAGG + Intronic
1055401540 9:75929672-75929694 AGTCTTGGGTATGTCTTTATCGG - Intronic
1055413038 9:76052308-76052330 AGTCTTGGGTGTGTCTTTATTGG - Intronic
1055808639 9:80125343-80125365 AATCTTGGGTATGTCTTTATCGG + Intergenic
1056038994 9:82640976-82640998 GGTCCTGGGCATTTCTTTATTGG - Intergenic
1059081251 9:111252755-111252777 AGTCTTGGGCATGTCTTTATCGG + Intergenic
1059868602 9:118545661-118545683 AGTCTTGGGTATGTCTTTATTGG - Intergenic
1203615355 Un_KI270749v1:57810-57832 AGTCTTGGGCATATCTTTACCGG - Intergenic
1185523503 X:759541-759563 AGTCTTGGATATGTCTTTATTGG + Intergenic
1185947610 X:4395373-4395395 ATTCTTGGGTATGTCTTTATTGG - Intergenic
1186092293 X:6062880-6062902 AGTCTTGAGCATATCTTTATTGG + Intronic
1186834849 X:13427610-13427632 GATGTTGGGTACAGCTTCATAGG - Intergenic
1188083937 X:25880402-25880424 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1188457028 X:30378958-30378980 AGTCTTGGGTATGTCTTTATTGG + Intergenic
1189798924 X:44674198-44674220 AGTCTCGGGTATGTCTTTATTGG - Intergenic
1190112394 X:47601402-47601424 GGTCCTGGGTATGTCTTTGTAGG - Intronic
1191226443 X:58049345-58049367 GGTCTCAGGCATATCTTTATTGG - Intergenic
1191688353 X:63915149-63915171 AGTCTCAGGTATATCTTTATTGG + Intergenic
1192501459 X:71656353-71656375 AGTCTTGGGTATGTCTTTATCGG - Intergenic
1192914656 X:75639116-75639138 AGTCTTAGGTATTTCTTTATAGG - Intergenic
1193414648 X:81207166-81207188 GGTCTTGGGGAAATATGTATAGG - Intronic
1193497334 X:82231098-82231120 AGTCTTGGGTATGTCTTTATAGG + Intergenic
1195545398 X:106107228-106107250 AGTCTCGGGTATGTCTTTATTGG + Intergenic
1195864333 X:109413118-109413140 GATCTTTGATAGATCTTTATAGG + Intronic
1196915891 X:120534408-120534430 GGTCTGGGGGACATATTTATAGG - Intronic
1197072416 X:122314769-122314791 AGTCTTGGGTATGTCTTTATCGG + Intergenic
1197594566 X:128450443-128450465 AGTCTTGGATATGTCTTTATTGG - Intergenic
1198417503 X:136435405-136435427 TGTTTTGTGTACATCTTCATTGG + Intergenic
1198511559 X:137356898-137356920 GGTCATGTGTACATCTTCTTTGG - Intergenic
1199158073 X:144573069-144573091 AGTCTCAGGTACGTCTTTATCGG + Intergenic
1199491203 X:148402747-148402769 AGTCTTGGGTATGTTTTTATTGG - Intergenic
1200039837 X:153356774-153356796 GGTCTCGGGAATGTCTTTATTGG + Intronic
1201504894 Y:14687386-14687408 AGTCTTGGGTATACCTTTACTGG - Intronic
1201735037 Y:17250625-17250647 AGTCTTGGGTATGTCTTTATTGG - Intergenic
1202085636 Y:21133687-21133709 AGTCTCGGGTATCTCTTTATTGG + Intergenic