ID: 1106157214

View in Genome Browser
Species Human (GRCh38)
Location 13:27170937-27170959
Sequence GAAAGGGGCGTGTGTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106157214_1106157229 2 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157229 13:27170962-27170984 CCAGCGCGGGGTCGGGGACTCGG 0: 1
1: 0
2: 2
3: 18
4: 209
1106157214_1106157230 14 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157230 13:27170974-27170996 CGGGGACTCGGCCCAGCCAGCGG 0: 1
1: 0
2: 0
3: 18
4: 158
1106157214_1106157223 -5 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 120
1106157214_1106157222 -6 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157222 13:27170954-27170976 CCTTTCCCCCAGCGCGGGGTCGG 0: 1
1: 0
2: 1
3: 10
4: 123
1106157214_1106157224 -4 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157224 13:27170956-27170978 TTTCCCCCAGCGCGGGGTCGGGG 0: 1
1: 0
2: 2
3: 3
4: 89
1106157214_1106157231 21 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157231 13:27170981-27171003 TCGGCCCAGCCAGCGGCGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 96
1106157214_1106157218 -10 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157218 13:27170950-27170972 CGCCCCTTTCCCCCAGCGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106157214 Original CRISPR GAAAGGGGCGTGTGTGAAGG TGG (reversed) Intronic
900481095 1:2899706-2899728 GGAGGGGGTGTATGTGAAGGGGG + Intergenic
900481110 1:2899769-2899791 GGAGGAGGTGTGTGTGAAGGGGG + Intergenic
902509380 1:16957851-16957873 GGAAGGGGCCTGGGTGAAGGGGG - Intronic
905034273 1:34907065-34907087 GAAAGGTGGGTGTGGGGAGGTGG - Intronic
905263371 1:36734506-36734528 GAAAGGCCCGTGAGAGAAGGTGG - Intergenic
905388808 1:37623162-37623184 GAAAGGGGTGTTTATCAAGGGGG + Intronic
905694458 1:39964740-39964762 GAATGAGGTGTGTGTGAATGGGG + Intronic
906145784 1:43559269-43559291 GAAGGGGCAGTGTGTGCAGGAGG + Intronic
906181548 1:43824381-43824403 GAAAGGGGTGTGTGTGTGGTGGG + Intronic
906253724 1:44331484-44331506 AAAAGGGGTGTGGGTGAAAGTGG - Intronic
906567836 1:46813351-46813373 GGACTGGGAGTGTGTGAAGGGGG + Intronic
906653703 1:47533125-47533147 GAAGGGGGTGTGAGGGAAGGAGG - Intergenic
907385515 1:54122907-54122929 GGCAGGGGAGTGTGTGCAGGGGG + Intergenic
907802865 1:57789175-57789197 GGCAGGGGCGGGGGTGAAGGGGG - Intronic
910716527 1:90236861-90236883 GAAAAAGGCATGTATGAAGGCGG - Intergenic
910978966 1:92939572-92939594 GAAGGGGGCATATGGGAAGGTGG - Intronic
911071879 1:93838287-93838309 GAAGTGGACATGTGTGAAGGGGG + Intronic
911191060 1:94948897-94948919 GAAAGGGAGGTGTGTGGAGTAGG + Intergenic
911995309 1:104758264-104758286 GAGGGGGGTGTGTGTGCAGGGGG + Intergenic
912218933 1:107649977-107649999 GACAGGGGTGTGTGTGGAGTGGG + Intronic
912739599 1:112181869-112181891 TAAAGGGGTGTGTGAGAAAGTGG - Intergenic
912852770 1:113141226-113141248 GAATGGGGTGTGTGAGGAGGTGG - Intergenic
913963681 1:143357567-143357589 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
914058040 1:144183156-144183178 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
914121105 1:144783209-144783231 GGAAGGGGAGGGTGGGAAGGGGG + Intergenic
914398273 1:147291357-147291379 GAAAGGGCTGTGTAGGAAGGTGG + Intronic
914667655 1:149844435-149844457 AAAAGGGGGGTGTGGGGAGGGGG - Intronic
916711726 1:167416648-167416670 GGAAGGGGCGTGTGTGGAATGGG - Exonic
916723160 1:167500588-167500610 TAAATGGGTGTGTGTGTAGGGGG - Intronic
918744804 1:188185556-188185578 GAAAGGGGAGTGTTTGAATAGGG + Intergenic
918980195 1:191547636-191547658 GAGAGGGGAGTATGTGAATGAGG - Intergenic
919372159 1:196741381-196741403 GAGAGAGGAGTGAGTGAAGGAGG + Intronic
920193914 1:204213615-204213637 GAAAGGGGTCAGTGTGAATGGGG + Intronic
922486387 1:225976329-225976351 GAAATGGGTGTCTTTGAAGGTGG - Intergenic
922977689 1:229798937-229798959 GAAAGGGGAGAGTGGGAGGGAGG + Intergenic
1062844091 10:690890-690912 GAAAGGGGAGTGAGTGCAGCTGG - Intergenic
1063540321 10:6927150-6927172 CAAAGGGGAGTGTGAGAAGATGG - Intergenic
1064131348 10:12712825-12712847 TACAGGGGTGTGTGTGTAGGCGG - Intronic
1065437734 10:25719300-25719322 GCAAGGGGAGGATGTGAAGGAGG - Intergenic
1065808850 10:29422100-29422122 GAAATGGCCCTGTGTGAATGTGG + Intergenic
1065818293 10:29501468-29501490 GAAGGGAGCGAGAGTGAAGGAGG + Intronic
1065954618 10:30683033-30683055 GAAGGGAGCGAGAGTGAAGGAGG - Intergenic
1066106590 10:32162338-32162360 GAAAGGGGTCTGTGTGTCGGTGG - Intergenic
1066641337 10:37557261-37557283 GAAAGGGTCATGTGTGAACAGGG + Intergenic
1066649429 10:37640497-37640519 GCCAGGGGCCTGTGTGAGGGAGG + Intergenic
1066994794 10:42553594-42553616 GAAGGGGGCTGGTGGGAAGGAGG + Intergenic
1067163367 10:43845469-43845491 GCAAGGGGTGTGTCTGAAGTGGG + Intergenic
1067306059 10:45065110-45065132 GGAAGGGGTGTTTGTGGAGGAGG + Intergenic
1068816426 10:61320124-61320146 GAAATGAGGGTGTGTGAAAGAGG + Intergenic
1069993729 10:72329990-72330012 GGAACTGGCGTTTGTGAAGGAGG - Intergenic
1070435294 10:76385444-76385466 GAGAGGGGCCTTAGTGAAGGAGG + Intronic
1073371369 10:102992609-102992631 GAATGGAGTGTGTGTAAAGGGGG + Intronic
1073683625 10:105730227-105730249 ACAAGGGGAGTTTGTGAAGGAGG - Intergenic
1074476782 10:113781323-113781345 GAAAGAGGTGTTTGGGAAGGAGG - Intronic
1074476801 10:113781396-113781418 GAAAGAGGGGTTTGGGAAGGAGG - Intronic
1074476872 10:113781621-113781643 GAAAGAGGTGTTTGGGAAGGAGG - Intronic
1074476891 10:113781694-113781716 GAAAGAGGGGTTTGGGAAGGAGG - Intronic
1074497930 10:113996256-113996278 GAAAGGGGAGAGGGTGAAGAAGG - Intergenic
1075277818 10:121110907-121110929 GAAAGGGGTGTGGGTGAAGCTGG + Intergenic
1076281401 10:129249638-129249660 CATAGGGGCGTGTGTGCATGGGG + Intergenic
1076548782 10:131264103-131264125 GAAAGGGGTGTGGGGGGAGGGGG - Intronic
1077016584 11:401246-401268 GAGCGGGGCGGGTGTGAACGGGG - Intronic
1077016685 11:401507-401529 GAGCGGGGCGGGTGTGAACGGGG - Intronic
1077318443 11:1929436-1929458 GAAAGGGGCTTGGGAGAAAGGGG - Intronic
1077349951 11:2088421-2088443 GAAGGAGGCGTGTGGGAGGGGGG - Intergenic
1077418377 11:2436519-2436541 GAAAGGGCTATGTGTGTAGGTGG + Intergenic
1077446208 11:2592152-2592174 TGAAGGGGCTTGTGTGCAGGTGG - Intronic
1078101084 11:8330715-8330737 GAGAGGGGCGGGTGGGGAGGAGG - Intergenic
1079248908 11:18773106-18773128 AAAAGGGGAGTGTGGAAAGGGGG + Intronic
1080466706 11:32504128-32504150 GAAAGGGGCATGGGGGAGGGAGG + Intergenic
1081762685 11:45587547-45587569 GAAAGGGGGCTGAGTGAAGAAGG + Intergenic
1082774931 11:57237483-57237505 GATAGGGGCTGGGGTGAAGGTGG - Intergenic
1083857753 11:65401434-65401456 GAAAGGGCCCTGTGGGAGGGAGG - Intronic
1084317075 11:68351752-68351774 GAAAGGGACGTGTGCGTAGGGGG + Intronic
1084327009 11:68406330-68406352 GAAAGGTGCGTGTGTGTTTGAGG + Intronic
1085400488 11:76232899-76232921 GAAAGGGGTGTGTGTGTTGGGGG - Intergenic
1085988119 11:81809062-81809084 CAAAGGGGAGGATGTGAAGGAGG - Intergenic
1086551894 11:88062296-88062318 GAGAGGAGTGTATGTGAAGGAGG - Intergenic
1086649743 11:89273371-89273393 GATGGGGGCGTGAGGGAAGGAGG + Intronic
1087934632 11:104018142-104018164 AAATGGGGTGTGTGTGGAGGGGG - Intronic
1088819601 11:113446160-113446182 GAAAGGGGCGAGTGGGAAGGGGG - Intronic
1089733723 11:120535353-120535375 GGAAGAGGGGAGTGTGAAGGGGG + Intronic
1089830359 11:121321926-121321948 AAAAGGGGATTGGGTGAAGGTGG + Intergenic
1090393834 11:126406393-126406415 GAAGGGGGCAGGTGGGAAGGTGG + Intronic
1091053768 11:132399683-132399705 AAAAGGGGGATGTGTGATGGGGG - Intergenic
1091446352 12:546098-546120 GAAAGTGGGGAGTGAGAAGGAGG + Intronic
1092529820 12:9335072-9335094 GAAAGGTGGATGTGGGAAGGAGG - Intergenic
1097542089 12:60954846-60954868 CAAAGGGGAGGATGTGAAGGAGG + Intergenic
1100280064 12:93110082-93110104 GAAGGGGGTGTGTGTGGGGGTGG - Intergenic
1104463693 12:128973885-128973907 GTAGGGGGTGTGTGTGTAGGGGG + Intronic
1105246798 13:18660053-18660075 GAAAGGGGCATCTGTATAGGAGG - Intergenic
1105634241 13:22201958-22201980 GAAAGGGAGGTCTGTGAGGGTGG + Intergenic
1105699697 13:22926730-22926752 CAAAGGTGCGGGTGTGCAGGGGG + Intergenic
1106157214 13:27170937-27170959 GAAAGGGGCGTGTGTGAAGGTGG - Intronic
1106176628 13:27337518-27337540 GAAAGGGGCTTGTGGAATGGTGG - Intergenic
1106246237 13:27953237-27953259 GAAAGGGGCTTGAGTGGAGTGGG + Intergenic
1106465434 13:30009883-30009905 CAAAGGGCTGTGTGTCAAGGAGG - Intergenic
1107641522 13:42448211-42448233 GAGAGAGGGGTGAGTGAAGGGGG - Intergenic
1110265184 13:73529481-73529503 GGAAAGAGAGTGTGTGAAGGAGG - Intergenic
1113417840 13:110144184-110144206 AAAAGAGGTGTGTGTGTAGGAGG + Intergenic
1113640721 13:111955027-111955049 GAACGATGCGGGTGTGAAGGTGG + Intergenic
1113728869 13:112625442-112625464 GACAAGGGCCTGTGTGAAGGTGG - Intergenic
1115177362 14:30578845-30578867 GAAAGAAGCGTGTGTGTAGAAGG - Intronic
1115962146 14:38847167-38847189 GAAGGTGGCTTGTGTGCAGGAGG + Intergenic
1119217794 14:72882521-72882543 GGAAGGGGAGTGTGTGCATGGGG + Intronic
1119595432 14:75928643-75928665 GAAAGTGGCATGTGTGTTGGGGG + Intronic
1120843595 14:89107646-89107668 GCAGGGGGGGTGTGTGCAGGGGG - Intergenic
1121458475 14:94054798-94054820 AAAAGGGGAGTGACTGAAGGTGG - Intronic
1122836798 14:104434520-104434542 GAAAGGGGCGGGTGGGAGGTTGG + Intergenic
1127289006 15:57553969-57553991 GGAAGGGTTGTGTGTGCAGGTGG + Intergenic
1128029455 15:64466909-64466931 GAAAGGGGTGAGAGAGAAGGAGG - Intronic
1128304452 15:66588847-66588869 GAAATGGGTGTGTGTGCTGGGGG - Intronic
1128724987 15:69981909-69981931 CAAAGGGGCCTGTGGGCAGGTGG - Intergenic
1129044894 15:72725805-72725827 GAAAGGGGGATGGGGGAAGGGGG - Intronic
1129330038 15:74822445-74822467 GAGAGGGGCGTGAGTGGAGGGGG + Intronic
1131092244 15:89631771-89631793 GAAAGGGCCGGATGTTAAGGAGG + Intronic
1131806321 15:96126372-96126394 GAGAGGGGCATTTGTTAAGGGGG - Intergenic
1131857424 15:96612568-96612590 GAAAGGAGTGAGTGTCAAGGAGG - Intergenic
1132156157 15:99496425-99496447 GAGAGGGGCATGTGGGGAGGGGG + Intergenic
1132846040 16:2001352-2001374 GAAAGGGGCCTGTGTCAATTGGG - Intronic
1132956848 16:2598828-2598850 AAAAGGGGCGTGTGTGACGGTGG - Exonic
1133452251 16:5913376-5913398 GAAAGGGGTTTGGGTGATGGGGG + Intergenic
1135204105 16:20467893-20467915 GAAAGGGCAGTTTGTGAAGGAGG - Intronic
1135480705 16:22818624-22818646 GAAAGGGGAGAGAGGGAAGGAGG - Intronic
1135562178 16:23485228-23485250 GAAAGGGGAGTTTGGGAAAGGGG + Intronic
1135868480 16:26127005-26127027 GCAATGGGAGTGTGTGATGGTGG + Intronic
1138028696 16:53542114-53542136 GGAGGCGGTGTGTGTGAAGGTGG - Intergenic
1138363212 16:56450927-56450949 GAAAGGGGCCTGAGAGAGGGAGG + Intronic
1138458656 16:57135215-57135237 CAAGGGGGCGGGTGGGAAGGAGG - Intronic
1140608556 16:76570541-76570563 GAAAGGTGTGTGTGTGGAGGGGG - Intronic
1140858858 16:79001738-79001760 GAAGGGGGCGTTTGTGCAGTGGG + Intronic
1141266869 16:82505727-82505749 GGAAGGGTCGGGGGTGAAGGAGG + Intergenic
1141876460 16:86828341-86828363 GAAAGGGGCATGTGAAGAGGAGG - Intergenic
1142560905 17:808248-808270 GAACAGGGCGTGTGTGAAGGGGG - Intronic
1142854584 17:2722742-2722764 GAAAGGGGTGTCTGTGAGGGAGG + Intergenic
1143019470 17:3909417-3909439 GAAAGAGGAATTTGTGAAGGAGG - Intronic
1143487656 17:7263324-7263346 GAAACGGGCGAGTGTGGGGGAGG - Intronic
1143500675 17:7336834-7336856 GAAAGGTGTGTGTGTGCTGGGGG - Intronic
1144633704 17:16889648-16889670 GAGAAGGGCCTGAGTGAAGGTGG + Intergenic
1145354219 17:22123726-22123748 TAAAGGGGCGTGGGGGAAAGGGG + Intergenic
1146645667 17:34575855-34575877 GGGAGGGCAGTGTGTGAAGGAGG - Exonic
1147168476 17:38605350-38605372 TAAAGGGGCTTGTGTGGAAGGGG - Intronic
1147457761 17:40549012-40549034 GAAATCGGGGTGTGTGGAGGAGG + Intergenic
1148095059 17:45046794-45046816 GAGATGGGTGAGTGTGAAGGAGG - Intronic
1149262019 17:54890626-54890648 GAAAGGGGAGAGGTTGAAGGTGG - Intergenic
1149993085 17:61393564-61393586 GGGATGGGTGTGTGTGAAGGGGG - Intergenic
1150932434 17:69599656-69599678 GAGAGGAGTGTGTGTGAAGAAGG - Intergenic
1152454066 17:80402751-80402773 CCAAGGGGAGGGTGTGAAGGCGG - Intergenic
1154395539 18:13984555-13984577 GAAAGGGAAGTATATGAAGGGGG - Intergenic
1154442057 18:14399067-14399089 GAAAGGGGCATCTGTATAGGAGG + Intergenic
1154954974 18:21244188-21244210 GAAACTGGTGTGTGTGCAGGAGG - Intronic
1156218357 18:35026130-35026152 GGAAGGAGCGTGTCTGAAGCAGG + Intronic
1156380857 18:36559821-36559843 GGAAGGGGCCTGTTTGAATGAGG + Intronic
1157715686 18:49885434-49885456 GAAAGGTGCCTGTCTGATGGGGG - Intronic
1158109926 18:53929572-53929594 GAATGTGGAGTGTGTGCAGGTGG - Intergenic
1159940086 18:74400270-74400292 GAGGGGGCCGTGGGTGAAGGAGG + Intergenic
1160009779 18:75097855-75097877 GAAGGGGGCGGTTGTGAATGAGG + Intergenic
1162175331 19:8826012-8826034 GAAGGGAGCGTGTGTGTAGCAGG + Intronic
1162603106 19:11684989-11685011 GAAAGCAGTGTGTGTGAAGAAGG + Intergenic
1163842293 19:19618788-19618810 TGAAGGGGCGTGTCTGTAGGCGG - Exonic
1165831627 19:38733492-38733514 GCAAGGGGCGTGTGTGGGGTGGG - Intronic
1166194329 19:41196182-41196204 GAAAGGGGTGAGAGTGATGGAGG + Intronic
1166392020 19:42413694-42413716 GAAAGGGGCCTGTGTGACTGAGG + Intronic
1166739101 19:45103468-45103490 GGGAGGGGTGGGTGTGAAGGTGG - Intronic
1168152531 19:54456569-54456591 CAAAGGGGCGAGGCTGAAGGGGG + Intronic
1168452514 19:56477377-56477399 GCGTGGTGCGTGTGTGAAGGGGG - Intronic
1202697524 1_KI270712v1_random:135824-135846 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
925413730 2:3655311-3655333 GAATGGGGCGTGGATGCAGGTGG + Intergenic
925595483 2:5551867-5551889 GAAAGTGGAGAGGGTGAAGGTGG + Intergenic
925905558 2:8537835-8537857 GAAAGGGGAGAAAGTGAAGGGGG + Intergenic
927207036 2:20617297-20617319 AGGAGGGGCGGGTGTGAAGGGGG + Intronic
927915998 2:26936458-26936480 GATAGGGGCGTGGGCGAAGGTGG + Intronic
928626188 2:33142340-33142362 GAAAGGGCCGTGCGGCAAGGTGG - Intronic
929581512 2:43084358-43084380 GAAAGGGGAGTGTGAGATGCAGG + Intergenic
929615662 2:43305481-43305503 CCAAGGGGTGTGTGTGATGGGGG - Intronic
931200239 2:60090681-60090703 GAAATGGGTGTGTGTCAATGGGG - Intergenic
933897558 2:86825248-86825270 AAAAGGGGCAGGTGTGCAGGTGG + Intronic
934097522 2:88620278-88620300 GAAAGGGGGGAGTGTGGAGCTGG - Intronic
934855326 2:97725697-97725719 GTAAGCGCCGTGTGTGCAGGTGG + Intronic
935260319 2:101350109-101350131 GAGAGGGGAGTGGGTGAAGCTGG - Exonic
937307629 2:120881848-120881870 GAGAGGGGCATGTGGGAAGGAGG + Intronic
938199867 2:129363728-129363750 GAGAGGGGTGTGTGTGAGAGAGG - Intergenic
938396210 2:130950310-130950332 GAGAGGGGCGGGTGTGGTGGGGG - Intronic
938438489 2:131302831-131302853 CAAAAGGGTGTGTGTGGAGGTGG - Intronic
938581710 2:132652338-132652360 GAAAGGGGGTTATTTGAAGGGGG + Intronic
938869043 2:135454582-135454604 GAAAGGGGAGGATGGGAAGGGGG - Intronic
940620578 2:156107988-156108010 GAAATGGGGATGGGTGAAGGAGG + Intergenic
941314300 2:163973290-163973312 GGAAGGGGCCTGTGTGAATGTGG + Intergenic
942895543 2:181048850-181048872 TAAATGGGCATGTGTGAAGTAGG - Intronic
942959657 2:181814831-181814853 GCAAGGGGCCAGTGGGAAGGGGG - Intergenic
944324618 2:198389398-198389420 GAAAGATGCGTGGGTGAATGGGG - Intronic
946172554 2:217904154-217904176 GGAAGGGGTGTGGCTGAAGGGGG - Intronic
946467598 2:219925836-219925858 GAAAGGGAAGAGTGAGAAGGTGG + Intergenic
947981324 2:234412427-234412449 GAATGGGCCGTGTCTGTAGGAGG + Intergenic
948596307 2:239081835-239081857 GACAGAGGTGTTTGTGAAGGAGG - Intronic
949050816 2:241896485-241896507 GAAGGGGGTGTGGGTGAAGGGGG + Intronic
1169330133 20:4709829-4709851 GCATGGGGAGTGTGTGAATGTGG - Intergenic
1171025607 20:21627784-21627806 GAAAGTGGCGTGTGTGCAGAGGG + Intergenic
1171245033 20:23603990-23604012 GAAATGGGGGTGGGTGGAGGTGG - Intronic
1171294244 20:24003767-24003789 GAAAGGGGCCTGTCTTTAGGTGG - Intergenic
1173354625 20:42275575-42275597 GGAAGGGGTGTGTGTGGCGGGGG + Intronic
1175034928 20:55991337-55991359 GATTGTGGTGTGTGTGAAGGTGG - Intergenic
1175418347 20:58816202-58816224 GAAAAGGCCTTGTGTGAATGGGG - Intergenic
1175752421 20:61508588-61508610 GACAGGGGCATGTGTTCAGGAGG + Intronic
1175825858 20:61936336-61936358 GGAAGGGGTGTGGGGGAAGGTGG - Intronic
1175825940 20:61936547-61936569 GAAAAGGGCATTTGTGAAGATGG - Intronic
1176454014 21:6892104-6892126 GAAAGGGGCATCTGTATAGGAGG - Intergenic
1176832189 21:13757152-13757174 GAAAGGGGCATCTGTATAGGAGG - Intergenic
1179128819 21:38616128-38616150 GAGAGGAGAGTGTGTGAAGGAGG - Intronic
1179422255 21:41245919-41245941 GAAAGGTGCGTGAGTGACAGTGG - Intronic
1180843524 22:18970099-18970121 GCAAGGGGCTTCTGTGCAGGGGG + Intergenic
1181052309 22:20243673-20243695 GAAAGGAGGATGTGTGGAGGAGG - Intronic
1181057949 22:20268626-20268648 GCAAGGGGCTTCTGTGCAGGGGG - Intronic
1181328645 22:22071531-22071553 GAAAGGGGTGAGTAGGAAGGCGG + Intergenic
1182663548 22:31942099-31942121 GATAGGGCAGTGTGTGAAGAGGG + Intronic
1182747640 22:32617764-32617786 GGAAGGGGTGTGTGTGAGGGAGG + Intronic
1184099933 22:42336659-42336681 GATAGGTGTGTGTGTGGAGGGGG - Intronic
1184569193 22:45311097-45311119 GGAAGGGGTGGGTGTTAAGGAGG + Intronic
1185052188 22:48559707-48559729 GGAAGGGGCGTGTGGGATGAGGG + Intronic
1185170995 22:49294538-49294560 GAAAGTGGCCTCTGTGAACGAGG + Intergenic
1185313542 22:50169630-50169652 GGATGGGGCGTGGGGGAAGGAGG + Intergenic
950885749 3:16361455-16361477 CCAAGGGGAGAGTGTGAAGGTGG + Intronic
951757633 3:26109001-26109023 GAAAGGTGTCTGTGTTAAGGGGG - Intergenic
951955731 3:28251234-28251256 GAAGCGGGCATGTGTGAAGAGGG + Intronic
952882031 3:37991303-37991325 GAAGAGGGGGTGTGTGAAGCGGG + Intronic
954920962 3:54190462-54190484 GAAAGTGGTGTGTGTGCTGGTGG - Intronic
955066876 3:55541091-55541113 GAATGGGGCTTTTGTTAAGGAGG - Intronic
956354775 3:68378829-68378851 GAGAGAGGAGTGTGTGAAAGAGG - Intronic
956408091 3:68949652-68949674 AAAGGGAGAGTGTGTGAAGGGGG + Intergenic
957024518 3:75166221-75166243 GAAAGGGGCAGGTTTGGAGGTGG + Intergenic
957127521 3:76180901-76180923 GATAGGGGAGAGTGGGAAGGTGG - Intronic
958765446 3:98361574-98361596 GAGAGGAGTGTGTGTGGAGGAGG + Intergenic
958837192 3:99159160-99159182 GAAAGGGGGATATGTGAAGTTGG - Intergenic
959405165 3:105952749-105952771 GGAAAGAGGGTGTGTGAAGGAGG + Intergenic
959935459 3:112023840-112023862 GGAAAGGGCGAGTGTGAAGGAGG - Intergenic
960963584 3:123089558-123089580 GGAGAGGGCGTGTGTGAAGTAGG + Intronic
960969691 3:123130637-123130659 GAGAGGGGAGGGTGTGGAGGGGG - Intronic
961145570 3:124590252-124590274 GAAATGGGGGTGTATGAAGGTGG + Intronic
961360073 3:126361394-126361416 GATAAGGACGAGTGTGAAGGGGG + Intergenic
961858090 3:129893155-129893177 GGGAGGGGCGTGTGAGAAGTCGG - Intronic
962403860 3:135083596-135083618 GTAAGGGGAGTGTATGGAGGGGG + Intronic
962736394 3:138329431-138329453 GAGGGGGGCTTGTCTGAAGGAGG - Intronic
965105133 3:164344989-164345011 AAAAGGGGAGGCTGTGAAGGAGG + Intergenic
965965606 3:174485437-174485459 GAGAGGGGGGTGGGTGGAGGAGG - Intronic
966971561 3:185049781-185049803 GAAAGGGGAGTGCGTGAAGGGGG - Intronic
968477215 4:817710-817732 CAAGGGGGCGTGAGGGAAGGGGG - Intronic
968897824 4:3415002-3415024 GTGAGGGGCGTGTGTGAGAGGGG + Intronic
969087715 4:4668983-4669005 AAAAGGGCCGCGTGTGAACGTGG - Intergenic
969422759 4:7107016-7107038 GATGGGGGAGTGTGTGAAGGGGG - Intergenic
969636527 4:8372609-8372631 GAGAGGGGCGTGTCTGATTGTGG - Intronic
969661885 4:8535066-8535088 GAGAGAAGGGTGTGTGAAGGAGG + Intergenic
969909549 4:10430858-10430880 GAAGGGTGTGTGTGTGAAGCAGG - Intergenic
970171431 4:13295001-13295023 GAAAGGGGAGGGTGAGAGGGAGG - Intergenic
972839103 4:42910102-42910124 GAGAGGGAAGAGTGTGAAGGAGG + Intronic
974612099 4:64230284-64230306 GAATGGGGCAAGTTTGAAGGGGG + Intergenic
976838255 4:89400959-89400981 GAGAGTGGCCTGTGTGATGGGGG + Intergenic
977225240 4:94386328-94386350 AAAAGGGGAGGATGTGAAGGAGG + Intergenic
979701426 4:123672099-123672121 GGCAGGGGCGTGTGTGATGGCGG + Intergenic
980878357 4:138684967-138684989 GAAAGGTGAGGGTGTGAGGGGGG + Intergenic
980971219 4:139568871-139568893 GAAATTGGAGTGTGTGATGGGGG + Intronic
981965663 4:150599256-150599278 GAAAGGGGAGTGTGAGATGGAGG - Intronic
982374788 4:154677817-154677839 GAAGGGGGCCTCTGAGAAGGTGG + Intronic
983193387 4:164778767-164778789 GACAGGGGTGAGTGTGAAGATGG + Intergenic
984674480 4:182531156-182531178 GAAAGGAAAGTGTGTCAAGGAGG + Intronic
985359624 4:189158923-189158945 GAAGTGGGCATGGGTGAAGGGGG + Intergenic
985372518 4:189301447-189301469 GAGAGAGGCCTGTGTGGAGGTGG + Intergenic
987566400 5:19593637-19593659 GGAGGGGGAGTGGGTGAAGGAGG - Intronic
988547603 5:32173552-32173574 GAAAGGAGCGACTGTGAAAGGGG + Intronic
989994881 5:50817846-50817868 GAAAGGGGTGTGTGTGGGGAGGG + Intronic
990727781 5:58775506-58775528 GTAATGGGCGTGAGTGAAGGTGG + Intronic
991352787 5:65736098-65736120 GAAAGGGACATGGTTGAAGGGGG - Intronic
992381342 5:76240719-76240741 GACAGGGACTTGTGTGCAGGTGG - Intronic
992769596 5:80035189-80035211 GAAAGGCGCGGGTGTGAGGATGG - Intronic
993355728 5:86904941-86904963 GAAAATGTCTTGTGTGAAGGAGG - Intergenic
995768586 5:115645568-115645590 CAAGAGGGCGTGTGTGTAGGAGG + Intergenic
996528151 5:124499901-124499923 AAAAGGGGAGGATGTGAAGGAGG - Intergenic
999990978 5:157049594-157049616 GAATGGGGCTGTTGTGAAGGGGG - Intronic
1000049293 5:157548138-157548160 GAAAAGGGGGAGTGTGATGGTGG - Intronic
1000055268 5:157600634-157600656 GAGAGGGCCATGTGTCAAGGAGG + Intergenic
1001073092 5:168603978-168604000 GAAAGTGGAGTGTGTGGAGGAGG + Intergenic
1001494065 5:172175539-172175561 GAAAAGGGCGGGTGTCAGGGCGG - Intronic
1001971233 5:175956560-175956582 GAAAGGGTCGTATGGGGAGGGGG - Intronic
1002246209 5:177887217-177887239 GAAAGGGTCGTATGGGGAGGGGG + Intergenic
1003129328 6:3381806-3381828 GAAAGGAGCGTGGCTGAGGGAGG - Intronic
1005154427 6:22787974-22787996 GAAAGGTGTGTGTGTGTGGGAGG - Intergenic
1007504655 6:42326249-42326271 GACAGGGGCCTGTATGAGGGTGG + Intronic
1007720027 6:43879328-43879350 GAAAGGGGCTTGTGACAAAGGGG + Intergenic
1007849254 6:44788335-44788357 GAATGGGGCTTGTGGAAAGGAGG - Intergenic
1010060121 6:71613268-71613290 GAAAGGGGCAGGGGTGAGGGAGG - Intergenic
1010916938 6:81631651-81631673 TACAGGGTCGTGTATGAAGGTGG - Intronic
1012466103 6:99517841-99517863 GAAATGGGAGTGTGGGAAGGAGG - Intronic
1013575771 6:111482793-111482815 GACAGGGGCCTGGGTGAGGGGGG + Exonic
1013880961 6:114900123-114900145 GAAAGAGGCGTGGATGAAAGTGG - Intergenic
1014165226 6:118216891-118216913 AAAAGGGGTGAGTATGAAGGTGG - Intronic
1016752566 6:147647413-147647435 GAAAGAGGGGGGTTTGAAGGGGG + Intronic
1018262655 6:161985836-161985858 GCAAGGGGCCAGAGTGAAGGGGG - Intronic
1018980757 6:168599907-168599929 GAGAGGGGAGTGTGTGAGTGTGG - Intronic
1019394479 7:809988-810010 GAGAGAGAAGTGTGTGAAGGAGG - Intergenic
1022464667 7:30645490-30645512 GAAAGGGATGTGTCTGAATGTGG - Intergenic
1023003743 7:35840189-35840211 GAAAGGGGGGAGGGGGAAGGGGG - Intronic
1026162445 7:67881463-67881485 GAAAGGTGTGTGTGTGTAGGGGG + Intergenic
1026342598 7:69447320-69447342 GCAAGGGGCCTGAATGAAGGAGG - Intergenic
1030048942 7:105521706-105521728 GAAAGGGAGGAGTGGGAAGGGGG + Intronic
1032095600 7:128937257-128937279 GAACAGGAGGTGTGTGAAGGTGG + Intergenic
1032586840 7:133154650-133154672 CAGAGGGCCCTGTGTGAAGGAGG + Intergenic
1033253023 7:139777358-139777380 GGAGGGGGCGTGTGCGAGGGTGG - Intronic
1033618838 7:143043591-143043613 GAAAGGACAGTGTGTGAAGTGGG + Intergenic
1033943282 7:146681605-146681627 GAAAGGGGAGAGTGGGAGGGTGG + Intronic
1034279676 7:149844334-149844356 GAAACGGGCGTGTGGGAGGCGGG + Intronic
1034697449 7:153066451-153066473 GCATGGAGTGTGTGTGAAGGTGG + Intergenic
1035053034 7:156015007-156015029 GAATGGGGCCTGGGTGGAGGAGG + Intergenic
1035957732 8:4100905-4100927 GAAAGTGGTGTATATGAAGGTGG + Intronic
1038136355 8:24790541-24790563 GGAGGGAGGGTGTGTGAAGGTGG - Intergenic
1041215496 8:55596209-55596231 GAAAGGGGCATGTTTAAAGTTGG + Intergenic
1042495367 8:69449808-69449830 GAAAGGGGCGTGGTTGAGTGAGG - Intergenic
1045464993 8:102461665-102461687 GAAAGAGGCGTGGGGGAAGAGGG - Intergenic
1046853010 8:118996988-118997010 GAAAGAGGCGTTTGTCATGGGGG - Intronic
1048111703 8:131474548-131474570 GAAAGAAGAGTGAGTGAAGGAGG - Intergenic
1049779502 8:144422378-144422400 GAAACGTGTGTGTGTCAAGGGGG - Intergenic
1051508110 9:17847317-17847339 GGGAGGGGGTTGTGTGAAGGGGG - Intergenic
1052696149 9:31881599-31881621 GGAAGCGGGGTGTGTGTAGGGGG + Intergenic
1056116992 9:83450271-83450293 GAAAGAGGCTTGTGTGCATGCGG - Intronic
1056625118 9:88246543-88246565 TAAATGGGACTGTGTGAAGGTGG - Intergenic
1058957217 9:109960255-109960277 GAAAGGTGGGTGGGTGCAGGGGG - Intronic
1060721450 9:125982247-125982269 GAAGAGAGTGTGTGTGAAGGAGG - Intergenic
1061248909 9:129415192-129415214 AAAAGGGGGGTGGGGGAAGGAGG - Intergenic
1061884609 9:133585289-133585311 GAAAGGTGGGTGTGGGGAGGGGG - Intronic
1062046132 9:134425428-134425450 GAAGGGGGCAGGTGGGAAGGAGG - Intronic
1062099280 9:134719792-134719814 AGAAGGGGCGTGTCTGAAGAAGG + Intronic
1062187781 9:135227853-135227875 GACAGGGGCGGGGCTGAAGGAGG - Intergenic
1062475990 9:136727817-136727839 GGAAGGGTCGTGGGTGAACGGGG + Intergenic
1062644657 9:137541349-137541371 GAAAGGGGCTTGGGGGAAGCTGG - Intronic
1186440228 X:9579756-9579778 GAAAAGGTAGTGTGTCAAGGGGG - Intronic
1187716158 X:22104446-22104468 GAAAGGGGGGTGGGGTAAGGAGG + Intronic
1188009905 X:25044365-25044387 GAAAGGTGCGGGTGTGCATGTGG + Intergenic
1188977238 X:36690488-36690510 GAGAGGAGAGTGTGTGAAGGAGG - Intergenic
1189213583 X:39304666-39304688 AAAAGGGCCGTGTGGAAAGGGGG + Intergenic
1190179241 X:48177533-48177555 GAGAGGGGAGGGGGTGAAGGGGG + Intergenic
1190298187 X:49040734-49040756 GAAAGGGGGATGGGGGAAGGAGG - Intronic
1190316684 X:49156297-49156319 GGAAGGAGGGTGTGTGACGGGGG - Intergenic
1193793843 X:85848817-85848839 GTAATGGGGGTGTGGGAAGGAGG + Intergenic
1196644198 X:118098934-118098956 GGAAGGGGGGTGGGGGAAGGGGG + Intronic
1196819006 X:119688170-119688192 GAAATGGGTAGGTGTGAAGGTGG - Intronic
1197339410 X:125247365-125247387 GAAAGGGGGGTGGGGGTAGGAGG + Intergenic
1198682993 X:139202762-139202784 GAAAGGAGTGGGAGTGAAGGGGG + Intronic
1198764389 X:140065683-140065705 GGAAGGGGGGTGTGGGAAGGAGG + Intergenic
1199079257 X:143558064-143558086 GAAATGTGTGTGTGTGAGGGGGG + Intergenic
1199470208 X:148186973-148186995 TAAAGGGACGTGGGTGATGGTGG + Intergenic
1199679772 X:150216470-150216492 GAATGGGGCCTGTATGAGGGAGG + Intergenic
1200169788 X:154064253-154064275 GAGAGGGGAGCGTGAGAAGGAGG - Intronic
1200834133 Y:7716557-7716579 CCAAGGGGAGAGTGTGAAGGTGG + Intergenic
1200841138 Y:7782922-7782944 GAGAGGAGAGTGTGTGGAGGAGG - Intergenic