ID: 1106157215

View in Genome Browser
Species Human (GRCh38)
Location 13:27170940-27170962
Sequence GGGGAAAGGGGCGTGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 410}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106157215_1106157222 -9 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157222 13:27170954-27170976 CCTTTCCCCCAGCGCGGGGTCGG 0: 1
1: 0
2: 1
3: 10
4: 123
1106157215_1106157229 -1 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157229 13:27170962-27170984 CCAGCGCGGGGTCGGGGACTCGG 0: 1
1: 0
2: 2
3: 18
4: 209
1106157215_1106157231 18 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157231 13:27170981-27171003 TCGGCCCAGCCAGCGGCGCGAGG 0: 1
1: 0
2: 1
3: 7
4: 96
1106157215_1106157230 11 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157230 13:27170974-27170996 CGGGGACTCGGCCCAGCCAGCGG 0: 1
1: 0
2: 0
3: 18
4: 158
1106157215_1106157224 -7 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157224 13:27170956-27170978 TTTCCCCCAGCGCGGGGTCGGGG 0: 1
1: 0
2: 2
3: 3
4: 89
1106157215_1106157223 -8 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106157215 Original CRISPR GGGGAAAGGGGCGTGTGTGA AGG (reversed) Intronic
901631548 1:10650658-10650680 GGGGAACGGGAGGCGTGTGATGG + Intronic
902862698 1:19257543-19257565 AGGGAAAGAGGCGGGTGAGAGGG + Intronic
902919176 1:19656395-19656417 GGGGATAGGGGGGTGGGTGGGGG + Intronic
903271573 1:22191821-22191843 GGGGAGAGGAGCGGGTGGGAGGG + Intergenic
903293984 1:22332176-22332198 GGGGAGAGAGGGGTGGGTGAGGG - Intergenic
903950263 1:26992609-26992631 GGGGGAAGGGGGGTGTGCGGGGG - Intergenic
904269994 1:29343727-29343749 GGGGACAGGGGTGTGTCTCAGGG - Intergenic
904455718 1:30646922-30646944 GGGGAAAGGGTGGGGAGTGAAGG + Intergenic
904988944 1:34576103-34576125 GGGGAATGGGGTGTGTGGGGTGG - Intergenic
905126517 1:35719242-35719264 GCGGAAAGGGGCGTGTGGGAGGG - Exonic
906145783 1:43559266-43559288 GGGGAAGGGGCAGTGTGTGCAGG + Intronic
906187379 1:43871866-43871888 GGAGAGGAGGGCGTGTGTGAGGG + Intronic
907051308 1:51331203-51331225 GGGGAAAGGGGCCAGAGTGTTGG - Intronic
907096305 1:51784372-51784394 GGGGGAAGGGGCATGTCTCAAGG - Intronic
907590354 1:55660969-55660991 GGGCAAAGGGCCGGGTGCGATGG - Intergenic
909705158 1:78572889-78572911 GGGAAAAGAGGCGTGTGTAAAGG - Intergenic
910088455 1:83432332-83432354 GAGGGAAGGGGAGTGTGGGAGGG + Intergenic
910395755 1:86792196-86792218 GGGGAAAAGTGAGTGTGGGAAGG + Intergenic
910798225 1:91119588-91119610 GGGGGTAGGGGTGTGTGTGGGGG - Intergenic
911613291 1:99980338-99980360 GGGGAAATGGGAGGGTGGGAAGG + Intronic
911995306 1:104758261-104758283 GGGGAGGGGGGTGTGTGTGCAGG + Intergenic
912745004 1:112238844-112238866 TGGGACAGAGGCGTGTGTCAAGG - Intergenic
913963684 1:143357570-143357592 GGGGGAAGGGGAGGGTGGGAAGG - Intergenic
914058043 1:144183159-144183181 GGGGGAAGGGGAGGGTGGGAAGG - Intergenic
914121102 1:144783206-144783228 GGGGGAAGGGGAGGGTGGGAAGG + Intergenic
914229752 1:145754956-145754978 GGGGAAATGGCCGGGTGTGGTGG + Intronic
914755331 1:150558931-150558953 GAGGAGAGCGGCCTGTGTGAGGG - Intronic
914920702 1:151845625-151845647 GGGGAAAGGGGAGGGAGGGAAGG - Intergenic
915161228 1:153922374-153922396 GGGAAACGGGGCGTGAGGGAGGG + Intronic
915276711 1:154793905-154793927 GGGGAAAGGATCCAGTGTGATGG - Intronic
915596324 1:156898353-156898375 CGGGAAAGGGGCAGGGGTGAGGG - Intronic
917027232 1:170657689-170657711 GGGGAAGTGGACATGTGTGAAGG - Intergenic
918040518 1:180911839-180911861 GGGGGAAGGGGCGTCTGGCAGGG - Intergenic
918215954 1:182391980-182392002 AGAGAAAGGGGCGTGGGGGAGGG + Exonic
920522562 1:206639164-206639186 GGGGAAAGGGCCGGGTGCGGTGG - Intronic
921185299 1:212665255-212665277 GGGGAAGGGGGCATGGGTGCTGG - Intergenic
921245629 1:213236183-213236205 GGGGACAGGGGTGTGGGTGGGGG - Intronic
922536410 1:226384262-226384284 GGGGAGAGGGGTATGTGAGAAGG + Intronic
922552559 1:226506876-226506898 GGGGAGAGGGGAGGGTGTGATGG - Intergenic
923452436 1:234131432-234131454 GGGGAAGGGGGGCTGGGTGAGGG - Intronic
924291603 1:242542430-242542452 GGGGAAAGGGTGGTGTATGTGGG - Intergenic
924854226 1:247859341-247859363 GGGGAAAGTGGCATGTGTTTTGG - Intronic
1064222183 10:13450838-13450860 GGGGAAATGGGCATTTGTGATGG + Intronic
1066065665 10:31759597-31759619 GGGGAAAGGGGTGTGCTTGGGGG + Intergenic
1066075559 10:31872292-31872314 GGGGAGAGGAGGGTGTTTGAGGG - Intronic
1066106591 10:32162341-32162363 TGGGAAAGGGGTCTGTGTGTCGG - Intergenic
1066649428 10:37640494-37640516 TGGGCCAGGGGCCTGTGTGAGGG + Intergenic
1067038440 10:42935497-42935519 GGGGAAAGGAGAGTGTAGGAGGG - Intergenic
1067531950 10:47080566-47080588 TGGGAAAGGGGTGTCTGGGAAGG + Intergenic
1069612727 10:69785987-69786009 GGGGAAAGGGGTGTGTGGGGAGG - Intergenic
1070121203 10:73579068-73579090 GGGGAAGGGGGTGGGGGTGAGGG - Intronic
1070312387 10:75283231-75283253 GATGAAAGGGGCAGGTGTGAGGG + Intergenic
1071026266 10:81117640-81117662 GGAGGAAGGGGAGGGTGTGATGG + Intergenic
1072572451 10:96670593-96670615 GGGGGAAGGGCTGTGTGAGAGGG + Intronic
1072710598 10:97713638-97713660 AGGGAAAGGGGCGGGTGGGAAGG + Intronic
1072739234 10:97899820-97899842 GGGGAAAGGAGGGTGTGCCAGGG - Intronic
1073007050 10:100332346-100332368 GGGGTGAGGGGTGTGTGAGAGGG + Intergenic
1073955034 10:108860668-108860690 GGGGAGGGGGGTGTGTGTCATGG - Intergenic
1074962948 10:118464274-118464296 GGGGTTAGGGGCATATGTGAGGG - Intergenic
1075897878 10:126013672-126013694 TGGGAAAGGGGCTTGTGTCTGGG + Exonic
1076037425 10:127211827-127211849 GGGGAAAGGCAGGTGTGTGCAGG - Intronic
1076751015 10:132543094-132543116 GGAGAAAGGGCTGGGTGTGAGGG - Intronic
1079578573 11:22033292-22033314 GGGGAAAGGGCAGGGTGTGGGGG + Intergenic
1080466705 11:32504125-32504147 GAGGAAAGGGGCATGGGGGAGGG + Intergenic
1081108732 11:39105298-39105320 GGGGAAAGGGGCATGGTTAATGG + Intergenic
1082795696 11:57376548-57376570 GGGGACAGGGGTGTGGGTGGTGG - Intergenic
1084190909 11:67498332-67498354 GGGGAAATGTGCGTGGGTGAGGG + Intronic
1084191218 11:67499835-67499857 GGGGACAGGGGGCTGTGTCATGG + Intronic
1085043929 11:73342806-73342828 GGGGGAAGGGGCGGGTGCGAGGG + Intronic
1085400491 11:76232902-76232924 AAGGAAAGGGGTGTGTGTGTTGG - Intergenic
1087934635 11:104018145-104018167 GGGAAATGGGGTGTGTGTGGAGG - Intronic
1087962961 11:104374700-104374722 CGGGAAAGGGGCCTCTGTAATGG + Intergenic
1088315204 11:108499379-108499401 GGGGAAAGGGATGTGTGGGGTGG - Intergenic
1088819604 11:113446163-113446185 CTGGAAAGGGGCGAGTGGGAAGG - Intronic
1089013264 11:115147395-115147417 GGGGAGAGTGGAGTGTGTGTGGG + Intergenic
1089013573 11:115148912-115148934 GGGGAGGGTGGAGTGTGTGAGGG + Intergenic
1089189001 11:116640890-116640912 GGGTACAGGGGAGGGTGTGAGGG - Intergenic
1089433058 11:118437883-118437905 GGGGAAGGGGGCCCCTGTGAGGG + Intronic
1089454729 11:118619311-118619333 GTGGGTAGGGGCTTGTGTGAGGG + Intronic
1089655439 11:119943771-119943793 GGAGAAAGTGGTGGGTGTGATGG + Intergenic
1090508192 11:127342198-127342220 GGGGAAAGGGGCATACATGATGG + Intergenic
1091124434 11:133082592-133082614 GGGGAAAGGGGGATGGGCGAGGG - Intronic
1091640038 12:2229585-2229607 GGGGAATGGGGTGTGAGTGGAGG + Intronic
1091754068 12:3040499-3040521 GGGGGAAGAGACGTGTGTGCAGG + Exonic
1096460556 12:51819546-51819568 GGGGGAGGGGGCAGGTGTGAGGG + Intergenic
1096746063 12:53727589-53727611 GGGGAAGAGGGCGTCCGTGACGG + Intronic
1097269191 12:57763989-57764011 GGGTCAAGGGGAGTGTTTGAAGG + Intronic
1097806631 12:63971742-63971764 GGGTATAGGGGTGTGTGTGTGGG + Intronic
1098450196 12:70610384-70610406 GAGGAAAGGGGCGGGGGTGGGGG - Intronic
1099430145 12:82573539-82573561 GGGGAGAAGGTCATGTGTGATGG - Intergenic
1100280065 12:93110085-93110107 GGGGAAGGGGGTGTGTGTGGGGG - Intergenic
1101862455 12:108494142-108494164 GGGGAGAGAGGTGTGTGAGATGG - Intergenic
1101886166 12:108664659-108664681 GGGGAAAGAGGCCTGGGTCAAGG - Intronic
1102749164 12:115277211-115277233 GGGGAAAGGGGAGGGGGGGAGGG + Intergenic
1103098538 12:118152169-118152191 GTGGAAGGGGGCGTGGCTGAGGG - Intronic
1103393677 12:120591833-120591855 GGGGATAGAGGTGTGGGTGAGGG + Intergenic
1103592586 12:122002856-122002878 GGGAAAAGGGGAATGGGTGAGGG - Intronic
1103740038 12:123084922-123084944 GGGGAGGGGGGTGTGTGGGATGG - Intronic
1106157215 13:27170940-27170962 GGGGAAAGGGGCGTGTGTGAAGG - Intronic
1107540388 13:41384045-41384067 GGGGAAAGGAGCTCGAGTGAGGG + Intergenic
1107766250 13:43738153-43738175 GGGTAAAAGGGCTTTTGTGAAGG - Intronic
1108153292 13:47558724-47558746 GGAGAAAAGGGTGTGTGTGATGG - Intergenic
1110285411 13:73744504-73744526 GGTGACTGGGGCCTGTGTGATGG + Intronic
1110608937 13:77467093-77467115 GAGGAAAGGCGAGTGTGAGAAGG + Intergenic
1113387124 13:109859095-109859117 GGGGAATGGGGAGTGTTTCACGG + Intergenic
1113584746 13:111457649-111457671 CGGGAAAGGGCGGTGAGTGAAGG - Intergenic
1113607573 13:111621432-111621454 GGGGTGTGGGGCGTGTGTGTGGG + Intronic
1113728870 13:112625445-112625467 GGAGACAAGGGCCTGTGTGAAGG - Intergenic
1114517476 14:23309084-23309106 AGAGAAAGGGTAGTGTGTGAGGG + Exonic
1118345856 14:64940302-64940324 AAGGAAAGGGGTGTGTGTGTAGG - Intronic
1118667854 14:68089665-68089687 GGGGAAAGGGGATGGTGGGAGGG - Intronic
1119424068 14:74524600-74524622 GGGGCGAGGGGCGGGTGTGGGGG - Intronic
1121464703 14:94107981-94108003 GGGGGAAGGGGGCTGGGTGAGGG - Intronic
1122050410 14:99055551-99055573 GCTGAAAGGGGCCAGTGTGATGG - Intergenic
1122792593 14:104190598-104190620 AGGGAAGGGGGCGTGCGGGAGGG + Intergenic
1122849413 14:104519359-104519381 GGGGAATGGGACGTGGGTGTGGG + Intronic
1123065322 14:105616202-105616224 GGGGACAGGAACGTGGGTGAAGG + Intergenic
1123867285 15:24533778-24533800 GGGGAAAGAAGCGTCTGTGGAGG + Intergenic
1123959116 15:25376028-25376050 GGGGAGGGGGGCTTGTCTGATGG + Intronic
1124474621 15:30022482-30022504 GGGGGAAGGGGCGGCTGTCAGGG - Intergenic
1124496876 15:30192425-30192447 GGGGAAGGGGAGGTGTGTGCGGG + Intergenic
1124614836 15:31234109-31234131 GGGGAAAGGAGGCTGGGTGAGGG + Intergenic
1124746700 15:32346222-32346244 GGGGAAGGGGAGGTGTGTGCGGG - Intergenic
1125481203 15:40082234-40082256 AGGAGAAGGGGTGTGTGTGAGGG - Intergenic
1126305077 15:47246564-47246586 GAGGAAAGGGCCATGTGTCAAGG - Intronic
1126419397 15:48455495-48455517 GGGGAAAAGTGCGGCTGTGAGGG + Intronic
1126653260 15:50948496-50948518 GGGGAAAGTGGAGGGTGTGTGGG + Intronic
1127226891 15:56940682-56940704 GGGGAAAGGGGAGAGGGAGAGGG - Intronic
1127694251 15:61428983-61429005 GGGGAAATCGGTGGGTGTGAGGG - Intergenic
1128355690 15:66925002-66925024 TGGAAAAGAGGCGTGTGGGAGGG + Intergenic
1128724988 15:69981912-69981934 GGGCAAAGGGGCCTGTGGGCAGG - Intergenic
1129044897 15:72725808-72725830 GGGGAAAGGGGGATGGGGGAAGG - Intronic
1129330035 15:74822442-74822464 GGGGAGAGGGGCGTGAGTGGAGG + Intronic
1131434812 15:92414227-92414249 AGGGCAAGGGGAGTGTGTGCAGG - Intronic
1131733290 15:95304736-95304758 AGGAAAGGGGGCGTGTGAGAGGG + Intergenic
1131806324 15:96126375-96126397 GGGGAGAGGGGCATTTGTTAAGG - Intergenic
1131827539 15:96332904-96332926 GGGGAAAGGGGTGAGGGGGAGGG - Intronic
1132895710 16:2228529-2228551 GGGGATGGGGGAGTGGGTGAGGG - Intronic
1132956849 16:2598831-2598853 CACAAAAGGGGCGTGTGTGACGG - Exonic
1135204106 16:20467896-20467918 GTGGAAAGGGCAGTTTGTGAAGG - Intronic
1135871429 16:26155014-26155036 GGGGAGAGGGTTGTGGGTGAGGG - Intergenic
1138616248 16:58169525-58169547 GGGGAGGGGGGTGTGTGTGTGGG + Intronic
1138641497 16:58391575-58391597 GGAGTAAAGGGTGTGTGTGAAGG - Intronic
1139326336 16:66155369-66155391 GGGTGAAAGGGCGTGTGTAAAGG - Intergenic
1140235027 16:73151341-73151363 GGGGAAAGGAAGGTGTGTGGGGG + Intergenic
1141010066 16:80388877-80388899 GGGAAGAGGGGTGTGTGGGAGGG - Intergenic
1141148902 16:81550941-81550963 CGGGACTGGGGTGTGTGTGACGG - Intronic
1142385305 16:89760226-89760248 GGAGAAACGGGGGTGAGTGAAGG + Intronic
1142547411 17:714578-714600 GGGGAAACGGGAGTGCGGGAGGG - Intronic
1142560908 17:808251-808273 GGGGAACAGGGCGTGTGTGAAGG - Intronic
1142794893 17:2300071-2300093 GGGAAAAGGGGAGGGGGTGAGGG - Exonic
1142854583 17:2722739-2722761 CAGGAAAGGGGTGTCTGTGAGGG + Intergenic
1143208834 17:5167890-5167912 GAGGAAAGGGGTGTGTGGGAAGG - Intronic
1143500678 17:7336837-7336859 GGGGAAAGGTGTGTGTGTGCTGG - Intronic
1143516099 17:7419965-7419987 GAGGAAGGGGGAGTGTGTGCTGG + Intergenic
1143750569 17:9023739-9023761 TGGGAAAGGGGGGTGGGTGCAGG - Intronic
1143896101 17:10137364-10137386 GGGGAGAGGGGTGAGGGTGAGGG - Intronic
1143920732 17:10329254-10329276 AGGGAGAGGGGAGTGTGGGAGGG - Intronic
1144022147 17:11246971-11246993 GGAGAAAGGGATGGGTGTGAAGG - Intronic
1144618158 17:16796001-16796023 GAGGAAAGGGGTGTGTGGGAAGG - Intronic
1144671646 17:17136188-17136210 GGAGAAAGTGGTGTCTGTGAAGG - Intronic
1144810723 17:17997199-17997221 CAGGAATGGGGCCTGTGTGAAGG - Intronic
1144894546 17:18519694-18519716 GAGGAAAGGGGTGTGTGGGAAGG + Intergenic
1145137680 17:20424550-20424572 GAGGAAAGGGGTGTGTGGGAAGG - Intergenic
1146005604 17:29158805-29158827 GGGTGAAGGGGAGTGTGTGGCGG - Intronic
1146182367 17:30706418-30706440 GGGGTGAGGGGCGAGGGTGAGGG + Intergenic
1146981346 17:37164689-37164711 GGTTAGAGGGGCATGTGTGAAGG - Intronic
1147483612 17:40790752-40790774 GGGAAAGGGAGAGTGTGTGAGGG - Intergenic
1147729093 17:42586180-42586202 GGGGACTGGGGTGGGTGTGAAGG + Intronic
1147976898 17:44253056-44253078 GGGGAAGGGGCCGGGGGTGAGGG + Intronic
1148557962 17:48589875-48589897 GGGGAAAAGGGTTTGTGTGGGGG - Intronic
1149117907 17:53120835-53120857 GGGGAAAGGAGCGTTTTTCATGG - Intergenic
1149141812 17:53440261-53440283 GGGGGGATGGGTGTGTGTGAGGG - Intergenic
1149458626 17:56809750-56809772 GTGTAGAGGGGTGTGTGTGAGGG - Intronic
1149866072 17:60151725-60151747 GGGGATAGCAGCTTGTGTGAGGG - Intronic
1149871456 17:60185671-60185693 GAGGAAAGGGGTGCGTGGGAAGG + Intronic
1150137262 17:62702920-62702942 AGGAACAGGGGCGGGTGTGAGGG - Intronic
1151484365 17:74389315-74389337 GGGGAGAGGGGCCTGGGTGAGGG + Intergenic
1151717968 17:75841008-75841030 GGAGAAAAGGGCGTGGTTGAGGG + Intronic
1152140560 17:78534118-78534140 GGGTAAAGGGGAGTGGTTGAGGG - Intronic
1152862247 17:82703208-82703230 GGGAAGAGGGGACTGTGTGAGGG - Intergenic
1153040700 18:811652-811674 GGGGAGAGGAGCGGGTGTGTGGG - Intronic
1154044584 18:10892669-10892691 GGGGAGAGGGGCGGGGGTGAGGG + Intronic
1154351785 18:13589634-13589656 GGGGAAAGGGCCATGCCTGAGGG - Intronic
1155243512 18:23885352-23885374 GGGGATAGAGGGGTGTGTGTGGG - Intronic
1155501028 18:26487059-26487081 GGGGTAAGGTGGGGGTGTGAAGG - Intronic
1156546098 18:37965190-37965212 GGGGAAAGGGGAGGGAGGGAGGG - Intergenic
1157281068 18:46346750-46346772 GGGGGAAGTGGGGTGTGTGGTGG - Intronic
1157622634 18:49025179-49025201 TGGGAGAAGGGGGTGTGTGAAGG + Intergenic
1157711307 18:49851672-49851694 GGGGAAAGGGGTCTGTGTAGAGG - Intronic
1158835989 18:61332894-61332916 GGGGAAGATGGCATGTGTGAGGG - Intergenic
1158959562 18:62578168-62578190 TGGGGAAGGGGTGGGTGTGAAGG + Exonic
1159940085 18:74400267-74400289 GGGGAGGGGGCCGTGGGTGAAGG + Intergenic
1160750794 19:733473-733495 AGGGAGAGGGGCCTGTGTGCAGG + Intronic
1160828100 19:1090004-1090026 GGGGGCAGGGGTGTGTGTGGGGG + Intronic
1160841221 19:1147778-1147800 GGGTCAAGGGGCCTGTGTGTGGG - Intronic
1161683308 19:5691291-5691313 GGGGAAAGGGGCGGCCGTCAGGG - Intronic
1162018314 19:7857309-7857331 GGGGAGAAGGGTGTGTGTGGAGG + Intronic
1162562726 19:11426828-11426850 GGGCAGAGGGTCGTGTGGGAGGG - Intronic
1162767817 19:12930576-12930598 GGTGAATGGGGAGTGAGTGATGG - Intronic
1162976459 19:14209384-14209406 GGGGCGAGGGGCGGGGGTGAGGG - Intergenic
1163123906 19:15233705-15233727 TGGGACAGGGCCGGGTGTGATGG + Intergenic
1163214003 19:15862880-15862902 GGGGAAAGGGAGGTGGGGGAAGG - Intergenic
1163795794 19:19337419-19337441 GCTGAAAGGGGCTTGTGTGCAGG - Intronic
1163904855 19:20143482-20143504 TGGGAAAAGGGCGTCTGTCATGG + Intergenic
1164558274 19:29269913-29269935 GGGGAAGGGGGGGCGGGTGAGGG - Intergenic
1165141862 19:33704466-33704488 GGGGAAAGGGGATGGGGTGAGGG + Intronic
1165165941 19:33856389-33856411 GAGGAAAGGGTAGTGGGTGAGGG + Intergenic
1165318066 19:35068729-35068751 GAGGAGAAGGGCGGGTGTGAGGG + Intergenic
1165610421 19:37146730-37146752 GGGGAAAGGGGCAGGAGTGGGGG - Intronic
1165816193 19:38643848-38643870 GGGGTGAGGGGAGTGTGTGGGGG - Intergenic
1166785570 19:45364796-45364818 GGGCAGAGGGGCGAGTGTGAGGG - Intronic
1166792607 19:45406763-45406785 GGAGAAAGGGGCGTCCGAGAGGG + Intronic
1166811633 19:45517897-45517919 GGGGAAAGGGGGGTGAGGGGCGG - Intronic
1166942683 19:46376243-46376265 GAGTAAAGGGGGGTGGGTGAAGG + Intronic
1166965244 19:46525973-46525995 GGGTAAAGGGGGGCGGGTGAAGG - Intronic
1167149211 19:47699237-47699259 GGGGGAAGGGGCGCGAGCGACGG - Intronic
1167207993 19:48115512-48115534 GGGGAGGGGTGTGTGTGTGAGGG - Exonic
1167575072 19:50314112-50314134 GGGGGAAGGGGCGGATGAGAGGG + Intronic
1168407479 19:56118444-56118466 GCGGAAGGGGGCGGTTGTGATGG + Intronic
1202697527 1_KI270712v1_random:135827-135849 GGGGGAAGGGGAGGGTGGGAAGG - Intergenic
925160222 2:1678222-1678244 GGGAATCGGGGAGTGTGTGAGGG - Intronic
925215170 2:2088167-2088189 AGGGGAAAGGCCGTGTGTGAAGG + Intronic
925420168 2:3704415-3704437 GTGGAGAGGGGCGTGGGGGAGGG + Intronic
925420214 2:3704512-3704534 GGGGGGAGGGGCGTGGGGGAGGG + Intronic
925420257 2:3704613-3704635 GTGGAGAGGGGCGTGGGGGAGGG + Intronic
926456177 2:13070897-13070919 TGGGAAAGGGGAATTTGTGACGG + Intergenic
927180794 2:20445611-20445633 GGGGAAAGGGGAGTCGGGGAGGG - Intergenic
929675049 2:43917990-43918012 GGGGATGGGGGTGTGTGTGGGGG - Intronic
930411262 2:51028377-51028399 GGGGAAAGGCGGGAGTGAGAGGG + Exonic
931385699 2:61795737-61795759 AGGGAAGGGGGTGTGTATGAAGG - Intergenic
932167148 2:69518783-69518805 GGTGAAAGGGGTGTGAGTGATGG + Intronic
934953335 2:98594206-98594228 TGGTAAAGGGGCGAGTGAGAGGG + Intronic
935214342 2:100964321-100964343 AGGGGAAAGGGCGTGTGTGCAGG - Intronic
936093384 2:109514921-109514943 GAGGAGAGGGAAGTGTGTGAGGG - Intergenic
936441967 2:112562349-112562371 GGGGACAGGGGCCTATGGGAGGG - Intronic
936784526 2:116078068-116078090 TGGGAAAGAGGCATGTGTTATGG - Intergenic
937217015 2:120319184-120319206 GGGGAGAGGGGAGTGTCTGCAGG + Intergenic
937307628 2:120881845-120881867 TGGGAGAGGGGCATGTGGGAAGG + Intronic
937394589 2:121523907-121523929 GGGGAAATGGGGGTGAGTGAGGG + Intronic
937915270 2:127095796-127095818 ATGGAAAGCGGCGGGTGTGATGG + Intronic
938105486 2:128527122-128527144 GGGGCTTGGGGCGGGTGTGAGGG - Intergenic
938553506 2:132402232-132402254 GGGGTAGGGGGCGTGAGTGGAGG + Intergenic
939669735 2:144995446-144995468 GGGGAAAAGGCCGGGTGTGGTGG - Intergenic
943660540 2:190554704-190554726 GGGGGAAGGGGCGGTTGTGGAGG + Intergenic
946226248 2:218265544-218265566 GGGGAAAGGGGTTTGTGGGAGGG - Intronic
946328079 2:218994962-218994984 GGTGAGAGGGGCGAGTGAGAAGG + Intergenic
946973286 2:225119641-225119663 GAGGAATGGTGTGTGTGTGAAGG + Intergenic
947407028 2:229789130-229789152 GTGGCAAGGGGTATGTGTGAGGG - Intronic
947796467 2:232896760-232896782 GAGGTTAGGGGCGTGGGTGAAGG + Intronic
948844062 2:240674813-240674835 GGTGAAAGGTGTGTGTGTGGAGG + Intergenic
949050813 2:241896482-241896504 GGGGAAGGGGGTGTGGGTGAAGG + Intronic
949050869 2:241896637-241896659 GGGTGAAGGGGTGTGGGTGAAGG + Intronic
1169383462 20:5127791-5127813 GGGGACAGTGGCGGGGGTGACGG + Intronic
1169969716 20:11256367-11256389 GGGGAAAGGGTTGTGTGGTAAGG - Intergenic
1170340698 20:15323822-15323844 GGGTAAAGGAGGGAGTGTGATGG - Intronic
1170361863 20:15555109-15555131 GGGGAAGAAGGAGTGTGTGAAGG + Intronic
1170397553 20:15943679-15943701 GAGGAAAAGGGTGTGTGTGTGGG + Intronic
1170428618 20:16258601-16258623 TGGGAAAGGGGTGTGTGTTTGGG - Intergenic
1170428675 20:16258834-16258856 TGGGGAAGGGGTGTGTGTGTTGG - Intergenic
1170882379 20:20308432-20308454 GGGGAAGGGGGCTGGTGTGGGGG + Intronic
1170882388 20:20308451-20308473 GGGGAAGGGGGCTGGTGTGGGGG + Intronic
1172098197 20:32470834-32470856 GGGGCAGGGGCCATGTGTGAGGG - Intronic
1172605442 20:36210521-36210543 GGGGAAAGGAGAGTGTAGGAGGG - Intronic
1172618389 20:36305191-36305213 GGGGAAAGGGGAATGTGTTCTGG + Intergenic
1174088374 20:48026640-48026662 GGGCAAAGGGGAATGTGTGAGGG + Intergenic
1174317331 20:49713292-49713314 GGAGCAAGGGGCGGGCGTGAAGG + Intronic
1175674963 20:60938403-60938425 GGGGAAAGGCGGGGGTGTCAGGG + Intergenic
1175861399 20:62152057-62152079 GAGGAAACAGGCATGTGTGAAGG - Intronic
1175931918 20:62497559-62497581 GGGGAAGGGGGGGTGGGTGTGGG + Intergenic
1176108230 20:63399417-63399439 GGGGACAGAGGCACGTGTGAGGG - Intergenic
1176670367 21:9728404-9728426 GGGGGAAGGGGAGTGTGAGGGGG + Intergenic
1178446176 21:32645670-32645692 GGGGAGCCGGGCGTGTGGGAGGG + Exonic
1178525453 21:33324847-33324869 GAGGAAAGGCGCGTGCGTGGAGG + Intronic
1179128820 21:38616131-38616153 GGAGAGAGGAGAGTGTGTGAAGG - Intronic
1179487713 21:41721627-41721649 GGAGAGAGAGGAGTGTGTGAAGG - Intergenic
1179801919 21:43815214-43815236 GGGGAAAGGGGGGTGGGCGGGGG + Intergenic
1179812020 21:43877896-43877918 GGGGAAGGGGGTGTGGGAGATGG - Intronic
1179975057 21:44860596-44860618 GGGGAAAAGGGTGAGTTTGAAGG - Intronic
1180123111 21:45767207-45767229 GGGGAAAGGGGGGATTGGGAGGG - Intronic
1180548889 22:16526647-16526669 GGGGACAGGGCCCTGTGTGGAGG + Intergenic
1181381523 22:22508458-22508480 AGGGAAGGGGGTGTGCGTGAGGG + Intronic
1181534402 22:23534151-23534173 GGAGAAAGGGGGGTGGGGGAGGG + Intergenic
1181802048 22:25354146-25354168 GGTGAAAGGTGCGCGTGTGTTGG + Intronic
1182128457 22:27833585-27833607 GAGGAAAGGGGCATGTTTGTGGG - Intergenic
1182510649 22:30817530-30817552 GGGGAAAGGGGGTTGTGAGGAGG + Intronic
1182747639 22:32617761-32617783 GATGGAAGGGGTGTGTGTGAGGG + Intronic
1183083775 22:35474163-35474185 GAGGCAAGGGGAGTGAGTGAAGG + Intergenic
1183616896 22:38951000-38951022 GGGCAAAGGGGCCAGTGTAAGGG - Intergenic
1184449880 22:44576532-44576554 TGGGAAAGGGGAGGCTGTGATGG + Intergenic
1184803684 22:46777739-46777761 GGGGAAATGGGCCTCGGTGATGG + Intronic
1185401915 22:50623320-50623342 GGGGAAGGGGGTGTGGGTGGAGG + Intronic
949457070 3:4250181-4250203 GGGGAAGGGGGAGGGAGTGAAGG + Intronic
949551548 3:5116171-5116193 GGGGAAAGACGGGTGTGTGGTGG - Intergenic
950498709 3:13350166-13350188 GGGGAAAAGTGTGTGTGTGTGGG + Intronic
950741239 3:15053301-15053323 GAAGAAAGGGGTGTGTGGGAAGG - Intronic
950850340 3:16056320-16056342 GGGGAAAGGGGTGTGAGTCTGGG - Intergenic
950885747 3:16361452-16361474 GGGCCAAGGGGAGAGTGTGAAGG + Intronic
953783498 3:45893123-45893145 GAGGGAAGGGGAGTGTGGGAGGG - Intronic
954107069 3:48415135-48415157 GGGGCAAGGGGAGAGTGTGGGGG + Intronic
954920963 3:54190465-54190487 GTGGAAAGTGGTGTGTGTGCTGG - Intronic
956374033 3:68594998-68595020 GAGGAAAGGGCCATGAGTGAAGG - Intergenic
958478647 3:94618531-94618553 GGGGAAAGGGAAGTTTTTGAAGG - Intergenic
960259165 3:115546051-115546073 GGGGAAGGGGGTGTGGGTGTGGG - Intergenic
961474235 3:127136807-127136829 GGGGAAAGAGGCTGGTGTGGAGG - Intergenic
961548740 3:127654472-127654494 GGGGTGAGGGGCGTCTGTGTGGG - Intronic
961917889 3:130396452-130396474 GGGGAAACAGTCGTGTGTGGAGG - Intronic
964460489 3:156920024-156920046 GTGGAAAGGGGCATGTGCAAAGG - Intronic
964542027 3:157790022-157790044 GGAGAAAGGTGCTTGTCTGAAGG + Intergenic
965404020 3:168248943-168248965 GGGGAAAGGAGCTGGTTTGAAGG + Intergenic
965491987 3:169349060-169349082 GGGGAAAGGGGAGGATGAGAGGG - Intronic
967782437 3:193455049-193455071 GGGCAAAGGGCCGGGTGTGGTGG + Intronic
967927385 3:194662226-194662248 GGGGAATGGGGGCTGTGTGGTGG - Intronic
968897826 4:3415014-3415036 TGTGAGAGGGGCGTGTGAGAGGG + Intronic
969262684 4:6043676-6043698 GGGGAATGGGGGGTTGGTGATGG - Intronic
969352018 4:6603529-6603551 TGGGGAAGGGGTGTGTGTGGGGG - Intronic
969422762 4:7107019-7107041 AGGGATGGGGGAGTGTGTGAAGG - Intergenic
970171432 4:13295004-13295026 GGAGAAAGGGGAGGGTGAGAGGG - Intergenic
970832995 4:20365484-20365506 GTGGAATGGGGCGTGAGTAACGG + Intronic
971074002 4:23127147-23127169 AGGGAAAAGAGCGTGTGTGGGGG - Intergenic
974783777 4:66590588-66590610 GAGGAAAGGGGAATGTCTGAGGG - Intergenic
975313082 4:72925237-72925259 GGGGAGAGGTGCCTGTGTAAAGG - Intergenic
976167319 4:82269762-82269784 GGGGAAGGGTGCGTGTGAGATGG - Intergenic
976838252 4:89400956-89400978 GAGGAGAGTGGCCTGTGTGATGG + Intergenic
979701425 4:123672096-123672118 ATGGGCAGGGGCGTGTGTGATGG + Intergenic
979858472 4:125664338-125664360 GTGGAAACTGGAGTGTGTGAAGG + Intergenic
980397355 4:132231874-132231896 GGGGAAAAGGTCTTGTGAGAGGG - Intergenic
980878354 4:138684964-138684986 TGGGAAAGGTGAGGGTGTGAGGG + Intergenic
981845451 4:149162715-149162737 GGGGACAGGGAGGTGTGTGTGGG + Intergenic
981965664 4:150599259-150599281 GCAGAAAGGGGAGTGTGAGATGG - Intronic
982118433 4:152116755-152116777 GGGGAAAGGGGTGTGGGAGGAGG - Intergenic
983531765 4:168816890-168816912 TGGGCAAGGGGCGGGGGTGAAGG + Intronic
984279745 4:177655742-177655764 GGGGAAAGGGGGGTGGGTAAAGG - Intergenic
984778901 4:183506012-183506034 GAAGAGAGGGGCGTGTGTGGCGG + Intronic
984847555 4:184120679-184120701 GGAAAAAGGGCCGTGTGTGGGGG + Intronic
985167602 4:187113737-187113759 GGGAAAAGAGGCGTGAGTGATGG + Intergenic
985359621 4:189158920-189158942 GGGGAAGTGGGCATGGGTGAAGG + Intergenic
986130907 5:4929140-4929162 AGGGAAAGTGGCGTGTGCCAAGG - Intergenic
987375512 5:17230368-17230390 GAGGAAAGGGAAGTGTGTGTCGG + Intronic
988456910 5:31394837-31394859 GGGGGTGGGGGTGTGTGTGAGGG - Intergenic
989200737 5:38760331-38760353 GGGGAAAGAGGAGTGAGTGTGGG + Intergenic
992873134 5:81025941-81025963 GGCGAAAGGGCCGTGTGGGGAGG - Intronic
994093378 5:95827556-95827578 GGGGAAAGAGGTGTGTGTTTTGG - Intergenic
994594747 5:101818206-101818228 GGGGAAAGGAGCATGTTTGTGGG + Intergenic
995188622 5:109297541-109297563 GGGGATGGGGGCGGGGGTGAGGG + Intergenic
996329958 5:122317558-122317580 GGGGAGAGTGGTATGTGTGACGG + Intronic
996347524 5:122502870-122502892 GGGGAAAAGGACGTGTGTCAAGG - Intergenic
997297768 5:132778267-132778289 GGGGTGAGGGGTGTGTGTGGAGG - Intronic
997708196 5:135978466-135978488 GAGGAAAGGGAGGTGTGGGAAGG - Intergenic
997899548 5:137753044-137753066 AGGGAAGGCGGTGTGTGTGAGGG + Exonic
1000055267 5:157600631-157600653 GGGGAGAGGGCCATGTGTCAAGG + Intergenic
1001494066 5:172175542-172175564 GGGGAAAAGGGCGGGTGTCAGGG - Intronic
1001820524 5:174706604-174706626 GGGGAAGAGTGCGTGTGTGTTGG - Intergenic
1002927603 6:1614109-1614131 GGGGGAAGGGGAGGGGGTGACGG + Intergenic
1003926411 6:10881888-10881910 GAAGAAAGTGGGGTGTGTGAAGG + Exonic
1005154428 6:22787977-22787999 GGAGAAAGGTGTGTGTGTGTGGG - Intergenic
1006295744 6:33169305-33169327 GGGAATATGGGTGTGTGTGAGGG - Intronic
1006933865 6:37704114-37704136 TGGGAAAGAGGCCTGTTTGAAGG + Intergenic
1007423737 6:41734529-41734551 GGGGAAGGGGGCGTGTTTTCCGG + Intronic
1007504654 6:42326246-42326268 GGTGACAGGGGCCTGTATGAGGG + Intronic
1007604402 6:43106584-43106606 AAGGAAAGGGGCGGGTGTGGTGG - Intronic
1008092572 6:47308679-47308701 GGGGAAGGAGATGTGTGTGAAGG - Intronic
1008629328 6:53348590-53348612 GGGGAAAGGGGTGCGGGTGCGGG - Intronic
1010891366 6:81314995-81315017 AGGGAAAGGGGGATGTGTGGGGG + Intergenic
1012466104 6:99517844-99517866 GAGGAAATGGGAGTGTGGGAAGG - Intronic
1012472710 6:99589355-99589377 GGGGATGGGGGCGGGTGGGATGG + Intergenic
1012497783 6:99853646-99853668 GGGGTGAGGGGCGTGGGTAAGGG - Intergenic
1018332747 6:162748927-162748949 GGGGGAAGGAGTGAGTGTGAGGG - Intronic
1018828217 6:167423473-167423495 GGGGGGAGGGCCGTGTGTGGGGG - Intergenic
1018828245 6:167423556-167423578 GGGGGGAGGGCCGTGTGTGGGGG - Intergenic
1018828375 6:167423959-167423981 GGGGGGAGGGCCGTGTGTGGGGG - Intergenic
1018828403 6:167424040-167424062 GGGGGGAGGGCCGTGTGTGGGGG - Intergenic
1018936483 6:168277138-168277160 GGGGAAAGGTGTGTGTGTGAGGG - Intergenic
1020227725 7:6293415-6293437 GGAGAATGGGGAGTGTTTGACGG - Intergenic
1020342635 7:7128897-7128919 GGGGAAAGGAGCTTGAGTGAAGG + Intergenic
1023003746 7:35840192-35840214 GGGGAAAGGGGGGAGGGGGAAGG - Intronic
1023116413 7:36866890-36866912 GGGGAAAGGGGTGTGGGTTGGGG + Intronic
1024006199 7:45226208-45226230 GGGGAGAGGGGCATGGGAGATGG - Intergenic
1025959252 7:66205692-66205714 GGGGGAAGGGGCGTGGGAGCAGG - Intronic
1026162442 7:67881460-67881482 GAGGAAAGGTGTGTGTGTGTAGG + Intergenic
1026508302 7:71005709-71005731 AGGGACAGGGGTGTGTGTGCAGG - Intergenic
1026593313 7:71714336-71714358 GGGGGAAAAGGCGAGTGTGAGGG - Intergenic
1027218830 7:76201668-76201690 GGGGATAGGGGCGGGGGTGTGGG + Intergenic
1027222917 7:76225470-76225492 GGGGAAAGGGGCGGGGGGGGCGG - Intronic
1027305322 7:76888764-76888786 GAGGGAAGGGGAGTGTGGGAGGG + Intergenic
1028316084 7:89404918-89404940 GGGGAAAGGGGAGAGAGGGAGGG + Intergenic
1028796542 7:94908696-94908718 AGGGAATGGGGGGTGTGTGTAGG + Intronic
1029221788 7:98995874-98995896 TGGGACAGGGGTGTGTATGATGG - Intronic
1031950816 7:127890289-127890311 GGGCAAATGGGCGTGTGAAAAGG - Intronic
1033193117 7:139301351-139301373 GTGGAAAGGGGTGTGGGAGAGGG - Exonic
1033253024 7:139777361-139777383 AGGGGAGGGGGCGTGTGCGAGGG - Intronic
1033601697 7:142893273-142893295 GGGGAAAGGAGGGTATGTGGGGG + Intergenic
1033943281 7:146681602-146681624 TGGGAAAGGGGAGAGTGGGAGGG + Intronic
1034344840 7:150379612-150379634 GGGGAAAGGGGCGCGGCCGAGGG + Intronic
1034367857 7:150567442-150567464 GGGAATAGGGGTGTGTGTGGTGG + Intronic
1034747024 7:153531861-153531883 GGGGAAAGAGAAGTGTGTGTTGG - Intergenic
1035389586 7:158496360-158496382 GGGGGAAGGGGCGTGGGGAAGGG - Intronic
1035404130 7:158587421-158587443 GGGGAGAGGCGCCTCTGTGAGGG - Intronic
1035421113 7:158729646-158729668 GGGGAGAGGGGCAAGTGTGGAGG + Intergenic
1036938297 8:13026446-13026468 GGGGAAAGGGGTGGGGGGGAGGG + Exonic
1037579373 8:20235704-20235726 GGGAAATGGGGAGTGGGTGAGGG - Intergenic
1037836175 8:22216034-22216056 GGGGAAGGGAGGGTGTGGGATGG - Intergenic
1039182756 8:34884774-34884796 GTGGACAGGGGGGTGTCTGAGGG + Intergenic
1045973385 8:108104331-108104353 GGGGGAAGGGGCGGCTGTGGGGG + Intergenic
1047358045 8:124141786-124141808 GGGGGATGGGGGGTGTGTGTAGG + Intergenic
1047617985 8:126579068-126579090 GGGGAAAGGGGTGTATCTAAAGG - Intergenic
1047951966 8:129942391-129942413 GGAGAAAGGTGCATGTGAGAGGG - Intronic
1048445035 8:134486859-134486881 GGGGTGAGGGGCGTGTGTGAGGG + Intronic
1048718730 8:137298468-137298490 AGGCAAAGGGGAGTGTGAGATGG + Intergenic
1049097611 8:140558139-140558161 AGGGAAGGGGGCGTGGGTCAGGG + Intronic
1049643144 8:143724586-143724608 GGGGAGAGGGGGGTGTCTGCTGG + Exonic
1049689114 8:143951054-143951076 GGGGAAAGGGGCAGCTGTGGGGG - Intronic
1049802316 8:144523584-144523606 GGGGAGGGGGGCGAGGGTGAAGG - Exonic
1050301873 9:4267138-4267160 GGGGACATGGGTGTGTGTGGGGG - Intronic
1051086006 9:13349756-13349778 GGGGAAAGCTGCATGTGTGGGGG - Intergenic
1051487711 9:17626317-17626339 GGGGACAGGGACCTTTGTGAGGG + Intronic
1052714012 9:32093035-32093057 GGAGAAAGGGCCGGGTGTGGTGG - Intergenic
1053111025 9:35460426-35460448 GGGGAAAGAGAGGTGTGTGGGGG - Intergenic
1053111041 9:35460494-35460516 GGGGAAAGAGAGGTGTGTGGGGG - Intergenic
1053179885 9:35959980-35960002 GGGGAAAGGTGTGTGTGTTGGGG + Intergenic
1053219105 9:36296685-36296707 GGTGGAAGGTGGGTGTGTGAGGG + Intronic
1053576844 9:39362824-39362846 AGGCAAAGTGGCGTGTGTGAGGG + Intergenic
1053841357 9:42190749-42190771 AGGCAAAGTGGCGTGTGTGAGGG + Intergenic
1054098414 9:60921515-60921537 AGGCAAAGTGGCGTGTGTGAGGG + Intergenic
1054119815 9:61197145-61197167 TGGCAAAGTGGCGTGTGTGAGGG + Intergenic
1054587939 9:66985417-66985439 AGGCAAAGTGGCGTGTGTGAGGG - Intergenic
1055466723 9:76573944-76573966 AGGGTAAGGAGGGTGTGTGAGGG - Intergenic
1056948604 9:91023635-91023657 GGGGAAAGGGTGGGGTGTGAGGG + Intergenic
1060103994 9:120862310-120862332 GGGGAAGGCAGGGTGTGTGAGGG - Intronic
1060479032 9:124007174-124007196 TGGGAAAGGTGTGTGTGTGTGGG + Intronic
1060544087 9:124450357-124450379 GCGGAAAGGGGCGTGGCCGAGGG + Intergenic
1061010268 9:127950546-127950568 GGTGAGAGGAGCGTGTGGGAGGG + Intronic
1061161662 9:128898996-128899018 GGGACAAGGGGTGTCTGTGATGG + Intronic
1061617924 9:131792369-131792391 GGGGATAGGGGCTTGTATGCGGG - Intergenic
1062027335 9:134346638-134346660 GGGGAAAGAAGCGTGTGTCTGGG + Intronic
1062464646 9:136675657-136675679 GGGGAGACGGGCGGCTGTGATGG - Intronic
1187164208 X:16789770-16789792 GGGGGAAAGGGTGTGTGTGAGGG - Intronic
1188225624 X:27593211-27593233 GGGCAAAGGGAGTTGTGTGACGG - Intronic
1188977239 X:36690491-36690513 GGAGAGAGGAGAGTGTGTGAAGG - Intergenic
1190063008 X:47222939-47222961 GGGGAGGGGAGCGTGTGTCAGGG - Intronic
1190966366 X:55305313-55305335 GGGGGAAGGGGCGGCTGTGGGGG - Intergenic
1191591375 X:62888642-62888664 GGGGAAAGGGGCAGCTGTGGGGG + Intergenic
1192428281 X:71096074-71096096 GGGGAGCGGGGCGTGGGGGAGGG + Intergenic
1193597655 X:83466710-83466732 GGGGTGAGGGGGGTGTGTCAGGG - Intergenic
1193867866 X:86759029-86759051 GGGGAAATGGGCATGTTTAATGG - Intronic
1196644195 X:118098931-118098953 GGGGGAAGGGGGGTGGGGGAAGG + Intronic
1197735403 X:129847065-129847087 GTGGAAAGGGCTGTGTGTGTGGG - Intergenic
1198183184 X:134229978-134230000 TGGGAAAGGGGCTTGAGTCAAGG - Intergenic
1199863123 X:151819994-151820016 AGGGAAAGGAGAGTGTGGGAGGG - Intergenic
1200206571 X:154320610-154320632 GAGGAAAGAGGGGTGTGGGAAGG + Intronic
1200834131 Y:7716554-7716576 GGGCCAAGGGGAGAGTGTGAAGG + Intergenic