ID: 1106157223

View in Genome Browser
Species Human (GRCh38)
Location 13:27170955-27170977
Sequence CTTTCCCCCAGCGCGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106157214_1106157223 -5 Left 1106157214 13:27170937-27170959 CCACCTTCACACACGCCCCTTTC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 120
1106157215_1106157223 -8 Left 1106157215 13:27170940-27170962 CCTTCACACACGCCCCTTTCCCC 0: 1
1: 0
2: 4
3: 36
4: 410
Right 1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106157223 Original CRISPR CTTTCCCCCAGCGCGGGGTC GGG Intronic
900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
902363066 1:15952664-15952686 CTTTCCTCCAGCTCGGTGACTGG - Intronic
902554682 1:17240005-17240027 CATTGCCCCAGCGTGGGGCCGGG - Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG + Intronic
903845978 1:26280215-26280237 CTTTCCCCCAGCGCCAGTCCGGG - Intronic
903864600 1:26389111-26389133 TTTGCCCCCAGCATGGGGTCCGG - Intergenic
913343245 1:117781224-117781246 CTTCCCCAGAGAGCGGGGTCAGG - Intergenic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1067760569 10:49042503-49042525 CTTTGCCTCAGTGCGGAGTCTGG - Intronic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG + Intronic
1083304336 11:61754810-61754832 CCTTCCCCCATCGCAGGGGCTGG - Intronic
1083696673 11:64448119-64448141 CGTTCCCACAGCGCGGGATCTGG + Intergenic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG + Intergenic
1098508440 12:71282615-71282637 CTTACCCTCAGTGCGGGGTGTGG + Intronic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1105727820 13:23183287-23183309 CTTCCCCGCAGTGTGGGGTCAGG - Intronic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG + Intergenic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1122337953 14:101006212-101006234 ATTTCTCCCAGCGCGGTCTCTGG - Intergenic
1122637888 14:103138786-103138808 GAGTCCCCCAGCGCGGGGACAGG + Intergenic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1128321978 15:66701043-66701065 CTTTCATTCAGCGCGGGGCCAGG + Intergenic
1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG + Exonic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG + Intergenic
1131054657 15:89368317-89368339 CTATCCCCCAGCGCCGGAGCAGG + Intergenic
1132444161 15:101896250-101896272 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1133316250 16:4885809-4885831 CTCTCCTCCAGCACGGGATCCGG + Exonic
1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG + Exonic
1136777621 16:32880148-32880170 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1136893003 16:33981366-33981388 CTTTCCCACAGGGCCGGGCCTGG + Intergenic
1138180426 16:54937255-54937277 CGTTCCCCCAGCCCGGGTGCGGG + Intergenic
1139095838 16:63703768-63703790 CTTTCCCCTGGGGCGGGGCCTGG + Intergenic
1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG + Intronic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1203080036 16_KI270728v1_random:1142257-1142279 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1143465543 17:7133991-7134013 GTTTCCCCCGGCCCGGAGTCGGG + Intergenic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1148037133 17:44673211-44673233 GTTTCCCCCAGCATGGTGTCAGG + Intronic
1148053142 17:44779108-44779130 CCTTGCCCCAGAGCGGGGCCGGG - Intronic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1150255614 17:63741890-63741912 CTTCCCCGCAGGGCGGGGTGGGG - Intronic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152802015 17:82334906-82334928 GTTTCCCCGAGGGCGGGGGCTGG - Intergenic
1154940717 18:21111081-21111103 GTTGCCCCCGGCCCGGGGTCTGG - Exonic
1159952703 18:74496588-74496610 CTGTTCCCGAGCGCGCGGTCGGG + Intronic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1161255594 19:3307460-3307482 CTTTACTCCAGCGGGGGCTCCGG + Intergenic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161790691 19:6358081-6358103 CTTCTCCCCAGGGCGGGGGCAGG + Intergenic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1168063538 19:53907239-53907261 ATTTCCCCAGGGGCGGGGTCTGG - Exonic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
938073297 2:128319246-128319268 CTTTCCTCCCGCGCGGGCTGCGG - Intergenic
941925284 2:170888228-170888250 CTTTCCCCCAGGGCTGGGGGTGG + Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
942304591 2:174593779-174593801 CTTCCCCCCAGCATGTGGTCTGG + Intronic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1178704183 21:34859354-34859376 CTTTCCCCCAGGGGGATGTCAGG - Intronic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1183904705 22:41031742-41031764 CTTTCCCCTAGCACAGGGTTGGG + Intergenic
952788024 3:37175818-37175840 CTTTTCCCCAGCGCGGTGGAAGG + Intronic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
960955461 3:123027734-123027756 CTCTCTCCGAGCGCCGGGTCGGG - Intronic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
968614615 4:1571733-1571755 CCTTCCCCCTGTGCAGGGTCAGG - Intergenic
968704676 4:2072358-2072380 CTGTCCCCCTGCTTGGGGTCTGG - Intronic
969444972 4:7239501-7239523 CTTTCACCCAGGGAAGGGTCTGG - Intronic
971352823 4:25868118-25868140 TTTTCCCCCAGCTCAGGGTGGGG - Intronic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG + Intergenic
985718734 5:1477367-1477389 CCTTCCCCCATCGCCGAGTCAGG - Intronic
994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG + Intronic
999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG + Intergenic
1002736159 5:181387856-181387878 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1006057397 6:31395696-31395718 CTCTCCCTCAGCGCTGGCTCTGG - Intergenic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1007789002 6:44298175-44298197 CTTTCCCCCAGCTGAAGGTCTGG + Intronic
1017011816 6:150068624-150068646 CTTGACCCCAGCTCGGGTTCCGG + Intronic
1019241255 6:170663384-170663406 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019595872 7:1858138-1858160 CTTTTCCTCAGCACGGGCTCAGG + Intronic
1020211263 7:6159650-6159672 CTGTCCCCAAGCGCGTGGCCTGG - Intronic
1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG + Intronic
1024617639 7:51128916-51128938 ATTTCCCTCAGTGCGAGGTCGGG - Intronic
1034825134 7:154255451-154255473 CTTTCCCCCAGTGCTGGGAGTGG - Intronic
1035022751 7:155808872-155808894 GCTTCCCCCAGCGCGGGGGCGGG + Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG + Intergenic
1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG + Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG + Exonic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1055482747 9:76725976-76725998 CCTTCTCCCAGCGCGTGCTCAGG - Intronic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1203601447 Un_KI270748v1:12618-12640 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1190243554 X:48676378-48676400 CTTTCCCGGAGCCCGGGCTCTGG + Intergenic
1200102225 X:153693894-153693916 CTTTCCCACAGGGCCGGGCCTGG + Exonic