ID: 1106160784

View in Genome Browser
Species Human (GRCh38)
Location 13:27199545-27199567
Sequence CTTGATTTATGGAGGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106160784 Original CRISPR CTTGATTTATGGAGGCTGAG AGG (reversed) Intergenic
900296809 1:1956059-1956081 CTGGAGTGAGGGAGGCTGAGGGG - Intronic
903911664 1:26731339-26731361 CTGGGAGTATGGAGGCTGAGAGG - Exonic
912184973 1:107264343-107264365 TTTGCTTTGTGGAGGCTGAAAGG + Intronic
912585257 1:110757978-110758000 CTTGTTTTAAGGAGACTCAGAGG - Intergenic
913403163 1:118458336-118458358 TTTGATTTATGATAGCTGAGGGG - Intergenic
920048577 1:203149606-203149628 CTTGAGATATCGGGGCTGAGTGG + Intronic
921762290 1:218930061-218930083 GATGATTTTTGGAGGCTAAGTGG - Intergenic
922326487 1:224533117-224533139 GTTGATTTGTGGAGGTGGAGAGG + Intronic
923268993 1:232337773-232337795 CTACAATTATGGAGGGTGAGAGG - Intergenic
1063690739 10:8284698-8284720 CTTGATTTATAGTTTCTGAGTGG + Intergenic
1064176926 10:13083019-13083041 CTTGAAAGATGGAGGCTGTGTGG - Intronic
1064866264 10:19884004-19884026 CTGGCTACATGGAGGCTGAGAGG - Intronic
1065032191 10:21598799-21598821 CTTGAGTCCTGGAGGCAGAGAGG + Intronic
1067547591 10:47205607-47205629 CTTGAATTTTTGAGGCTGAAGGG - Intergenic
1072257279 10:93631997-93632019 CTTGCTTTCTGGAGGCTCTGGGG + Intronic
1072305163 10:94100314-94100336 CCTGATTTAGGGAGGGTGAGGGG - Intronic
1072696251 10:97605158-97605180 CATCATTTTGGGAGGCTGAGGGG + Intronic
1075664155 10:124218938-124218960 CTTGAGTCAAGGAAGCTGAGAGG - Intergenic
1076986351 11:238760-238782 TTTGATTTATGGATACTGAACGG - Intronic
1077206191 11:1345908-1345930 CTTGAACGATGCAGGCTGAGGGG - Intergenic
1078646358 11:13144280-13144302 ATAGAATTATGGAGGCTGACAGG + Intergenic
1078795079 11:14584242-14584264 CTAGATTTATGGAGGCAATGTGG + Intronic
1078898129 11:15616218-15616240 GCTGTTTTATGGAGGCTAAGAGG + Intergenic
1079545409 11:21627237-21627259 GTTTATTTGTGGAGGCTGAGAGG + Intergenic
1083186228 11:61019470-61019492 CTTGATGGATGGAGACCGAGGGG - Exonic
1085804277 11:79620215-79620237 GTTGATTTATGGTGGCTGCTTGG + Intergenic
1086036605 11:82423255-82423277 TTTGATTTTTAGAGGCTTAGTGG - Intergenic
1086932678 11:92709599-92709621 CTTGATGAATGTTGGCTGAGTGG + Intronic
1087285566 11:96261331-96261353 TTACAGTTATGGAGGCTGAGAGG - Intronic
1089255878 11:117193649-117193671 CTGGATACATGGAGGCTGGGTGG + Intronic
1089382457 11:118045160-118045182 CCTGATGTATTGAGGGTGAGGGG - Intergenic
1091877439 12:3947565-3947587 CTTGATTGCTGGTGGCTGGGAGG + Intergenic
1099910588 12:88828478-88828500 CTTGAGTCAAGGAGGCAGAGAGG - Intergenic
1102020547 12:109679276-109679298 CTTGCTTTACTGAGGCTCAGAGG + Intergenic
1102170742 12:110840683-110840705 CTTGATTTATTGAGACTGCCAGG - Intergenic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1103896929 12:124279147-124279169 GTTTATGTTTGGAGGCTGAGAGG + Intronic
1104425334 12:128672384-128672406 CTTGGTTTTTGTAGGCTGAAAGG - Intronic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1106160784 13:27199545-27199567 CTTGATTTATGGAGGCTGAGAGG - Intergenic
1108492013 13:50991431-50991453 CTTGATGTGGAGAGGCTGAGAGG + Intergenic
1109019775 13:57074391-57074413 CTGTATTTTGGGAGGCTGAGGGG + Intergenic
1111137459 13:84067005-84067027 CCTGATTTAGGGAGGATGAGAGG - Intergenic
1111353657 13:87067457-87067479 CATGATTTGAGGAGGCTGAGAGG - Intergenic
1111541019 13:89667352-89667374 CTAGAACTATGGGGGCTGAGAGG + Intergenic
1112610373 13:100949315-100949337 CAGGACTTTTGGAGGCTGAGTGG - Intergenic
1115343435 14:32316954-32316976 CTTGACTTATAGAAGGTGAGGGG - Intergenic
1115668586 14:35582703-35582725 CTTGCTTTATGGAGGGGGAGGGG + Intronic
1116819757 14:49616563-49616585 CTTGAATTTGGGAGGCAGAGCGG - Intergenic
1118723991 14:68613866-68613888 CTCGATTTTTGGAGTCAGAGAGG + Intronic
1120343042 14:83245727-83245749 CTTGATTTTTACAGGCTGATAGG + Intergenic
1121293655 14:92798410-92798432 CTTTATTTGTGGAGGATGTGGGG - Intronic
1121359304 14:93241700-93241722 TTAGATTTATGGAGGCTGAGCGG + Exonic
1121939115 14:98052452-98052474 CTTAATATCTGGAGGCTGGGTGG + Intergenic
1123190686 14:106566472-106566494 CTTGAGATATGGAGTGTGAGTGG - Intergenic
1123825990 15:24082706-24082728 TTTTGGTTATGGAGGCTGAGAGG + Intergenic
1125681838 15:41535683-41535705 CTTGATATAAAGAGGTTGAGAGG - Intronic
1131457408 15:92593262-92593284 GTTGATTTATGAACGCTGAGAGG - Intergenic
1131897011 15:97044721-97044743 CAGCATTTAGGGAGGCTGAGCGG + Intergenic
1135433491 16:22407932-22407954 GCTGAGTTTTGGAGGCTGAGTGG + Intronic
1135933776 16:26761767-26761789 CCTGTTTTATAGAGGCAGAGTGG - Intergenic
1136380421 16:29891926-29891948 ATTCATTAATTGAGGCTGAGGGG - Intronic
1138647914 16:58438650-58438672 CTTCATTTCTGGAGGGGGAGAGG + Intergenic
1139363472 16:66418377-66418399 CTTGATTTAAGGAAGCTCGGAGG + Intergenic
1144649822 17:17000277-17000299 CTTGCTATGTGGAGGCAGAGAGG - Intergenic
1146290474 17:31603061-31603083 GTGGATCTATGGGGGCTGAGAGG - Intergenic
1146449691 17:32962883-32962905 CTTTCTTTATAGAGGCTCAGGGG + Intergenic
1146804522 17:35854772-35854794 CTTGATTTAGGGAGGCAGGCTGG + Intronic
1147718050 17:42521353-42521375 CTGGATGGATGGAGGCTAAGAGG - Exonic
1147925010 17:43940813-43940835 CTTGCTTTATTGAGCCTGTGTGG + Exonic
1148152401 17:45404491-45404513 CTGGATTTATGGATGCTTCGAGG + Exonic
1150576663 17:66436672-66436694 CTTGATAAAGGGAGGATGAGTGG + Intronic
1150667565 17:67156622-67156644 CTTGAGTCATGGAAGCTGAGGGG - Intronic
1151890335 17:76947622-76947644 CAGGAATTATGGAGGCTCAGAGG - Intronic
1155312604 18:24538771-24538793 CCTGATTTATGGAGGCAGCAAGG + Intergenic
1155513158 18:26597328-26597350 CTTGAGGTGTGGAGACTGAGAGG + Intronic
1155592952 18:27448897-27448919 CTAGATTTATGGAAGGGGAGGGG - Intergenic
1156640336 18:39087877-39087899 GTTATTTTATGGAGGCTAAGGGG + Intergenic
1157946872 18:51990255-51990277 CTTGATTCCTGTAGTCTGAGGGG + Intergenic
1158263045 18:55630817-55630839 CTTGTTTTCTGTAGGATGAGTGG + Intronic
1161794371 19:6378079-6378101 CTTCATGTAAGGAGGCTGGGTGG - Intronic
1162663740 19:12192599-12192621 CTTTTTTTCTGGAGGCGGAGGGG + Intergenic
1162791942 19:13067607-13067629 CAAGTTTTATGGAGGCTGAGGGG - Intronic
1165186359 19:34025747-34025769 CTTAACTCATGGAGGCTGATGGG - Intergenic
1165755429 19:38290207-38290229 CTTCATCTATGGAGGCTGCCGGG + Exonic
1167997456 19:53417976-53417998 CTTGATCCCTGGAGGCAGAGAGG - Intronic
1167999894 19:53436915-53436937 CTTGAATTCTTGGGGCTGAGTGG + Intronic
1168007297 19:53501057-53501079 CTTGATCCCTGGAGGCAGAGAGG + Intergenic
925125931 2:1455857-1455879 CTTGATTTGTGGTGGCTGGAGGG - Intronic
926798756 2:16640527-16640549 CTAGATTTATGGAGGCAGAGTGG + Intronic
927102976 2:19802176-19802198 CTGGATGTGTGGGGGCTGAGAGG - Intergenic
928613798 2:33016633-33016655 CTCGATGAGTGGAGGCTGAGTGG - Intronic
929108956 2:38390293-38390315 CTTAATTGATGGTGACTGAGAGG + Intergenic
930104210 2:47627508-47627530 TTTGATGCATGGAAGCTGAGTGG + Intergenic
930616245 2:53597699-53597721 CTTGATGTATGTTGGATGAGAGG + Intronic
931869072 2:66440217-66440239 TTTGCTTTCTGGAGGGTGAGTGG - Intronic
935802730 2:106714863-106714885 CATGCTTTATGGAGCCTGGGGGG - Intergenic
937284190 2:120739545-120739567 CTTGCTTCTTGGAGGCTGTGGGG + Intronic
938717365 2:134033088-134033110 CTTGTTTTATAGATACTGAGTGG + Intergenic
939962642 2:148579029-148579051 CCTGGTTTCTGGAGGATGAGTGG - Intergenic
940476556 2:154169476-154169498 CTTGAGTTATGAAGTCTGAATGG + Intronic
941525512 2:166602037-166602059 CTGCAATTATGGAAGCTGAGAGG + Intergenic
942157027 2:173140430-173140452 CTTGAATTCAGGAGGCAGAGAGG - Intronic
942200547 2:173566559-173566581 CTTGATATTTGGACACTGAGTGG + Intergenic
942587097 2:177492649-177492671 AGTGATTTTTGGAGGCTGTGTGG + Intronic
944132832 2:196365110-196365132 TGTGATTTATGGATGCTGAATGG + Intronic
944484645 2:200192299-200192321 TTTGCTTTCTGGAGGCTGTGGGG + Intergenic
944943371 2:204654239-204654261 GATGATTTATCCAGGCTGAGGGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945987119 2:216363899-216363921 CTTGAATTGGAGAGGCTGAGGGG + Intronic
946835957 2:223772558-223772580 CTCAATTTATAGAGGCTCAGAGG - Intronic
947914156 2:233820920-233820942 CATGATTTAATGAGGCTCAGTGG + Intronic
1169759593 20:9076520-9076542 CTTCATTTATGGAGACACAGAGG + Intronic
1172808370 20:37629581-37629603 ACTGCTTTAAGGAGGCTGAGAGG + Intergenic
1173758264 20:45537527-45537549 CTGGATTTATGTAGACAGAGAGG + Exonic
1175631528 20:60542162-60542184 CATGATTTATGGAGGAAAAGGGG - Intergenic
1175707310 20:61189995-61190017 CTTGGATGATGGAGGCTGAATGG + Intergenic
1175821764 20:61913788-61913810 CATGAATTTTGGAGGCAGAGAGG + Intronic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1177226597 21:18264865-18264887 CTTGATTTCTGGAAGCTTACTGG - Intronic
1177530153 21:22347941-22347963 ATTGATTTTTGGAGACTGAAAGG - Intergenic
1179664259 21:42899351-42899373 CTTGAATCAGGGAGGCGGAGAGG - Intronic
1182396284 22:30038791-30038813 CGTGATTTCAGGAGGCAGAGGGG - Intergenic
950392199 3:12705461-12705483 CTGGATATATAGAGGTTGAGAGG + Intergenic
951559923 3:23955575-23955597 CAATATTTTTGGAGGCTGAGTGG + Intronic
952388780 3:32862062-32862084 CTTGATTTTTGGGGGAGGAGGGG + Intronic
954164041 3:48741776-48741798 CTTGAACTAAGGAGGCAGAGAGG + Intergenic
956199163 3:66688452-66688474 CTAGATTATTAGAGGCTGAGAGG + Intergenic
962918626 3:139931834-139931856 TTAAAATTATGGAGGCTGAGAGG + Intergenic
964369451 3:155984541-155984563 CTTGGTATTTGGAGGCAGAGAGG + Intergenic
964460632 3:156922473-156922495 CTTTATTTATGGAGCCTAAAAGG + Intronic
965141650 3:164844829-164844851 CTTGATTTTTGAAAGCTTAGAGG - Intergenic
965627803 3:170699306-170699328 ATTGCTTTCTGGAGGCTGCGGGG + Intronic
966511491 3:180768448-180768470 CCTGATGACTGGAGGCTGAGAGG + Intronic
967500596 3:190193036-190193058 CTTGTTTTATAGTGGCAGAGGGG + Intergenic
967771956 3:193343948-193343970 TTTGATTGATGGAAGCTGCGTGG - Exonic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
971345042 4:25803932-25803954 ATGCAATTATGGAGGCTGAGAGG - Intronic
972055859 4:34802280-34802302 ATTTAATTATGGAGGCTGACAGG - Intergenic
972456788 4:39263115-39263137 CTTGGTTTATGGAGGGGGAAGGG + Intronic
973546841 4:51990682-51990704 ATGTAATTATGGAGGCTGAGAGG - Intergenic
973833719 4:54788681-54788703 CTTGTTTTATGGACACTGTGGGG - Intergenic
974282524 4:59816448-59816470 AGTGAGTTATGGAGGCAGAGAGG - Intergenic
981979108 4:150770271-150770293 ATGCAATTATGGAGGCTGAGAGG - Intronic
984321517 4:178203265-178203287 CTTTATTTATGGAAGCCGAGAGG + Intergenic
985613403 5:903716-903738 CTTGATAAATGGAGGTGGAGGGG - Intronic
985877590 5:2612002-2612024 CTTGATTTATGGGGGAGAAGAGG - Intergenic
990339977 5:54812850-54812872 TTACAGTTATGGAGGCTGAGAGG - Intergenic
992487774 5:77211569-77211591 CTTGGTTTATGCAGGAAGAGGGG + Intronic
993637274 5:90359847-90359869 CTTGGTTGATGTAGGCTGATTGG + Intergenic
993664694 5:90681541-90681563 CTTTTTTTGTGTAGGCTGAGGGG + Intronic
993766455 5:91864455-91864477 CTGTAGTTATGGAAGCTGAGCGG - Intergenic
998561141 5:143172919-143172941 CATGTTTTATTGAGGCTGACTGG + Intronic
1003896193 6:10609892-10609914 CTTGTTTGTTGGAGGGTGAGTGG + Intronic
1004169630 6:13285793-13285815 GTTTATTTATGGAAGATGAGAGG + Intronic
1008395388 6:51000501-51000523 TTTTATTTTAGGAGGCTGAGTGG - Intergenic
1008511923 6:52284261-52284283 CTTGATTTGAGGAGACTGTGGGG - Intronic
1011646099 6:89459398-89459420 CTGGTTTTATGGACACTGAGGGG - Intronic
1011674572 6:89719783-89719805 CATGTTTTTTGGAGGCTGACTGG - Intronic
1012063667 6:94518533-94518555 CATGATTATTGGATGCTGAGAGG + Intergenic
1012127591 6:95450645-95450667 CTTGTATTGTGGAGGTTGAGAGG - Intergenic
1012311723 6:97733604-97733626 ATTGATTTAAGGAGGAAGAGAGG - Intergenic
1013969466 6:115999493-115999515 CATGATTTATTGATGCTGAGTGG - Intronic
1014168314 6:118250567-118250589 CTGGATTTAGGGAGCCAGAGAGG + Intronic
1015011248 6:128351278-128351300 CTTATTTTATAGAGGCAGAGAGG + Intronic
1017466699 6:154700740-154700762 CTTGAGTCTGGGAGGCTGAGAGG - Intergenic
1019139195 6:169932896-169932918 CATTATCTATGGAGTCTGAGAGG - Intergenic
1019521617 7:1463220-1463242 GAGGATTGATGGAGGCTGAGAGG + Intergenic
1021301722 7:18981511-18981533 CTTCATTTGTGGAGGCTCTGGGG + Intronic
1021602674 7:22379845-22379867 CATGCCTTTTGGAGGCTGAGAGG + Intergenic
1024073636 7:45807530-45807552 CTTGGTCTGTGGAGGCTGACTGG - Intergenic
1024293510 7:47824638-47824660 CTTGTTTTATTTAGGGTGAGCGG + Intronic
1024649702 7:51392670-51392692 CTTGGTCTGTGGAGGCTGACTGG + Intergenic
1024963335 7:55001412-55001434 TTACATTTATGGAGGCTGGGAGG - Intergenic
1025053780 7:55748000-55748022 CTTGGTCTGTGGAGGCTGACTGG + Intergenic
1027959237 7:84922214-84922236 CTAGATTTATGGATGTAGAGAGG - Intergenic
1029937477 7:104442451-104442473 GGAAATTTATGGAGGCTGAGGGG + Intronic
1030252629 7:107464184-107464206 GTTCATTTGTGGAGTCTGAGTGG - Intronic
1033168277 7:139060499-139060521 CACGATTTATAGAGGATGAGGGG - Intronic
1036480570 8:9135383-9135405 CTTTGTATATGGAAGCTGAGTGG + Intergenic
1037814786 8:22106453-22106475 CATGATTCAGCGAGGCTGAGGGG + Intergenic
1038017299 8:23525916-23525938 CCAGATTCATGGATGCTGAGAGG - Intergenic
1038765637 8:30425339-30425361 CTTAAATTATGGATGCAGAGAGG - Intronic
1039939430 8:42076565-42076587 CAGTATTTAGGGAGGCTGAGGGG - Intergenic
1040422568 8:47253766-47253788 CTTGCTTTATTGAGGCAAAGTGG - Intergenic
1041038411 8:53819907-53819929 CTTTATTTATGAAGGATCAGTGG - Intronic
1044494417 8:92859844-92859866 CATGATTGATGGAGACTGTGAGG + Intergenic
1045476224 8:102555152-102555174 CTGGATTTAGAGGGGCTGAGGGG + Intronic
1047083929 8:121495491-121495513 CTGGATTGATTGAGGCAGAGTGG - Intergenic
1048034191 8:130661670-130661692 CTTGATTTCAGGAGGCAGAAAGG - Intergenic
1048158806 8:131992071-131992093 GTTAATTTATGAAAGCTGAGGGG - Intronic
1048752898 8:137699811-137699833 CAAGCTTTCTGGAGGCTGAGGGG + Intergenic
1049478294 8:142806997-142807019 CTGGGGTTCTGGAGGCTGAGGGG + Intergenic
1049605183 8:143526038-143526060 CTTGAACTATGGTGGCTGTGGGG - Intronic
1050680973 9:8111007-8111029 CTTGTTTTGTGGGAGCTGAGTGG + Intergenic
1051902975 9:22062684-22062706 CATGGGTTTTGGAGGCTGAGGGG + Intergenic
1052317745 9:27133653-27133675 CTTGCTTTATGGAGCTCGAGGGG + Intronic
1053211682 9:36234486-36234508 CTTGGTGTGTGGAGCCTGAGAGG - Intronic
1057140020 9:92720802-92720824 CTTCATTTATGGGGCCTGAAAGG - Intronic
1058069724 9:100589625-100589647 TTTAATTTATGGAGGCTTCGGGG - Intergenic
1060512662 9:124245169-124245191 ATTCCTTTATGGAGCCTGAGAGG + Intergenic
1061405361 9:130390708-130390730 CTTGATTGATGGGGGTAGAGGGG + Intronic
1061684949 9:132267939-132267961 CTTGATTAAAGGAGGCTTTGTGG - Intronic
1188154296 X:26722480-26722502 CTTGGTTCTTGGAGGGTGAGTGG - Intergenic
1189817029 X:44834467-44834489 CTTGGTTTATGGACGGTGAGTGG - Intergenic
1195049772 X:101086516-101086538 TTTGATTTATTGAATCTGAGGGG + Intronic
1195770412 X:108345285-108345307 TTTCATTTATGGATGATGAGTGG - Intronic