ID: 1106164758

View in Genome Browser
Species Human (GRCh38)
Location 13:27233917-27233939
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106164745_1106164758 29 Left 1106164745 13:27233865-27233887 CCCACCTGTAATCCCAGCTACTC 0: 237
1: 1326
2: 2297
3: 2514
4: 3068
Right 1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1106164746_1106164758 28 Left 1106164746 13:27233866-27233888 CCACCTGTAATCCCAGCTACTCT 0: 43
1: 841
2: 2008
3: 2100
4: 2063
Right 1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1106164750_1106164758 17 Left 1106164750 13:27233877-27233899 CCCAGCTACTCTGGAGGTTGAGG 0: 224
1: 13847
2: 221163
3: 279308
4: 173377
Right 1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1106164752_1106164758 16 Left 1106164752 13:27233878-27233900 CCAGCTACTCTGGAGGTTGAGGC 0: 180
1: 11946
2: 201637
3: 260655
4: 178738
Right 1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1106164748_1106164758 25 Left 1106164748 13:27233869-27233891 CCTGTAATCCCAGCTACTCTGGA 0: 4262
1: 108644
2: 250127
3: 226643
4: 156630
Right 1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106164758 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intergenic
Too many off-targets to display for this crispr