ID: 1106168131

View in Genome Browser
Species Human (GRCh38)
Location 13:27266913-27266935
Sequence GTGAACAAGAGGAGGACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106168131 Original CRISPR GTGAACAAGAGGAGGACCCT TGG Intergenic
900748076 1:4374828-4374850 TTGACCAAGAGGAGGAGGCTGGG - Intergenic
901182306 1:7350143-7350165 GAGAACAAGAGCAGGTGCCTGGG - Intronic
902977089 1:20096733-20096755 GTCAACAAGGGGTGGACTCTTGG + Intergenic
903262240 1:22137513-22137535 AGGAACAAGAGGAGGAGGCTTGG + Intronic
903320286 1:22539030-22539052 GTGAACAAGACCAGAACCCCAGG + Intergenic
903341407 1:22657012-22657034 CTGAACACGAGGAGGTTCCTCGG - Intronic
906984380 1:50667230-50667252 GTGTATAAGAGGAAGAGCCTTGG - Intronic
907598890 1:55746795-55746817 GTGAATATTAGAAGGACCCTAGG - Intergenic
909018321 1:70403849-70403871 GTGAATGAGAGGGGGACCCCAGG + Intergenic
912951176 1:114121480-114121502 CTAAGCAACAGGAGGACCCTGGG + Intronic
916163823 1:161946320-161946342 GTGAATATTAGGAGGAGCCTGGG + Intronic
917299101 1:173554389-173554411 GTGGGCAAGAGCAGCACCCTAGG + Intronic
919856115 1:201707282-201707304 GTGAACAACGGGTGCACCCTCGG - Intronic
922275738 1:224076196-224076218 GTGAACCAGCAGAGCACCCTAGG - Intergenic
922563158 1:226583661-226583683 GTGACAGAGAGGAGGACTCTAGG - Intronic
922724848 1:227918055-227918077 CTGAGGAAGAGGAGGACCGTTGG - Intergenic
922724868 1:227918122-227918144 CTGAAGAAGAGGAGGACCTGGGG - Intergenic
922724941 1:227918326-227918348 CTGGAGAGGAGGAGGACCCTGGG - Intergenic
922724959 1:227918380-227918402 CTGGACAGGAGGAGGGCCCTGGG - Intergenic
923282899 1:232461823-232461845 GTCCTCAAGAGAAGGACCCTAGG - Intronic
924838787 1:247685661-247685683 ATCAACAAGAGGAGGAACTTTGG - Intergenic
1071461150 10:85897432-85897454 GGGAACCAGAGGAGAAGCCTTGG + Intronic
1071554713 10:86593198-86593220 GTGCACAGGAGCAGGGCCCTGGG - Intergenic
1074848254 10:117418035-117418057 GTGATCAAAAGAAGGACCTTTGG + Intergenic
1074951771 10:118343766-118343788 GTGAACAGGAAGAGGGACCTCGG - Intergenic
1075465425 10:122647237-122647259 GTGAGGATGAGGGGGACCCTGGG + Intergenic
1077533657 11:3108642-3108664 GTGCCCCACAGGAGGACCCTTGG - Intronic
1078024280 11:7679906-7679928 CTGAACACGTGGAGGTCCCTAGG + Intergenic
1080583181 11:33659969-33659991 GGGAAGCAGAGGAGGACTCTGGG - Intronic
1081236806 11:40656303-40656325 GTGAAAAAGAGGAGGAAATTAGG - Intronic
1082810055 11:57474268-57474290 GTGGCCAAGAGGAGGGCTCTTGG + Intronic
1084674194 11:70624621-70624643 GGGAACCAGAGGAGGAACCAGGG + Intronic
1085258463 11:75190653-75190675 TTGAACTAGAGGAGGTTCCTGGG + Intronic
1086328118 11:85725335-85725357 GGGAACAAGATGAGCATCCTGGG + Intronic
1089173925 11:116534997-116535019 GGGACCAAGAGAAGGACCCGAGG - Intergenic
1089667450 11:120029473-120029495 GGGAAAAAGAGGAGGAGCCAGGG + Intergenic
1090249070 11:125238467-125238489 GAGAGCAAGAGGAATACCCTAGG + Intronic
1090265818 11:125352164-125352186 GTGGACAAGAGGAGCACCTGGGG - Intronic
1096229674 12:49889955-49889977 GTGCTCAAGCAGAGGACCCTAGG + Intronic
1096992732 12:55818234-55818256 ATGAACATGAGGAGGAAGCTGGG + Intronic
1097195376 12:57239977-57239999 GTGACCAGGATGAGGACCCCGGG - Intronic
1098376349 12:69819703-69819725 CTAAAGAAGAGGAGGACTCTTGG + Exonic
1104188775 12:126457992-126458014 GGGAACAGGTGGAGGACACTTGG + Intergenic
1104357613 12:128101596-128101618 GTGGACCAGTGGAGAACCCTAGG + Intergenic
1106168131 13:27266913-27266935 GTGAACAAGAGGAGGACCCTTGG + Intergenic
1108429429 13:50339434-50339456 GTGAACAAAAGGAGAAGCCATGG - Intronic
1112706838 13:102079993-102080015 GTGAGCAAGAGGAAGAAGCTGGG + Intronic
1112902395 13:104374161-104374183 GCAAACCAGCGGAGGACCCTGGG - Intergenic
1115458936 14:33636875-33636897 GTCAGCAGGAGGAGGACACTCGG + Intronic
1117876196 14:60251896-60251918 TTGAACAAGCACAGGACCCTTGG + Intronic
1118477558 14:66132533-66132555 TTGAATAAGAGCAGGAACCTAGG - Intergenic
1120355521 14:83428418-83428440 GTGAAAAAGAGGAGGGCACCTGG + Intergenic
1122781738 14:104146662-104146684 GTGACCATGGGGAGGGCCCTGGG + Intronic
1123983247 15:25622403-25622425 CTGAACACATGGAGGACCCTGGG + Intergenic
1124349682 15:28945899-28945921 GTGATGAGGAGGAGGACTCTGGG + Intronic
1126138242 15:45413215-45413237 TCCAACAAGAGGAGGACTCTGGG - Intronic
1127772739 15:62244144-62244166 GTGAGGAGGAGGAGGAGCCTTGG - Intergenic
1129321224 15:74776178-74776200 GTGTACAAGTGGAGGACCTTGGG - Intergenic
1129537738 15:76327895-76327917 GTGGACACAGGGAGGACCCTGGG - Intergenic
1132655915 16:1041591-1041613 GATAACGAGAGGGGGACCCTTGG - Intergenic
1134403641 16:13935937-13935959 GAGAACAAGAGCAGTCCCCTTGG - Intronic
1135623288 16:23974455-23974477 GAGAACAGGAGGAGGAGCCAAGG + Intronic
1137907775 16:52341794-52341816 GTGGAAAAGAGGAGGTCCTTTGG + Intergenic
1137946129 16:52734763-52734785 GGGAACAAGAACAGGATCCTGGG - Intergenic
1141587813 16:85046665-85046687 GTGAACACGGAGAGAACCCTGGG - Intronic
1141816199 16:86410854-86410876 GTGAACAAGAATATCACCCTAGG + Intergenic
1141948300 16:87324904-87324926 GGGGACAAACGGAGGACCCTGGG + Intronic
1142228139 16:88887368-88887390 CTGACCAAGAGGAGGCCCCTGGG - Intronic
1142705945 17:1694363-1694385 GTGGACAAGAGGGGAGCCCTTGG + Intergenic
1143322361 17:6076388-6076410 GTGAGCAAGAGTGGGATCCTGGG + Intronic
1143994845 17:10997442-10997464 GGGAAGAAGAGCATGACCCTGGG - Intergenic
1145867946 17:28252858-28252880 GTGAGCCTGAGGAGGGCCCTTGG + Intergenic
1146950105 17:36899858-36899880 GGGACAAGGAGGAGGACCCTCGG + Intergenic
1148750132 17:49940843-49940865 GTGAGCGAGAAGAGGACCCTGGG + Intergenic
1151130720 17:71893761-71893783 GTGAATAATATGAGCACCCTTGG + Intergenic
1151854922 17:76714212-76714234 TAGAACATCAGGAGGACCCTGGG - Exonic
1152564109 17:81092523-81092545 TTGAACAACAGGAGGCCCCCGGG - Intronic
1152889445 17:82872150-82872172 CTGGATAGGAGGAGGACCCTCGG - Intronic
1153374351 18:4358630-4358652 GAGAACAAGAGGGAGGCCCTAGG - Intronic
1153896071 18:9561632-9561654 GTGAACAAGAGGAAATACCTAGG + Intronic
1155039217 18:22050975-22050997 GTGAACAAAAGCAGAGCCCTGGG - Intergenic
1155171852 18:23272595-23272617 GTGAACAAGAGGAAGGAGCTAGG + Intronic
1158879968 18:61768652-61768674 CAGAACTCGAGGAGGACCCTTGG - Intergenic
1159942135 18:74416325-74416347 GTGGCCAAGAGGAGAGCCCTAGG - Intergenic
1161050458 19:2161105-2161127 GTGTAAACCAGGAGGACCCTGGG - Intronic
1162789145 19:13054118-13054140 GGGAACTGGGGGAGGACCCTGGG - Intronic
1164554528 19:29240990-29241012 GTGAACAGAAAAAGGACCCTGGG - Intergenic
1165217161 19:34283669-34283691 GTGAAGAAGAGAATGGCCCTGGG - Intronic
1165846444 19:38820952-38820974 ATGAACAAGAGGAGGAACAGAGG + Intronic
1167376228 19:49113862-49113884 ATGAACAAGAGGTGGAGCTTGGG - Intergenic
926350168 2:11986938-11986960 GTGAACCAGAGTGGGAACCTGGG - Intergenic
928233771 2:29522527-29522549 GTCAACAGGGAGAGGACCCTGGG + Intronic
929771265 2:44894159-44894181 GGGAAGAAGAGGAGGAGCCAGGG + Intergenic
931554243 2:63482424-63482446 GTGCACAAAAGGAGGTCCCTTGG + Intronic
932438515 2:71717251-71717273 GGGACAAAGAGGAGGACACTGGG - Intergenic
932449118 2:71798507-71798529 GTGACCACCAGGGGGACCCTGGG - Intergenic
932774618 2:74520364-74520386 GAGAAAACGATGAGGACCCTTGG + Intronic
935837737 2:107073851-107073873 CAGAACAAGAGAAGCACCCTTGG - Intergenic
938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG + Intergenic
944989266 2:205216902-205216924 GTGAAGAGGAGAAGGAGCCTAGG - Intronic
947025605 2:225734589-225734611 GTGAGCCAGAGAAGGACTCTTGG + Intergenic
948503585 2:238411931-238411953 GAGGACAAGAGGTGGGCCCTGGG + Intergenic
1168891290 20:1296749-1296771 GGGGACAGGAGGAGGAGCCTCGG - Intronic
1171153417 20:22847751-22847773 ATGGACAAGAGGAGGACACTGGG + Intergenic
1175457171 20:59124183-59124205 CTGAACGGGAGGAGGACACTGGG + Intergenic
1182221490 22:28762256-28762278 GTAAATAAGATGAGGACGCTGGG - Intergenic
1185222519 22:49636189-49636211 GTGAACAAAAGGTGGATCCAGGG + Intronic
954362446 3:50129221-50129243 GTGAGCAAGAGGAGTAGTCTGGG + Intergenic
954408238 3:50357335-50357357 GTGAGCAAAAGCAGGAGCCTTGG + Intronic
954427806 3:50452681-50452703 GTGAACATGAGAAGCCCCCTTGG + Intronic
954580870 3:51702355-51702377 CTCAGCAAGAGGAGGGCCCTGGG + Intronic
956111945 3:65878765-65878787 GTGATCAGGAGCAGGGCCCTGGG - Intronic
956202391 3:66719825-66719847 GTGAACACGAGGACCACCCACGG + Intergenic
956668221 3:71661879-71661901 GTGGTTAAGAGGAGGAGCCTGGG + Intergenic
959766308 3:110033727-110033749 ATGAATAACAGGAGGAACCTCGG - Intergenic
959926184 3:111924319-111924341 GTGAAATAGAGGAGGGCACTAGG + Intronic
961125357 3:124412856-124412878 AGGAACCAGAGCAGGACCCTTGG + Intronic
963364046 3:144311671-144311693 ATGAACAAGATGAAGCCCCTGGG + Intergenic
964644497 3:158944000-158944022 GTGGAAAAGAGCAGGAACCTTGG + Intergenic
969931104 4:10631505-10631527 GAAAATAAGATGAGGACCCTTGG + Intronic
970466950 4:16333677-16333699 GAGAACAAGCATAGGACCCTGGG - Intergenic
970515003 4:16820353-16820375 GTGAACAAGAGCAGGTTCCCTGG + Intronic
971733514 4:30416763-30416785 GTGTACAATAGGGGGACCCTGGG - Intergenic
973797740 4:54445775-54445797 GGGAACATGAGGAGAGCCCTTGG - Intergenic
974122791 4:57660132-57660154 GTGAACAAGAAAAGGACTCCTGG - Intergenic
975645987 4:76546480-76546502 GAGAACCAGAGAAGGATCCTGGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977618664 4:99111946-99111968 GTGAACAAGATGACCACCTTGGG + Intergenic
977672941 4:99716653-99716675 GTGAGCAAGTGCAGGAGCCTGGG - Intergenic
980264831 4:130501855-130501877 GTGAAAATGAGGAGGACATTAGG - Intergenic
981042636 4:140237605-140237627 GGGAACAAGAGACGGATCCTTGG + Intergenic
986725482 5:10593564-10593586 GTGAACAGGAGGTTGACCCAGGG - Intronic
991976258 5:72186305-72186327 TTGAAAAAGAGGAGGAAACTAGG + Intronic
995464304 5:112435510-112435532 GTGAGCAAAAGGGGGAGCCTGGG - Intergenic
996726491 5:126677284-126677306 GTGAACATAAGAAGTACCCTGGG + Intergenic
1002418240 5:179132039-179132061 CTCCACAAGGGGAGGACCCTGGG + Intronic
1002436515 5:179234962-179234984 GGGAACATGAGCAGGTCCCTGGG - Intronic
1005882080 6:30069548-30069570 GAGAACAAAAGGAAGACACTGGG - Exonic
1005996444 6:30934270-30934292 AGGAACAAGAGGATGACCTTGGG + Intergenic
1006517633 6:34553624-34553646 GTGTACATGAGGGGGGCCCTGGG + Intronic
1006590046 6:35148251-35148273 GGGAACAAAAGGAGGTCACTGGG + Intronic
1006797036 6:36738496-36738518 GTGGACAAGAGGAGGACAGAGGG + Intergenic
1013426473 6:110017372-110017394 GTGACCATGAGGAGCACCCTTGG + Intergenic
1014053821 6:116989575-116989597 GTGAAAAATAGAAAGACCCTAGG + Intergenic
1015164624 6:130189860-130189882 TAGAACAAGAGGAAGACACTGGG + Intronic
1015592465 6:134835278-134835300 AGGAACAAGAGCAGGACCCCTGG + Intergenic
1017094102 6:150789060-150789082 GAGAGGGAGAGGAGGACCCTGGG + Intronic
1018707713 6:166475208-166475230 GTGAATTAGAGAAAGACCCTGGG - Intronic
1019672745 7:2290875-2290897 GAGAACAGGAGGAGGAACCCAGG + Intronic
1020725278 7:11805147-11805169 GTAAACAAGAGGAGGAAGTTTGG - Intronic
1021445125 7:20724867-20724889 TTGCACAAGATAAGGACCCTTGG + Intronic
1023792578 7:43764897-43764919 GTGATCAAGAGCAGGACACGGGG - Intronic
1024881506 7:54091006-54091028 GAGAACAAGGGGAGGTCACTGGG + Intergenic
1026880866 7:73905816-73905838 GAGAGCAAAAGGAGGGCCCTGGG - Intergenic
1032212289 7:129926734-129926756 GTCAGCCAGAGGAGGACTCTTGG - Intronic
1039989610 8:42476504-42476526 GTGAACCACAGGAGCGCCCTGGG + Intronic
1041104423 8:54427337-54427359 GTGAAGAAGAGTAAGACCCAGGG - Intergenic
1041379268 8:57236139-57236161 GTCAACAAGGGGTGGACCCATGG + Intergenic
1050771436 9:9206292-9206314 TTTTACAAGAGGAGGACCATTGG + Intronic
1056071846 9:82995383-82995405 GTGAACAAATGGAGATCCCTGGG - Intronic
1057716828 9:97502082-97502104 GTGAACGCGAGAAGGACCCGGGG + Intronic
1058344343 9:103942428-103942450 GTGAAAAAGAGGCGGTGCCTTGG + Intergenic
1059484618 9:114617203-114617225 GTGAACCACAGGTGGACCCGGGG + Exonic
1060302694 9:122384561-122384583 GTGACCAAAGGCAGGACCCTAGG + Intronic
1062072727 9:134566538-134566560 GTGAAGGTCAGGAGGACCCTAGG - Intergenic
1062435874 9:136546372-136546394 GTGAATAAGCGGAGGAGCCCGGG + Intergenic
1062558503 9:137128353-137128375 GTGGAAAAGAGCAGGGCCCTGGG - Intergenic
1185601339 X:1341763-1341785 GTGAGCCAAAGGAGGACCATCGG - Exonic
1187500210 X:19833139-19833161 GGGAAGGAGAGGAGGACCATGGG - Intronic
1187500216 X:19833159-19833181 GGGAAGGAGAGGAGGACCGTGGG - Intronic
1188562526 X:31485628-31485650 AGGAACAAGAGGAGAACTCTGGG + Intronic
1194330919 X:92582306-92582328 GTGCATAACAGGGGGACCCTGGG - Intronic
1195420266 X:104667622-104667644 GTGATTAAGAGCAGGACTCTGGG - Intronic
1200639620 Y:5701372-5701394 GTGCATAACAGGGGGACCCTGGG - Intronic