ID: 1106171277

View in Genome Browser
Species Human (GRCh38)
Location 13:27290751-27290773
Sequence TCCCAAATCATTGTCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106171272_1106171277 26 Left 1106171272 13:27290702-27290724 CCAGGGAATTTTATTTCTTGTAA 0: 1
1: 0
2: 9
3: 63
4: 717
Right 1106171277 13:27290751-27290773 TCCCAAATCATTGTCTCCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106171277 Original CRISPR TCCCAAATCATTGTCTCCCC GGG Intergenic
901125922 1:6928657-6928679 TCCCAGCTCATTCTCACCCCAGG + Intronic
904177976 1:28644767-28644789 TCCAAACTCATTGTCTTTCCCGG - Intergenic
904508492 1:30979960-30979982 TCCCAAATCCATGTCTCCAGTGG - Intronic
905897549 1:41558447-41558469 CCCCAAATCCTCATCTCCCCAGG - Intronic
906803446 1:48757434-48757456 TCCCAAATCATAGTCTACAGAGG - Intronic
913281355 1:117188005-117188027 TCCCAAATCTTTTCCTACCCTGG - Intronic
914385615 1:147167042-147167064 TCCTAAGCCATTGTATCCCCTGG + Intronic
916995950 1:170301217-170301239 TCCCAAAGAATTGTTTCCTCTGG - Intergenic
918262442 1:182808004-182808026 TCTGAAATCATTCTCTTCCCTGG - Intronic
919511677 1:198472824-198472846 TCACATATCCTTGTCTCTCCAGG - Intergenic
920088527 1:203435556-203435578 TCCCAGCACATTGGCTCCCCAGG - Intergenic
921971599 1:221155077-221155099 CCCCCAATCATTCTCACCCCAGG - Intergenic
1063027323 10:2193293-2193315 ACCTAAATCATTGGCTCTCCTGG - Intergenic
1063704259 10:8415571-8415593 TCCCACATCTTTGTCTTCCAAGG - Intergenic
1073469689 10:103714912-103714934 TCCCAAGTCCCTGTCTCTCCTGG - Intronic
1073630592 10:105144551-105144573 TCCCAAATTATTGTCTTGGCAGG + Intronic
1075165366 10:120063341-120063363 TCCCAAATCATTCTCATCCTTGG - Intergenic
1075524024 10:123167245-123167267 TCCCAAATCTCAGTCTGCCCAGG + Exonic
1075597865 10:123745456-123745478 TCCCAAACAAGTGTCTCTCCTGG + Intronic
1083838774 11:65290868-65290890 TCCCAAGTCAGTGCTTCCCCAGG + Intronic
1085318643 11:75561442-75561464 TCCTCAATCCTTGTCACCCCTGG - Intergenic
1085744018 11:79099456-79099478 TCCCAAAGCACTTGCTCCCCTGG + Intronic
1085771786 11:79331974-79331996 ATGCAAATCATTGTCTCCTCTGG - Intronic
1088257588 11:107915796-107915818 TCCCAAAGCAGTGCCTCTCCAGG - Intronic
1090598813 11:128348225-128348247 GCCCAACTCATGGTCTCCCGTGG + Intergenic
1090719463 11:129458660-129458682 TCCCAAACCATTCTCCACCCAGG - Intergenic
1091135953 11:133189675-133189697 TCCTAAATCATTGTATCTGCTGG + Intronic
1091159274 11:133405160-133405182 CCCCAAATCCTTGGCTCCCCTGG + Intronic
1091959841 12:4684405-4684427 TCCCAAACCCTTGGCCCCCCAGG + Intronic
1099792125 12:87349412-87349434 ACCCAAAGCTTTGTCTCCTCAGG - Intergenic
1101226391 12:102692091-102692113 TCCCAAATCCTTGCCTCCAGAGG + Intergenic
1103142559 12:118562262-118562284 TCCCAATTCCTCCTCTCCCCAGG + Intergenic
1103328372 12:120136834-120136856 GCCCAAATCAATATCTCCCATGG - Intronic
1103885131 12:124194790-124194812 TCCCAATTTATTATCTTCCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106171277 13:27290751-27290773 TCCCAAATCATTGTCTCCCCGGG + Intergenic
1107873445 13:44768143-44768165 CCCAAATCCATTGTCTCCCCAGG - Intergenic
1107876463 13:44795371-44795393 AACCAAACCATTGTCTCTCCTGG - Intergenic
1110298764 13:73900231-73900253 TAGCAAATCATTGTCTTCCTTGG - Intronic
1110860598 13:80341373-80341395 TCCCAGCTCATTGGCTCCGCGGG + Intergenic
1112771987 13:102801693-102801715 TTCCAGATTATTGTATCCCCAGG - Intronic
1113197089 13:107820787-107820809 TGCCAAATCAGTGTCTCCTGTGG - Intronic
1117015376 14:51512464-51512486 CTGCAAATCATTGTATCCCCAGG + Intronic
1118496307 14:66311178-66311200 TCCGAAATCCTTTCCTCCCCTGG - Intergenic
1119019041 14:71090554-71090576 TCCCAAATTAATATTTCCCCAGG - Intronic
1131923039 15:97351155-97351177 TCCCAAAACATTTTCTTCCTTGG - Intergenic
1132539810 16:503446-503468 TCCCAAATCATGGGTGCCCCAGG - Intronic
1132586516 16:707909-707931 TCCCATCTCCTTTTCTCCCCAGG + Intronic
1133360366 16:5169137-5169159 TCCCAAATCCTTCTGTGCCCTGG - Intergenic
1133571876 16:7049110-7049132 TCCCAAATTATTTTCTCTCCGGG + Intronic
1141617796 16:85220146-85220168 TCCCAAAACATTTTCCCCTCTGG + Intergenic
1143478554 17:7216437-7216459 CCCCAAATCCTTGCCTCACCTGG + Intronic
1144589932 17:16515343-16515365 TCCCAAATCCTTGTCACCAGAGG + Intergenic
1147182185 17:38693375-38693397 TCCCCCATCATTTTCTCCCCTGG - Intergenic
1153287904 18:3473253-3473275 TCCAATATCATTTTATCCCCCGG - Intergenic
1159315799 18:66771822-66771844 TCCCACATCCTTGTCTTTCCAGG - Intergenic
925977193 2:9149703-9149725 CTCCAAATCATTGTCTCCCCAGG - Intergenic
927751220 2:25672918-25672940 CCCCAAATCACTGTTTCCCGAGG - Intronic
928614608 2:33024742-33024764 CCTCACATCATTGCCTCCCCTGG - Intronic
929830955 2:45345812-45345834 TCCAATGTCATTTTCTCCCCAGG + Intergenic
930607167 2:53504668-53504690 TCCCAGCTCACTGTCTCCTCAGG + Intergenic
932582110 2:72998840-72998862 TCCCAAATCCTTGCCTGGCCTGG + Intronic
937858589 2:126690710-126690732 TCCCACATTATTTTCTTCCCTGG + Intronic
937859090 2:126694297-126694319 TCCCACATTATTTTCTGCCCTGG + Intronic
939957669 2:148540208-148540230 TCCCAAGTCAGTGTCTCTCCTGG - Intergenic
946960097 2:224976002-224976024 TCAGAATTCATTGTATCCCCTGG - Intronic
947505125 2:230702845-230702867 TCCCATATCTCTGTCTCTCCAGG + Intergenic
947551060 2:231047187-231047209 ACCTAAAACAGTGTCTCCCCTGG + Exonic
1168971329 20:1932905-1932927 CCCCATATCTGTGTCTCCCCTGG - Intronic
1169515037 20:6307211-6307233 TCCCAAATCATTTACTGCACTGG - Intergenic
1170201257 20:13746620-13746642 TGCCTAATCATTTTCTTCCCTGG + Intronic
1173346545 20:42205674-42205696 TGCCTGATCAGTGTCTCCCCAGG - Intronic
1174756817 20:53167098-53167120 ACCCAACTCATTCTCACCCCAGG - Intronic
1177157486 21:17513467-17513489 TCCCATAGCATTCTCTGCCCCGG + Intronic
1182452609 22:30430131-30430153 TCCCAGCTCATCTTCTCCCCCGG + Intergenic
1185226937 22:49658530-49658552 TCCAAAATCAAGGTGTCCCCGGG + Intergenic
1185327771 22:50235526-50235548 TCACAAAACACTGTCTCCACAGG + Intronic
949616459 3:5758918-5758940 CCCAAAACCATTGTCTCCGCTGG + Intergenic
952566018 3:34659253-34659275 TCCCAAATCACATTCTCCCATGG - Intergenic
955622276 3:60877435-60877457 TGCCAAAGCACTGTTTCCCCAGG - Intronic
955640824 3:61081998-61082020 TCCCATACAATTGTCTCACCTGG + Intronic
958598809 3:96266574-96266596 TCCTAATTCATTGTCTCCTCTGG - Intergenic
958724264 3:97885012-97885034 TTCCAAATTAATGTCCCCCCAGG - Intronic
961484613 3:127208278-127208300 TACCAAATCCCTGTCACCCCAGG + Intergenic
962679616 3:137784782-137784804 TTCTAAATCAGTGTCTCCCTGGG - Intergenic
962855055 3:139337567-139337589 TCCCAAATAACTCTCTCCCCTGG - Intronic
966016472 3:175145077-175145099 TCCCAAATCCTTCTCTATCCAGG - Intronic
968560491 4:1278800-1278822 TCCCAAGTCATGCTCTGCCCTGG + Intergenic
968878517 4:3286742-3286764 TCCCAGCACTTTGTCTCCCCAGG + Intergenic
971040594 4:22747708-22747730 TCCCAACTCAGTGTCTGACCAGG + Intergenic
971840573 4:31846987-31847009 TCCCAAAACTCTGTCTTCCCAGG - Intergenic
972603695 4:40594712-40594734 ACCCAAATCCTTGTTTCTCCCGG + Intronic
972761518 4:42109987-42110009 TCCAAAATCACTGTCTACACTGG + Intergenic
972947392 4:44272739-44272761 TCACTCATCATTGTCTCCCTAGG - Intronic
972980194 4:44689264-44689286 TTAGAAATCATTGTATCCCCAGG + Exonic
976963941 4:91012238-91012260 AGCCAAAGCATTGTTTCCCCAGG + Intronic
985428653 4:189856392-189856414 TCACAAATAATTGTGGCCCCAGG - Intergenic
987283633 5:16435902-16435924 GCCCCAATCATTGTCTCCTGAGG + Intergenic
988308496 5:29526708-29526730 TCCAAAATCTTTGTCTTCCATGG - Intergenic
990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG + Intergenic
991563854 5:67984323-67984345 TTGCAAATCATTATCTTCCCTGG + Intergenic
992529517 5:77641027-77641049 GCCCTTATCCTTGTCTCCCCAGG - Intergenic
1000148416 5:158475855-158475877 TCCCAAAGCATAGGCCCCCCGGG - Intergenic
1000178459 5:158782776-158782798 TACTAAATCATTGACTCCACTGG + Intronic
1000883205 5:166720759-166720781 TCCCAAAGCAATGCTTCCCCAGG + Intergenic
1001132728 5:169078210-169078232 TCCAAATGCAATGTCTCCCCAGG + Intronic
1005995552 6:30929056-30929078 TCTCAAAGAATTGTCTCCCAAGG - Intergenic
1006259772 6:32858144-32858166 TCCCAAAGCACTCTCTCCTCTGG + Intronic
1012987085 6:105886807-105886829 TTCAAAATCATTGTGTACCCTGG - Intergenic
1014219082 6:118781872-118781894 GCCCAAAGCATGGTCTTCCCAGG + Intergenic
1014802544 6:125792485-125792507 AACCAAATCATTGTTTCCTCTGG - Intronic
1014855399 6:126395506-126395528 TCACATATCTTTGTCTCTCCAGG + Intergenic
1015368816 6:132427367-132427389 TTCCAAATCTTTGTCTCTCTGGG + Intergenic
1016674591 6:146749298-146749320 TCCCAAATCAATGTCTGCAGTGG - Intronic
1017988165 6:159462833-159462855 TCCCAAATTATTTTCTCCCAGGG - Intergenic
1023638042 7:42232489-42232511 CCCAAATTCATTGTCTGCCCGGG - Intronic
1023716416 7:43048155-43048177 TCACATATCACTGTCTCTCCAGG - Intergenic
1026912074 7:74096831-74096853 TCTCCCATCATTGTCTCTCCTGG + Intronic
1026981681 7:74530304-74530326 TGCCCCATCATTGCCTCCCCAGG - Intronic
1031069720 7:117149006-117149028 ACCCAATTCATTGTCCTCCCTGG - Intronic
1033285066 7:140034257-140034279 ACCCAAATACGTGTCTCCCCAGG - Exonic
1037734505 8:21555558-21555580 TCCCAGATCACTATCCCCCCGGG - Intergenic
1038211109 8:25519873-25519895 CTCCAAATCATTGCCTCTCCAGG - Intergenic
1046535294 8:115501156-115501178 TCTCAAATCATATTTTCCCCAGG + Intronic
1048417128 8:134239890-134239912 TTCCAAATCACTGCCTCTCCTGG - Intergenic
1048838878 8:138547271-138547293 ACCCAAATAATTCTCTTCCCTGG + Intergenic
1049617431 8:143581783-143581805 ACCCAAAGCTTTGTCTCCCTGGG + Intronic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1058695105 9:107552333-107552355 ACCCAAATAATTGTTTCTCCTGG + Intergenic
1059107968 9:111527708-111527730 ACCCAAATCCTGATCTCCCCAGG - Exonic
1185940818 X:4316779-4316801 TCCCTCATCATTGTGTCCCCTGG - Intergenic
1192553925 X:72075249-72075271 TCCCAGATCATTTGCTCCTCAGG - Intergenic
1193366065 X:80636078-80636100 TCACACATCTTTGTCTCCCCAGG + Intergenic
1194618123 X:96132910-96132932 TCACAACTCACTGTCTCCCATGG + Intergenic
1197945622 X:131835925-131835947 TCCCAAATCAATCTATCCCAAGG + Intergenic
1198956264 X:142135291-142135313 AAATAAATCATTGTCTCCCCAGG + Intergenic
1199762189 X:150913391-150913413 CTCCAAAGCCTTGTCTCCCCAGG + Intergenic