ID: 1106171611

View in Genome Browser
Species Human (GRCh38)
Location 13:27293433-27293455
Sequence CCTTCCGATGAAAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106171611 Original CRISPR CCTTCCGATGAAAGGATGGA GGG (reversed) Intergenic
900799455 1:4728312-4728334 CCTTCCGATGGCATGCTGGAGGG + Intronic
902599042 1:17528631-17528653 TCTTCAGATGAATGAATGGATGG - Intergenic
907751698 1:57269269-57269291 CCTTGCCATGCAGGGATGGAGGG + Intronic
911686534 1:100783214-100783236 CCTTCAAATGAAAGGATATAGGG + Intergenic
913453308 1:119007392-119007414 CCTTCCTAGGAAAGAAGGGAAGG - Intergenic
914474658 1:148013463-148013485 CCCTCCGAAGGAAGGATGGGCGG + Intergenic
915057997 1:153154183-153154205 CCCTGAGATGCAAGGATGGATGG - Intergenic
915328275 1:155092480-155092502 CCTGGCTATAAAAGGATGGATGG + Intergenic
915825847 1:159076108-159076130 CCTACTGATGAAAGCAAGGAAGG + Intronic
917307373 1:173640321-173640343 CCTTCTCATCAAAGGGTGGAAGG + Intronic
920189585 1:204184615-204184637 CCTTGGGATGAAACCATGGAAGG - Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
922219006 1:223543663-223543685 CCTTCCAATGAAGGGATGGGGGG - Intronic
1064473766 10:15664440-15664462 CCTTCCCATGAAACTATGAAAGG + Intronic
1068088965 10:52409118-52409140 CCTTCCTAAGAAAGTAAGGAGGG + Intergenic
1069020629 10:63484183-63484205 CCTTGGGATGGATGGATGGATGG + Intergenic
1072460390 10:95612959-95612981 CTTTCCAGTCAAAGGATGGAAGG + Intronic
1078405484 11:11067033-11067055 CCTTCTGAACAAATGATGGAAGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1084537409 11:69765180-69765202 GCTTCTTATGAAAGGAAGGAGGG - Intergenic
1084699577 11:70777535-70777557 ACTTCTGATGGATGGATGGATGG - Intronic
1089534613 11:119153327-119153349 CCTTCCAATGAATGAATGAAAGG + Intronic
1089760407 11:120718589-120718611 CCTTGAGATGGAAGGAAGGAGGG + Intronic
1093269003 12:17035730-17035752 CCTTCCGATGAAGGGATATAAGG + Intergenic
1095249963 12:39967755-39967777 CCTTTTAATGAAAGGAGGGAAGG + Intronic
1095741500 12:45611369-45611391 CCAGCCGACGAAAGGATGGAAGG - Intergenic
1103842256 12:123874627-123874649 CCATCCATTGAATGGATGGATGG - Intronic
1105211648 13:18260680-18260702 CCTCACGATGAATGGATAGAGGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1108912389 13:55571946-55571968 TCTTCTAATGAAAAGATGGATGG + Intergenic
1112381083 13:98890985-98891007 CCTTCCGTTGAAAAGATGTCTGG + Intronic
1117669678 14:58093730-58093752 CCTTCCGAGAAAAGGTTGGTGGG + Intronic
1118774105 14:68962613-68962635 CCTTCCAAAGAAGGGATGCATGG - Intronic
1120995924 14:90418822-90418844 CCTTCCTCTGAAACCATGGAAGG + Intergenic
1125127516 15:36241459-36241481 CATTCCAATGAAGGAATGGATGG - Intergenic
1127375064 15:58376816-58376838 TCTTCAGAAGAAAGGAAGGAAGG + Intronic
1128936126 15:71748104-71748126 CCTGGCCATGACAGGATGGAAGG - Intronic
1129897775 15:79121393-79121415 CTGTCTGATGAAAGGATAGATGG + Intergenic
1130346991 15:83056715-83056737 CCTGTCGATGGATGGATGGATGG - Intronic
1130924442 15:88374743-88374765 CCTACCCAGGAAAGGAAGGAGGG + Intergenic
1132852966 16:2033107-2033129 CCGTCCCAAGAAAGGAAGGAAGG - Intronic
1137466486 16:48714504-48714526 CCTTGAGAAGAAAGGATGGAGGG - Intergenic
1137951511 16:52788264-52788286 GCTTCCCTTGAAAGGAGGGAGGG + Intergenic
1141995048 16:87631292-87631314 GCTTCCTAAGAAAGGATGCATGG + Intronic
1143624689 17:8103099-8103121 CATTCGGATAAATGGATGGACGG + Intronic
1151408806 17:73907198-73907220 CCTGAGGATGAAAGGATGGTGGG + Intergenic
1155034616 18:22015493-22015515 CCTTCCCAAGAAAGGGTGCATGG + Intergenic
1157297528 18:46456964-46456986 CCTTCAGAGGACAGGATTGAGGG - Exonic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1160340107 18:78082458-78082480 CCTTCAGAGGAAAGGAGGGTGGG + Intergenic
1164918006 19:32067458-32067480 ACTCCCCATGAAATGATGGAAGG - Intergenic
1167160448 19:47764134-47764156 ACCTCTGATGAAAGGATGGAGGG - Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928721292 2:34124703-34124725 CCTACCTATGAAAGGTTGGTTGG - Intergenic
930918015 2:56718108-56718130 TTTTCCCATGAAAGGATTGAAGG - Intergenic
931941625 2:67257906-67257928 TCTTCAGATTAAAGGCTGGATGG + Intergenic
932223411 2:70019571-70019593 CCTTCCTTTTAAAGGATGAATGG - Intergenic
934301973 2:91781775-91781797 CCTCACGATGAATGGATAGAGGG - Intergenic
938263454 2:129910842-129910864 CCTTCCAACCAAAGGAAGGAGGG - Intergenic
948160865 2:235822881-235822903 ACATCCGAGGGAAGGATGGATGG + Intronic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1173338184 20:42130285-42130307 CCTTGGGCTGAAGGGATGGAGGG + Intronic
1180814456 22:18780948-18780970 CCTCACGATGAATGGATAGAGGG + Intergenic
1181002469 22:19994345-19994367 CATACAGATGAATGGATGGATGG + Intronic
1181186195 22:21106216-21106238 CCAACCAATGAAAGGATGAAGGG - Intergenic
1181200644 22:21215284-21215306 CCTCACGATGAATGGATAGAGGG + Intronic
1182048493 22:27295695-27295717 CCTTACCATGGATGGATGGATGG + Intergenic
1182760885 22:32721438-32721460 CCTTGGGATGGATGGATGGATGG - Intronic
1183339765 22:37273780-37273802 CCTTCAGATGACAGGATTGCAGG + Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184324747 22:43774668-43774690 GTTTCCGGTGACAGGATGGAAGG + Intronic
1184326765 22:43793800-43793822 CCTTCAGATGAACCGATGGATGG - Intronic
1184982738 22:48105769-48105791 CAGTCTGATGAAAGGAGGGAGGG - Intergenic
1203226273 22_KI270731v1_random:80151-80173 CCTCACGATGAATGGATAGAGGG - Intergenic
1203264555 22_KI270734v1_random:6635-6657 CCTCACGATGAATGGATAGAGGG + Intergenic
950191405 3:10978965-10978987 CCTAGCGAAGAAAGGATAGAAGG + Intergenic
951804905 3:26633215-26633237 CCTTTGGATGAATGGGTGGATGG - Intronic
952540125 3:34358503-34358525 CCTTTCGATGGATGGAGGGAGGG + Intergenic
961390337 3:126548814-126548836 CCTTGTGATGAAAAGATTGAAGG - Intronic
966575811 3:181501458-181501480 CCTTCCAATGAAAGCATTGATGG - Intergenic
968113467 3:196069799-196069821 CCTTCAGATGAAAGGCAGCATGG - Intronic
968808496 4:2789662-2789684 CCTGCCCATGCAAGGATAGAAGG + Intergenic
969404650 4:6982229-6982251 CCTTTCAATGAATGGATGAATGG + Intronic
969696823 4:8739787-8739809 CCTAAGCATGAAAGGATGGAGGG + Intergenic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
973706731 4:53588630-53588652 GCTTCAGTTGTAAGGATGGAGGG + Intronic
974191881 4:58515538-58515560 GCTCCCAATGAAAGGATAGATGG + Intergenic
974324820 4:60399732-60399754 CATTCTGATGAAAGAATTGAAGG - Intergenic
974919283 4:68218261-68218283 CTATGCCATGAAAGGATGGATGG - Intergenic
975604244 4:76137359-76137381 CCTACACATGAAAGAATGGAGGG + Intronic
982122852 4:152158958-152158980 TCTTCAGTAGAAAGGATGGAAGG - Intergenic
983465799 4:168087889-168087911 CCTTCCAATGAAAGATTGCAGGG - Intergenic
985836128 5:2273153-2273175 CCTTCGCAGGAAAGGCTGGAGGG + Intergenic
986078831 5:4367739-4367761 ACTGCAGATGAAAGCATGGATGG - Intergenic
986730533 5:10632053-10632075 CCTGGCTATGACAGGATGGAAGG - Intronic
992161690 5:74010487-74010509 CCTTTGGATGGATGGATGGATGG - Intergenic
993210514 5:84944628-84944650 CATTCCCATCAAAGGATGAATGG - Intergenic
993370069 5:87082124-87082146 TCTTCCTATGAAAGGAGGGGAGG - Intergenic
994157321 5:96518658-96518680 CCTTCTCATGAAAGGTTGGTTGG - Intergenic
994742684 5:103641710-103641732 CCCACAGATGAATGGATGGAGGG - Intergenic
998408010 5:141885039-141885061 ACTTCAGTTGAAAGGAAGGAAGG - Intergenic
999178027 5:149645727-149645749 CCTTTCGAAGAAAAGAGGGAAGG - Intergenic
1001565621 5:172697465-172697487 GCCTCCCAGGAAAGGATGGACGG + Intergenic
1006611291 6:35295993-35296015 CCTAGAGCTGAAAGGATGGAGGG - Intergenic
1009839368 6:69048234-69048256 CTTTCCAATGAAAGGACGGAAGG + Exonic
1011422626 6:87189794-87189816 CCTTCCGAGTACAGTATGGAAGG - Intronic
1014274454 6:119371129-119371151 TCTGTCGATGGAAGGATGGATGG + Intergenic
1018728185 6:166629182-166629204 CCTTCCGAGGGAAGCATGGTCGG - Intronic
1019264409 7:105242-105264 CCTTCCGATGAATGATCGGAAGG + Intergenic
1019710192 7:2514786-2514808 CCGACAGATGAATGGATGGATGG - Intronic
1022329061 7:29360562-29360584 CCTTCCCATGGCAGGGTGGAGGG + Intronic
1024507814 7:50177575-50177597 TCTACTGATGAATGGATGGATGG + Intergenic
1032636987 7:133719892-133719914 ACTTCTCAGGAAAGGATGGATGG + Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034025959 7:147704424-147704446 CCTTCTGAAGAAAGGGTGGTTGG + Intronic
1034270142 7:149799770-149799792 CCTTCCCAGGAAAGGAAGGTGGG - Intergenic
1038969420 8:32615832-32615854 TCTTCTGAGGAAAGGAAGGAAGG + Intronic
1042130964 8:65586580-65586602 CCTTAAGATGAAAGGAGAGAAGG - Intergenic
1043165072 8:76893430-76893452 CCTTACAAGGAAAGGAAGGAAGG - Intergenic
1043197005 8:77307894-77307916 CCTTCTTATGATAGGAAGGAAGG + Intergenic
1046448207 8:114352853-114352875 CCTTCCTAAGAAATGATGCATGG - Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1051056327 9:12991534-12991556 TCTTCCTTTTAAAGGATGGAAGG + Intergenic
1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG + Intergenic
1057551831 9:96056844-96056866 CCTCCCTTTGAAAGGATGGAAGG + Intergenic
1059358538 9:113720180-113720202 CCTTCCAAAGGAAGGAAGGAAGG - Intergenic
1061255582 9:129453146-129453168 TCTTTGGATGGAAGGATGGAAGG + Intergenic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1195229161 X:102829075-102829097 TCTTTGGATAAAAGGATGGATGG - Intergenic
1197865644 X:131014052-131014074 ACTTACAAGGAAAGGATGGAAGG - Intergenic
1200157264 X:153983829-153983851 CCTTCAGATGAAAGGAGGTGAGG - Intergenic