ID: 1106174729

View in Genome Browser
Species Human (GRCh38)
Location 13:27320541-27320563
Sequence CTTCCTCCCAACATGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 3, 1: 22, 2: 88, 3: 169, 4: 555}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106174725_1106174729 -4 Left 1106174725 13:27320522-27320544 CCTCTCTATGTGGCCTGGGCTTC 0: 5
1: 14
2: 67
3: 156
4: 504
Right 1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG 0: 3
1: 22
2: 88
3: 169
4: 555
1106174721_1106174729 9 Left 1106174721 13:27320509-27320531 CCTCTTCATGTGGCCTCTCTATG 0: 1
1: 1
2: 3
3: 35
4: 279
Right 1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG 0: 3
1: 22
2: 88
3: 169
4: 555
1106174719_1106174729 28 Left 1106174719 13:27320490-27320512 CCAGGGTCATCTGCTGGAACCTC 0: 1
1: 0
2: 0
3: 7
4: 191
Right 1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG 0: 3
1: 22
2: 88
3: 169
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106174729 Original CRISPR CTTCCTCCCAACATGGTGGC TGG Intergenic
901416826 1:9122084-9122106 CTTCCTCCCCTCACGGTGGTGGG - Intronic
901681201 1:10913847-10913869 CTTCCTCACAGCATGGCGGCTGG + Intergenic
901780585 1:11591902-11591924 CTTCCTCACAGCATGGTGGCTGG - Intergenic
901873092 1:12149954-12149976 CTTCCTCACAGCATGGCTGCTGG + Intergenic
902314765 1:15609907-15609929 CTTCCTCACAGCATGGCTGCTGG + Intergenic
902598398 1:17524754-17524776 CTGCCTCTCAACATGATGGGAGG - Intergenic
902835887 1:19046550-19046572 ATTCCTCACTGCATGGTGGCCGG + Intergenic
903541514 1:24098973-24098995 CTTCCCTCAAGCATGGTGGCAGG + Intronic
903547490 1:24135693-24135715 GTTCTTCCTCACATGGTGGCAGG + Intronic
903699678 1:25237483-25237505 CTTCCTCAAAGCATGGGGGCTGG + Intergenic
903766552 1:25738785-25738807 CTTCCTTACAGTATGGTGGCTGG + Intronic
904850612 1:33456404-33456426 CTTTTTCACAACATAGTGGCTGG + Intergenic
905156977 1:35992980-35993002 TATCCTCACAACATTGTGGCTGG + Intronic
905303752 1:37003810-37003832 CTTCAGCCCAGCAGGGTGGCAGG - Intronic
907574434 1:55513390-55513412 TATCCTCACAACATGGTAGCTGG - Intergenic
907592979 1:55693484-55693506 CCTCTTCACAACATGGTGGCTGG + Intergenic
907603614 1:55794211-55794233 CTTCCTCCCTACATCCTTGCTGG + Intergenic
907657678 1:56360679-56360701 CTTCCTCACAGCATGGCAGCTGG + Intergenic
907706856 1:56839827-56839849 CTTCCTCACAGTATGGTTGCTGG + Intergenic
907950858 1:59182354-59182376 TGTCCTCACAACATGGTGGCTGG - Intergenic
908100901 1:60790016-60790038 GTTTCTCACAACCTGGTGGCTGG - Intergenic
908832185 1:68190536-68190558 CTGCCTCGCAACATGGCAGCGGG - Intronic
908911933 1:69081485-69081507 CTTCCTCACAAGATGGTTGTTGG + Intergenic
909035418 1:70590118-70590140 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
910402832 1:86854443-86854465 CTTCCTCACAGCATGGTGATTGG - Intergenic
910552609 1:88493608-88493630 CTTCCTCCCAGCATGATGTCTGG + Intergenic
911119152 1:94277760-94277782 CTTCCTCCCATCACTGTGTCAGG - Intergenic
912211683 1:107563690-107563712 CTGCCTCACAACATGGCAGCTGG - Intergenic
912972961 1:114301408-114301430 CTTCCTTGCAGCATGGTGGCTGG - Intergenic
913052722 1:115131215-115131237 CTGATTTCCAACATGGTGGCTGG - Intergenic
913681063 1:121187094-121187116 CTTCCGCACAACATGGTGTGGGG - Exonic
914032893 1:143974734-143974756 CTTCCGCACAACATGGTGTGGGG - Intergenic
914156553 1:145093232-145093254 CTTCCGCACAACATGGTGTGGGG + Exonic
914856546 1:151355910-151355932 CTCCCTCACAACATGGTAGCTGG - Intergenic
914943815 1:152046169-152046191 CTTCCTCACAGCATGGTGGATGG - Intronic
915737715 1:158095229-158095251 CTTCCTCCCACCATGGCAGGTGG + Exonic
916042698 1:160974782-160974804 CTTCCTTACAACATGGAGGCTGG - Intergenic
916199043 1:162252298-162252320 CCTCCTCCCAACATGCTGGCTGG + Intronic
916492282 1:165312581-165312603 CTTCCTTACAGCATAGTGGCTGG - Intronic
916678585 1:167084614-167084636 CCTCCTCATAACATGATGGCTGG - Intronic
916991428 1:170249726-170249748 CTTTCTCATAGCATGGTGGCTGG - Intergenic
917097473 1:171413736-171413758 GCTGCTCCCAAGATGGTGGCGGG + Intergenic
917553338 1:176058106-176058128 CTCCCTCCCGACGGGGTGGCTGG - Intronic
917970624 1:180204379-180204401 CTTCCTCACGGCATGGTGGCTGG + Intergenic
918118663 1:181518304-181518326 CTTCCTCTCAGCATCGTTGCTGG + Intronic
918404811 1:184201188-184201210 CTTTCTCACGGCATGGTGGCTGG + Intergenic
918992962 1:191721995-191722017 CCTTCTCACAACATGGTGACCGG + Intergenic
919082729 1:192886460-192886482 GCTGCTTCCAACATGGTGGCAGG + Intergenic
919151477 1:193705902-193705924 CTTCCTCACAGCATGGTGGCTGG + Intergenic
919315857 1:195969930-195969952 ATTCCTCCCAATATCGTGACAGG + Intergenic
919706399 1:200680486-200680508 CTGCCTCCCAAAGTGCTGGCTGG - Intergenic
919827605 1:201514535-201514557 CTCTCTCACAGCATGGTGGCTGG + Intergenic
919986221 1:202677437-202677459 CTTCCTCACAGCATGGTGGCTGG - Intronic
920089795 1:203444246-203444268 CCTCCTTGCAACATAGTGGCTGG + Intergenic
920092616 1:203465073-203465095 CCTCCTCCCCACATGGTCCCTGG - Intergenic
920174745 1:204093538-204093560 CTCCCTCTGACCATGGTGGCGGG + Intronic
920468375 1:206205618-206205640 CTTCCGCACAACATGGTGTGGGG - Intronic
920940111 1:210474178-210474200 CTGCCTCCTAGCATGGGGGCTGG + Intronic
921099223 1:211913857-211913879 AGTCCTCCTCACATGGTGGCTGG - Intergenic
922175556 1:223194551-223194573 CTTCCTCACAGCATGGTAGCTGG - Intergenic
922362001 1:224831585-224831607 CTTCCCCACAACATGGTGGCTGG - Intergenic
922867956 1:228876436-228876458 CTACTTCACAACATGATGGCTGG + Intergenic
922876360 1:228942850-228942872 AGAGCTCCCAACATGGTGGCAGG - Intergenic
922877823 1:228954251-228954273 AGAGCTCCCAACATGGTGGCGGG - Intergenic
923128505 1:231054443-231054465 CTACCACACAACACGGTGGCTGG - Intergenic
923210873 1:231803220-231803242 CTTCCTTACAACATGGCTGCTGG + Intronic
923227970 1:231956884-231956906 CTTCCTCACAAAATGGTGGCTGG + Intronic
923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG + Intronic
923301993 1:232650055-232650077 CTTCCTCACAATATGGAAGCTGG - Intergenic
923654612 1:235904837-235904859 CCTGCCCCCAACATGGTGTCTGG - Intergenic
924202158 1:241671758-241671780 CTTCTTCCCTCCATGGTGGGAGG + Intronic
924949897 1:248872831-248872853 CCACCTCCCAACGTGGTGGCGGG + Intergenic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063607831 10:7538581-7538603 CTTCCTCACAACATGGCGGCTGG + Intergenic
1064178626 10:13096834-13096856 CCTCCTCCCAATCTGGGGGCGGG + Intronic
1065356249 10:24844923-24844945 CTTCCCCACAACGTGGTGGTTGG - Intergenic
1065566840 10:27019994-27020016 CTTCCTCACAAGATCGGGGCTGG + Intronic
1066025361 10:31352707-31352729 CTTGCTTACAACATGGTAGCTGG + Intronic
1066201455 10:33145711-33145733 CTGCCTCACACCTTGGTGGCTGG + Intergenic
1067277557 10:44848716-44848738 CTTCCTCACAAGATGGTGGCTGG - Intergenic
1067532709 10:47086096-47086118 ACTACTCCCAGCATGGTGGCTGG + Intergenic
1067733795 10:48833402-48833424 CTTCCTTACAGCATGGTAGCAGG + Intronic
1068387679 10:56352441-56352463 CAAGCTCCCAAGATGGTGGCAGG - Intergenic
1068757573 10:60671760-60671782 CATCCTCACAACATGGCTGCTGG - Intronic
1069749315 10:70735436-70735458 CTGCATCCCTGCATGGTGGCTGG - Intronic
1069774143 10:70917127-70917149 CCTCCTGCCAACATGGCTGCAGG - Intergenic
1069776730 10:70931648-70931670 CTTCCTCCAGACACGGTGGCTGG + Intergenic
1069912197 10:71766374-71766396 CTGCCTCCTTACCTGGTGGCAGG - Intronic
1070080601 10:73182599-73182621 CTTCCTCGCAATATGATGGCTGG - Intronic
1070313480 10:75290414-75290436 CTTCCTCACACCATGGCAGCTGG + Intergenic
1070325430 10:75385591-75385613 CTTCCTCACAGCATGGTGACTGG + Intergenic
1071082648 10:81830974-81830996 CTTGCTCCTAAGATGGTGGTGGG + Intergenic
1071742782 10:88379794-88379816 ATTCTTCACAACATGATGGCTGG - Intronic
1073494160 10:103876383-103876405 ATTCCTCACATCATGGTGTCTGG - Intergenic
1075413177 10:122244126-122244148 CTTCCTCTCATCCTGGTGCCAGG + Intronic
1075999290 10:126902911-126902933 CAGCCTCCCAAAATGCTGGCTGG + Intergenic
1076528252 10:131126339-131126361 CTGCCTCTCAGCATGGTGGACGG - Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1076980326 11:200703-200725 CTTCCTCACAACATGATGGCTGG - Intronic
1077460385 11:2706297-2706319 TGTCCTCACACCATGGTGGCTGG - Intronic
1077735313 11:4784257-4784279 TTTCTTCACATCATGGTGGCTGG + Intronic
1078358424 11:10649760-10649782 CTTACTCTCAACTTTGTGGCAGG - Intronic
1078485709 11:11721497-11721519 CTGCCTCATAACATGGTGGAAGG + Intergenic
1078500708 11:11872268-11872290 CTTCCTCACAGCATGGAGGCTGG + Intronic
1079398599 11:20087105-20087127 TTTCCTCCCACCTTGCTGGCCGG - Intronic
1079857804 11:25628271-25628293 CCAACTCCCAAGATGGTGGCTGG - Intergenic
1080247389 11:30195255-30195277 CTTCTACACAGCATGGTGGCTGG - Intergenic
1080387887 11:31820275-31820297 CTTCCTCCAAGGCTGGTGGCAGG - Intronic
1080835916 11:35940946-35940968 TGTCCTTACAACATGGTGGCTGG + Intergenic
1081023268 11:37974198-37974220 TTTCCTCACAAGCTGGTGGCTGG + Intergenic
1081154429 11:39671806-39671828 CTTTCTCACAGTATGGTGGCTGG - Intergenic
1081367787 11:42257699-42257721 CTTTCTCACAACATGGTGGCTGG - Intergenic
1081498370 11:43639285-43639307 CTTTCTCCCAGCAAGGTGGGCGG - Intronic
1081762006 11:45583217-45583239 CTTTCTCACAACATGGCAGCTGG - Intergenic
1083639565 11:64138198-64138220 CTTCCTCCTAACAAGGAGGCAGG - Intronic
1083708304 11:64531610-64531632 CTTCCTCCTACCTTGGTGGAGGG - Intergenic
1085042871 11:73336919-73336941 CTTCCCCACAACGTGGAGGCTGG + Intronic
1086111092 11:83199072-83199094 CTTCCTCACAATATGGTGACTGG + Intronic
1086324714 11:85686413-85686435 CTTCCTCCCCTGATGCTGGCTGG - Intergenic
1087278090 11:96180438-96180460 CTTCTTCACAACATAGTGGCTGG - Intronic
1087282295 11:96225280-96225302 TGTCCTCCTGACATGGTGGCTGG - Intronic
1088190251 11:107220509-107220531 TTTCCTTAAAACATGGTGGCTGG - Intergenic
1088194841 11:107262923-107262945 CTTCCTCCCACAATGATGCCAGG + Intergenic
1088425135 11:109693822-109693844 CTTTCTCCCAGGGTGGTGGCAGG + Intergenic
1088499154 11:110465258-110465280 CTTCCTCACAACCTGGCGCCTGG + Intergenic
1088503918 11:110510827-110510849 TGTCCTAACAACATGGTGGCTGG - Intergenic
1088937616 11:114419481-114419503 CTTCCTCACAGCATGGTGTCTGG + Intronic
1089131317 11:116214550-116214572 CTGCCTCCCAAGATGGTGCCAGG + Intergenic
1089547220 11:119238123-119238145 CAGCCTCCCAAAATGCTGGCAGG + Intronic
1089867107 11:121641851-121641873 TTTCCTCCTAAAAAGGTGGCTGG - Intergenic
1090313387 11:125763628-125763650 TTACCTGCCAACATGGTGTCTGG - Intergenic
1090964530 11:131586450-131586472 CTTCCTCACAACATGGCAGCTGG - Intronic
1090964694 11:131588256-131588278 CTTCCTCACAACATGGCAGCTGG + Intronic
1091040726 11:132278486-132278508 CTTCCTCCTAGCAAGGTGGCTGG + Intronic
1091205159 11:133815768-133815790 TTTCCTCACAGCGTGGTGGCTGG - Intergenic
1092343389 12:7695309-7695331 CTTCCTCTCAGGATCGTGGCTGG + Intronic
1092598305 12:10031565-10031587 TTTCTTCCCAAAATGGTGGGGGG - Intronic
1092734058 12:11562886-11562908 CATCCTCCCAAAGTGCTGGCTGG - Intergenic
1093167237 12:15818074-15818096 CTTCCTCACAACATGGCAGTTGG + Intronic
1093511671 12:19936476-19936498 CTGCCTCACAACATGGCAGCTGG - Intergenic
1094048169 12:26190322-26190344 TATCCTCACAACATGGTGGCTGG - Intronic
1094406748 12:30124470-30124492 TGTCTTCACAACATGGTGGCTGG - Intergenic
1095402225 12:41827962-41827984 CTTCCTCACATCGTGGTGGCTGG - Intergenic
1095493838 12:42763837-42763859 CTTCTTCACAAAATGGTGGCTGG + Intergenic
1096664686 12:53155439-53155461 CTACCTCCCAAAATAGTGTCTGG - Intergenic
1097377699 12:58859018-58859040 AGAGCTCCCAACATGGTGGCAGG + Intergenic
1097983391 12:65757305-65757327 CTTCCTCACAGCATGGTGACAGG - Intergenic
1098112257 12:67135200-67135222 TTTCCTCACAGCATGATGGCTGG + Intergenic
1098199637 12:68040998-68041020 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1098383230 12:69891493-69891515 TTTCTTCACACCATGGTGGCTGG + Intronic
1098482173 12:70976541-70976563 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1098769910 12:74539353-74539375 CTGCCTCCCACCCTGGGGGCAGG + Exonic
1098976277 12:76905324-76905346 CTTCCTCACAACATGGTGGTTGG - Intergenic
1099651061 12:85428942-85428964 CTTTCTCACAACATAGTGGCTGG + Intergenic
1100673355 12:96839893-96839915 CCTCCTCACAACATGGTAGTAGG + Intronic
1100903856 12:99274936-99274958 CTTCCTTAAAGCATGGTGGCTGG + Intronic
1101933965 12:109040742-109040764 CATCTTCACAACATGGTGACTGG + Intronic
1102185587 12:110945748-110945770 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102200816 12:111056526-111056548 CTTCCTCACAGCATGGTGGCTGG + Intronic
1102426018 12:112845009-112845031 TGTCCTCACAACATGGCGGCTGG + Intronic
1102554365 12:113717188-113717210 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1102594981 12:113985454-113985476 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102637942 12:114340882-114340904 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1102671321 12:114621580-114621602 CTGCCTTACAACATGGTAGCTGG - Intergenic
1102819015 12:115892241-115892263 CTTCCTGACAGCATGGTGCCTGG - Intergenic
1102894132 12:116585015-116585037 TGTCCTCACAACATGGTGGCTGG - Intergenic
1102925802 12:116825244-116825266 CTTCCCACAAACATGGTGGCTGG + Intronic
1102932693 12:116874751-116874773 CTTCCTCACAGCATGGCAGCCGG - Intronic
1103055403 12:117816239-117816261 CTTCCTCACAGCATGGTGGTTGG - Intronic
1103202343 12:119098104-119098126 TATCCTCACAACATGGCGGCTGG - Intronic
1103740795 12:123090302-123090324 TGTCCTCACAAGATGGTGGCTGG + Intronic
1103885591 12:124197852-124197874 CTTCCTTACAGCATGGTGGCTGG - Intronic
1103890671 12:124236746-124236768 TTTACTCCCAAGGTGGTGGCCGG - Intronic
1103985257 12:124762740-124762762 TTTCCTTCCACCATGGTGACAGG - Intergenic
1104064279 12:125293962-125293984 CTTCCTCACAGCATGGCAGCTGG - Intronic
1104382757 12:128322193-128322215 CTTCCTCACAACATGGTGGCTGG - Intronic
1104535021 12:129610602-129610624 CTTCCTCCCAGCCAGTTGGCTGG - Intronic
1104597414 12:130129323-130129345 CTTCCTGGCAATATGGCGGCTGG + Intergenic
1104747788 12:131221002-131221024 CTCCCTCCCTCCAGGGTGGCAGG + Intergenic
1105345989 13:19573216-19573238 CTTTCTCACTACATGGTCGCTGG - Intergenic
1105627742 13:22129629-22129651 CTTCCTCACAACATGGCAGCTGG + Intergenic
1105772731 13:23628439-23628461 CTTCCTGACAGAATGGTGGCTGG - Intronic
1106146048 13:27050740-27050762 CTTCCTCACAGTATGGCGGCTGG - Intergenic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106236220 13:27862740-27862762 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1106421594 13:29590110-29590132 CATCCTCCCCACAAAGTGGCTGG - Intronic
1106622171 13:31381329-31381351 CTTTCTCCCATCATTGCGGCAGG - Intergenic
1106644018 13:31613791-31613813 CTTCCTGACAGCATGGTGGTTGG - Intergenic
1107159533 13:37209902-37209924 CTTCTTCCCAACATGGGCTCTGG - Intergenic
1107478538 13:40764643-40764665 CTTTATCCCTGCATGGTGGCTGG - Intronic
1107791529 13:44006924-44006946 CTTCCTTCCAACATGGTGGTTGG + Intergenic
1107887329 13:44884662-44884684 CTTCCCCACAGCATAGTGGCTGG + Intergenic
1108040267 13:46333352-46333374 CTTCCTCACACCATGGGGGCAGG - Intergenic
1108054724 13:46474219-46474241 CTGCCTCCTCACATGGTGGAAGG - Intergenic
1108505317 13:51107626-51107648 CTCCCTCCCTATATGGAGGCCGG + Intergenic
1108621353 13:52187508-52187530 CTTTCTCACCGCATGGTGGCTGG - Intergenic
1108665288 13:52624037-52624059 CTTTCTCACCGCATGGTGGCTGG + Intergenic
1109346363 13:61119009-61119031 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1109405527 13:61893516-61893538 CTTTATCACAACATGGTGGAAGG - Intergenic
1110785667 13:79522736-79522758 CTTCCTCAGTAGATGGTGGCTGG + Intronic
1110845287 13:80185467-80185489 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1111248793 13:85576381-85576403 TTGCCTCTCAACCTGGTGGCTGG - Intergenic
1111393095 13:87625289-87625311 CTTTGTCACATCATGGTGGCTGG - Intergenic
1111523406 13:89434691-89434713 CTGCATCCTAACATGGTGGATGG + Intergenic
1112251470 13:97784471-97784493 CTTCATCCTCACATGGTGGAAGG - Intergenic
1113706150 13:112434170-112434192 CCTCCTCCCCTCATGGCGGCCGG - Intronic
1113784061 13:112993243-112993265 CTTCGTGTGAACATGGTGGCGGG + Intronic
1113894366 13:113754429-113754451 CTTCCTCATGACATGGGGGCTGG - Intergenic
1114595679 14:23909729-23909751 TGTCCTCACAACATGGTAGCTGG + Intergenic
1114921611 14:27339173-27339195 CTTCCTCCTTAAGTGGTGGCTGG - Intergenic
1115233925 14:31190023-31190045 CTTCCTCACAGGATGGTGACTGG - Intronic
1115694557 14:35882377-35882399 CTCCCTCCCAACGTGCTTGCTGG + Intronic
1115710799 14:36048887-36048909 CTTCCTCACAGGATGGTGGCTGG + Intergenic
1116091876 14:40318449-40318471 TTTCCTCACAGCATGGTGACTGG - Intergenic
1116735109 14:48679578-48679600 TTTCTTCACAGCATGGTGGCTGG - Intergenic
1117772902 14:59152359-59152381 CTTCCTCCCAGCATTGCTGCAGG + Intergenic
1118169308 14:63370903-63370925 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1118325244 14:64776022-64776044 CTTCCTCCCACCCTGGTGGCTGG + Intronic
1118492966 14:66279738-66279760 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1119134393 14:72203643-72203665 GCTGCTCACAACATGGTGGCTGG + Intronic
1119281167 14:73409337-73409359 CTTCTTCACAGCATGGTGCCTGG - Intronic
1119701632 14:76759851-76759873 CTTCTTCACAACATGGTAGCTGG + Intergenic
1119749100 14:77064967-77064989 CATCCTCCCAGCATGCTGGCAGG + Intergenic
1119854638 14:77890356-77890378 CTTCCTCACAGCATGGCGGCTGG + Intronic
1119921477 14:78450537-78450559 CTTCCTCCCTACCTGGAGCCCGG + Intronic
1120055798 14:79922740-79922762 CTTCCTCATAGCATGGTGACTGG + Intergenic
1120220587 14:81728181-81728203 CGTCCTTACAACATGGTGGCTGG + Intergenic
1120281998 14:82451052-82451074 CTTCCTGCCTGCATTGTGGCAGG - Intergenic
1120627723 14:86849665-86849687 CTTACTCTTAACATGGTGTCTGG + Intergenic
1120834050 14:89024920-89024942 CTTCCTCACAGCATGGCGGCTGG + Intergenic
1121435154 14:93914434-93914456 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1121534023 14:94678749-94678771 CTTCCTTCCAGCATGGTGGCTGG - Intergenic
1122045942 14:99023776-99023798 ATTTCTCGCAATATGGTGGCTGG + Intergenic
1122657345 14:103270909-103270931 CTGTCTCCCCAGATGGTGGCTGG - Intergenic
1122927383 14:104911774-104911796 CTGCCTCCCAAAGTGCTGGCTGG - Intergenic
1123156478 14:106232095-106232117 CATCCTCACAACAAGGTGACAGG + Intergenic
1123171056 14:106373402-106373424 CTTCCTCACATCCTTGTGGCAGG - Intergenic
1123222795 14:106872570-106872592 CTTCCTCACATCCTTGTGGCAGG - Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1123791703 15:23727635-23727657 CTCCCTCCTCACATGGTGGAAGG - Intergenic
1124347619 15:28933004-28933026 CTGCGTCCTAACATGGTGGAAGG + Intronic
1124361207 15:29037789-29037811 CTGCCTCATAACATGGTGGAAGG + Intronic
1124608632 15:31192588-31192610 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1126380234 15:48038967-48038989 CTTCCTCACAACATGGCAGCTGG + Intergenic
1126411043 15:48373480-48373502 CTTCATCACAAAATGGTGGTGGG - Intergenic
1126468630 15:48983605-48983627 TTTCCTCCCATCATGTGGGCAGG - Intergenic
1126782849 15:52153219-52153241 CCTGCTCACAACATGGTAGCTGG - Intronic
1126913219 15:53436884-53436906 CTTCTTCACAACATGATGGCAGG + Intergenic
1127214416 15:56809615-56809637 CTTCCTCATAGCATGGCGGCTGG + Intronic
1127582887 15:60353783-60353805 CGTCCTCACAACATGGCAGCCGG - Intronic
1127787991 15:62373039-62373061 CATCCTCACAACATGGCAGCTGG - Intergenic
1128144178 15:65323226-65323248 CTTCCTCACAGCATAGTGGCTGG - Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129898277 15:79124653-79124675 CTTCCTCACAGTATGGTGGCTGG - Intergenic
1130150705 15:81309382-81309404 CCTCCTCACAACATGGTGTCTGG + Exonic
1130177764 15:81592882-81592904 CTGCATCCCCACATGGTGGAAGG - Intergenic
1130181980 15:81639050-81639072 CTACCTCTCACCATGGTGGCTGG + Intergenic
1130273018 15:82462162-82462184 CTGACGCACAACATGGTGGCTGG + Intergenic
1130465368 15:84189521-84189543 CTGACGCACAACATGGTGGCTGG + Intergenic
1130487321 15:84405287-84405309 CTGACGCACAACATGGTGGCTGG - Intergenic
1130498897 15:84484015-84484037 CTGACGCACAACATGGTGGCTGG - Intergenic
1130587659 15:85194128-85194150 CTGACGCACAACATGGTGGCTGG + Intergenic
1131178362 15:90224038-90224060 CTTGCTCCCAGCATGGTGTGGGG - Intronic
1131231099 15:90660220-90660242 TATCTTCACAACATGGTGGCTGG - Intergenic
1131342107 15:91612014-91612036 CTTTCTCACAACGTGGTGGCTGG - Intergenic
1131412693 15:92223695-92223717 CATCCTCACAGCATGGTGTCTGG + Intergenic
1131473647 15:92717528-92717550 CTTCCTCACAGCATGGCAGCTGG - Intronic
1131487539 15:92834089-92834111 CTTCCTCACAACATGGTCCCTGG - Intergenic
1132405403 15:101539144-101539166 CTTCCTCACAACATGGTGGCTGG - Intergenic
1133439178 16:5806339-5806361 CTGCATCCCCACATGGTGGATGG + Intergenic
1133455559 16:5939513-5939535 CATCCTCACAACATGGCTGCTGG + Intergenic
1133741469 16:8654975-8654997 TTCCCTTCCCACATGGTGGCTGG - Intergenic
1133795439 16:9042632-9042654 CTTCCTCACAGCATGGCGGCTGG - Intergenic
1133817162 16:9206767-9206789 CTTCCTCACAGCATGATGGCTGG - Intergenic
1133926121 16:10194010-10194032 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1133944727 16:10338708-10338730 CTTCCTCACAGCATGGTGGCTGG + Intronic
1134021655 16:10925196-10925218 CTTCCTCATAGTATGGTGGCTGG + Exonic
1134358118 16:13503515-13503537 CTTCCTCCCAGCATGGCAGCTGG + Intergenic
1134763482 16:16734756-16734778 CTTCCTCACTACATGGTGGCTGG + Intergenic
1134763699 16:16737051-16737073 CTTCCTCACAACATAGTAGCTGG + Intergenic
1134842458 16:17412705-17412727 CTGCCTTCCAAGATGGTGGATGG - Intronic
1134982355 16:18622106-18622128 CTTCCTCACAACATAGTAGCTGG - Intergenic
1134982570 16:18624401-18624423 CTTCCTCACTACATGGTGGCTGG - Intergenic
1135195944 16:20394762-20394784 CTCCCTCCCACCTTGCTGGCTGG + Intronic
1135654598 16:24236764-24236786 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1136104584 16:28020760-28020782 CGTCCTCACAACATGGCAGCTGG - Intronic
1136606455 16:31337482-31337504 ATTCCTTCCCACCTGGTGGCAGG + Intergenic
1137241542 16:46659062-46659084 TGTCCTCACAGCATGGTGGCTGG - Exonic
1137337012 16:47559638-47559660 CTTCCTAACAGCATGGTGGCTGG + Intronic
1137462495 16:48678139-48678161 TGTCCTCATAACATGGTGGCTGG - Intergenic
1137604534 16:49778688-49778710 CTTTCTCCCCACATCGTGACTGG - Intronic
1137648135 16:50093772-50093794 CTTCCTCATAACAGGATGGCTGG + Intronic
1138155740 16:54701441-54701463 CTTCCTCACAACATGGTGGCTGG - Intergenic
1138206261 16:55127352-55127374 CATCCTCACTGCATGGTGGCTGG + Intergenic
1138233023 16:55353657-55353679 CTTTCTCCTCACATGGTGGATGG - Intergenic
1139014808 16:62677298-62677320 TTTCTTCCTAACTTGGTGGCTGG - Intergenic
1140322150 16:73963340-73963362 CTTCCTCCCAAGATGGCGGCTGG - Intergenic
1140767704 16:78175530-78175552 TTTCCTCACAACATGGTGGCTGG - Intronic
1140831633 16:78756946-78756968 TATCCTCCCAACATGGCAGCTGG - Intronic
1140837253 16:78806607-78806629 CTTCCTCACAATATGGCGGCTGG + Intronic
1141010731 16:80395949-80395971 CTTCCTCACAACATGGTGGCTGG + Intergenic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141475556 16:84270767-84270789 CTTCCTCACAGCATGGCGGCCGG + Intergenic
1141638278 16:85327131-85327153 CTTCCTCACAACATGGTGGCAGG + Intergenic
1141651120 16:85393794-85393816 CTGCCCCCCAGCCTGGTGGCTGG + Intergenic
1141713187 16:85712075-85712097 CATCCTCGTAACATGGTGGCTGG - Intronic
1141903686 16:87008825-87008847 CTTCCTCACATCATGGCTGCTGG - Intergenic
1142109612 16:88324166-88324188 CTTCCTCACAGCATGAGGGCTGG + Intergenic
1143093709 17:4465251-4465273 CTTCCTCACAGCATGGTGGCCGG + Intronic
1143501923 17:7344153-7344175 CGTCATCCCAACATGTTGGGAGG + Intronic
1143624298 17:8100246-8100268 CTTCCTCATAGCACGGTGGCTGG - Intronic
1143967737 17:10768817-10768839 CTTCCTTCCAACATGGTGGCTGG - Intergenic
1144193083 17:12864003-12864025 CTTCCTCACAGTATGGTGGTGGG + Intronic
1144396138 17:14844965-14844987 CTTCCTCACAGCGTGGTAGCTGG + Intergenic
1144549373 17:16226381-16226403 CTTCCTCACAACCTGGTGGCTGG + Intronic
1144613011 17:16741434-16741456 CTTCCTCACAGCATGGGGGCTGG + Intronic
1144622028 17:16823907-16823929 ATTCCTCCCAACATGCCTGCTGG - Intergenic
1144871078 17:18371473-18371495 CCTCCTCACAGGATGGTGGCAGG - Intergenic
1144884396 17:18448807-18448829 ATTCCTCCCAACATGCCTGCTGG + Intergenic
1144887435 17:18472842-18472864 CTTCCCCACAATATGGTGGCTGG - Intergenic
1144899789 17:18574288-18574310 CTTCCTCACAGCATGGGGGCTGG - Intergenic
1145132672 17:20371511-20371533 CTTCCTCACAACATGGGGGCTGG + Intergenic
1145144781 17:20471452-20471474 CTTCCCCACAATATGGTGGCTGG + Intergenic
1145147835 17:20495570-20495592 ATTCCTCCCAACATGCCTGCCGG - Intergenic
1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG + Exonic
1146354146 17:32119930-32119952 CTTCCCCACAATATGGTGGCTGG - Intergenic
1146686234 17:34843329-34843351 TGTCCTCACAACATGGCGGCTGG - Intergenic
1146797394 17:35792332-35792354 CTTCCTTATAACATGGTGTCTGG - Intronic
1147017331 17:37502760-37502782 CTTCCTCACAGCATGGCAGCTGG + Intronic
1148181051 17:45605137-45605159 TTGCCTCCCAACATGCTGGGAGG + Intergenic
1149400039 17:56286587-56286609 CTTCCTTACAACATGGCGGCAGG + Intronic
1149438663 17:56656211-56656233 CTTCCTCACATCATGGTGCCTGG + Intergenic
1149441029 17:56673982-56674004 CCTCCTCACCACATGGTGACTGG + Intergenic
1149637123 17:58179966-58179988 CTGTCACCAAACATGGTGGCAGG + Intergenic
1150469812 17:65427355-65427377 CTTCCTTACAGCATGGTGGCTGG + Intergenic
1151143556 17:72017957-72017979 CTACCTCCCAACTTGGGGTCAGG + Intergenic
1151170784 17:72244194-72244216 CTTCCTTACAACATGGCAGCTGG - Intergenic
1151339383 17:73460192-73460214 CTTCCTCACAACATGGTGACTGG - Intronic
1151432675 17:74074726-74074748 GTTCCTCACAACATGGCAGCTGG - Intergenic
1151512747 17:74571197-74571219 GGTCTTCCCAACATGGGGGCTGG + Intergenic
1151891618 17:76954221-76954243 CTTCCGTGCAGCATGGTGGCTGG + Intergenic
1152017051 17:77757629-77757651 GTTCCTCCCAACATAAAGGCAGG + Intergenic
1152201678 17:78950887-78950909 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1153747780 18:8198174-8198196 CTTACTCCCATCATCCTGGCTGG + Intronic
1153825614 18:8871516-8871538 CTTCCTCCCAGCAGGATGACTGG - Intergenic
1155149425 18:23111265-23111287 CTTCCTCACAATATGGTGGCTGG - Intergenic
1156218508 18:35027383-35027405 GCTCCTCACAGCATGGTGGCTGG - Intronic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1157415592 18:47499989-47500011 CTTCCTTACAACATAGTGGTTGG + Intergenic
1157547818 18:48559722-48559744 CTTCCTCAAAGCATGGTGGCTGG + Intronic
1157751902 18:50186641-50186663 CTGCCACCCAGCATGGTGACTGG + Intronic
1157777782 18:50409563-50409585 CTTTCTCACAACGTGGTGGCAGG - Intergenic
1158406328 18:57163038-57163060 CTTCCTCACAGCATGGTTGCTGG - Intergenic
1159584269 18:70268361-70268383 TTTCCTCACAAGATGGTGACTGG + Intergenic
1160245939 18:77159468-77159490 CTGCATCCCCACATGGTGGAAGG - Intergenic
1161254932 19:3303007-3303029 CATCCTTACAACATGGTGGCTGG + Intergenic
1161291728 19:3497364-3497386 CATCCTCACAACATGGTCACTGG - Intronic
1161529764 19:4781037-4781059 CTTCCTCACAAGATGGCTGCTGG - Intergenic
1161860555 19:6795010-6795032 CTTCCCCACAACATGGCGACCGG + Intronic
1161874443 19:6896870-6896892 TTTCCTCACAATATGGTGGCTGG + Intronic
1161874579 19:6898036-6898058 TTTCCTCACAATATGGTGGCTGG + Intronic
1163151302 19:15416409-15416431 TATCCTCACAACATGGTGGCTGG - Intronic
1164870934 19:31642140-31642162 CCTCCTCACAACATGGCAGCTGG - Intergenic
1164957666 19:32401002-32401024 TGTCCTCACTACATGGTGGCTGG + Intergenic
1165301505 19:34972589-34972611 CTTCCTCACAGCATGGAGACTGG + Intergenic
1165551964 19:36594458-36594480 ATTCCTCACAGCATGATGGCTGG - Intronic
1165558671 19:36659109-36659131 CTTCCTAGGAACATGGTGGCTGG - Intronic
1166305278 19:41934033-41934055 CTTCCTCCCCACTTCCTGGCAGG - Intergenic
1166972801 19:46581500-46581522 CTTCCTCACAACATGGTGGCTGG + Intronic
1167170366 19:47827001-47827023 CATCCTCACAACATGGCGGCTGG + Intronic
1168520601 19:57047412-57047434 CATCCTCACATCATGGTAGCCGG - Intergenic
924972229 2:139090-139112 CTTCATCCTCACATGGTGGTAGG - Intergenic
925031815 2:655720-655742 CTGCCTCACAACAAGGTGGCTGG - Intergenic
925752224 2:7099038-7099060 CTTGATCCCAACCTAGTGGCTGG - Intergenic
926009186 2:9395003-9395025 CTTCCTCATATCACGGTGGCTGG + Intronic
926733123 2:16052096-16052118 CTTCCTCACAGCATGGTGGCTGG + Intergenic
926829946 2:16950748-16950770 CTTCTGCCCAACATAGTGGGGGG + Intergenic
927037790 2:19198515-19198537 CTTCTTCCCAGCATGGTGGCTGG - Intergenic
927137875 2:20110594-20110616 CTTCCTCACAGCATGGTGGCTGG + Intergenic
928036709 2:27830929-27830951 CTTCCTCATAATATGGTAGCTGG - Intronic
928272480 2:29868915-29868937 CTTCATCACAACATGGTGGCAGG - Intronic
929027468 2:37618413-37618435 CTTCCTCACAACATGGCAGCTGG + Intergenic
929147661 2:38720817-38720839 CTTCCTTACAGTATGGTGGCAGG + Intronic
929270668 2:39968001-39968023 CTTCCTCACAGCATGGGGGTTGG - Intergenic
929648966 2:43658677-43658699 GGTTCTCACAACATGGTGGCTGG + Intronic
929790635 2:45020116-45020138 CTTCCTTACAGCATGGTGGCTGG - Intergenic
929804216 2:45130456-45130478 CTTTCTCACAACACTGTGGCTGG + Intergenic
930002844 2:46872859-46872881 CTGCATCACAACATGGTGGAAGG + Intergenic
930100464 2:47599197-47599219 CTTCTTACCATCATGGAGGCTGG - Intergenic
930102050 2:47610870-47610892 CTTCCTCACACCATGGTGGCTGG + Intergenic
930978464 2:57493267-57493289 CTTCCTCCACAAAGGGTGGCCGG + Intergenic
931229467 2:60362116-60362138 CTTCCACCCAATATGGTAGTTGG + Intergenic
931384645 2:61787188-61787210 CATCCTCACAACATGGCAGCTGG - Intergenic
931390155 2:61834714-61834736 CGGCCTCCCAAAATGCTGGCTGG + Intronic
931728069 2:65130093-65130115 CTTCCACCCAAAATGGCCGCCGG + Exonic
931969620 2:67571422-67571444 CTTCCTGACTACATGGAGGCTGG - Intergenic
932003796 2:67907926-67907948 CTTCCTCCCTGCATTGTGTCTGG + Intergenic
932627089 2:73306175-73306197 CTTCCTCACAACATAGTTGCTGG + Intergenic
932697807 2:73971161-73971183 CTTCCTTCCTGCCTGGTGGCTGG + Intergenic
932707765 2:74039827-74039849 CTTCCTCACAGCATGGTGACTGG + Intronic
933769885 2:85736738-85736760 CTTCCTCATGGCATGGTGGCTGG - Intergenic
934063461 2:88318525-88318547 CTTCCTTCCAAAATGGTGGCTGG + Intergenic
934874710 2:97906595-97906617 CTTCCTCCTAGTATGATGGCTGG - Intronic
935431724 2:102983245-102983267 CTTCCTGACAGCATGGTGGTGGG - Intergenic
935529740 2:104217943-104217965 CTTCTGCACAATATGGTGGCTGG - Intergenic
935813596 2:106825268-106825290 CATCCTCACAACATGGCAGCTGG - Intronic
935920302 2:108005720-108005742 CTGCCTCCTCACATGGTGGAAGG + Intronic
936019628 2:108984808-108984830 CTACATCCCAGCATGGTGCCTGG + Intronic
936119368 2:109728090-109728112 CTTCCTCACAGCATGGTGGCTGG - Intergenic
936519164 2:113201101-113201123 CCTCCTCCCAACCTGGAGCCAGG + Intronic
936907457 2:117553611-117553633 CATCCTCCCAACATGGACCCAGG - Intergenic
937885012 2:126893707-126893729 GCTTCTCCCAGCATGGTGGCTGG + Intergenic
938790242 2:134669909-134669931 CTTCTTCCTCACATGGTGCCTGG - Intronic
939037933 2:137155483-137155505 CTTACTACAAACATCGTGGCTGG + Intronic
939927939 2:148197204-148197226 CTTCCTCACAATATGGGGACTGG - Intronic
940197238 2:151108500-151108522 CTTCCTTGCAACATGGAGGCTGG + Intergenic
940361663 2:152802729-152802751 CTTCCTCCAACCATGTTGGAAGG - Intergenic
940771940 2:157848333-157848355 CTTCCTCATAGCATGGCGGCTGG - Intronic
940881554 2:158952067-158952089 TTTCCTTTCAACATGGTGGCTGG + Intergenic
940919587 2:159292284-159292306 CTTCCTCACTGCACGGTGGCTGG - Intergenic
941673148 2:168316717-168316739 CTGCCTCATAACATGGTGGAAGG + Intergenic
941684560 2:168435181-168435203 CTTCCTCACACCATAGTGACTGG + Intergenic
941906248 2:170717509-170717531 CTGCCTCCCAAAATGGAGCCAGG + Exonic
942212102 2:173681503-173681525 CTTCCTCACAACATGGTGTCTGG + Intergenic
942762622 2:179417488-179417510 CTTCCTTATAGCATGGTGGCAGG - Intergenic
943724921 2:191243816-191243838 CTTCCTCACAATATGGCAGCTGG + Intergenic
944186857 2:196958608-196958630 CATCTTCCTCACATGGTGGCAGG + Intergenic
944304142 2:198159138-198159160 CTTCTTCACAACATAGTGGTTGG + Intronic
944923520 2:204439290-204439312 CTGCCTCCCAGCATGGTGGTTGG + Intergenic
945066467 2:205951606-205951628 CTTCCTCACAGCATGGCAGCTGG - Intergenic
945816781 2:214614368-214614390 CTTCCCCTCAGCATGGTGGCTGG + Intergenic
946040394 2:216778224-216778246 CTTCCCCGTAACATGGAGGCTGG + Intergenic
946184891 2:217975078-217975100 TGTCCTTACAACATGGTGGCTGG - Intronic
946670011 2:222092447-222092469 CTTCCTCACAGCATGGTGGCTGG - Intergenic
947102001 2:226630923-226630945 GTCCCTCCCAAAATGGTGGATGG - Intergenic
947528223 2:230892489-230892511 CTTCCCCACAACATGGAGACTGG + Intergenic
947722953 2:232380406-232380428 CTCCCTCCCCACAGGGTGCCCGG + Exonic
948182166 2:235990559-235990581 CTTCCTTCCAACATGGTGGCTGG + Intronic
948290656 2:236821883-236821905 CATCCTCACAACATGGCGGCTGG - Intergenic
948579936 2:238979923-238979945 CTTCCTCTCAGCGTAGTGGCTGG + Intergenic
948665880 2:239534715-239534737 CTCCCTTCCAACATGGCAGCTGG - Intergenic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
1168743535 20:215835-215857 CTTCCTTCTAACATGGTGGCTGG - Intergenic
1168810731 20:702932-702954 CTTCCTCCTAGCATGCAGGCTGG - Intergenic
1169034573 20:2439011-2439033 CTTCCTCACAACATGGTAGCTGG + Intergenic
1169046234 20:2536524-2536546 TTTCCTGCCCTCATGGTGGCTGG - Intergenic
1169265313 20:4163798-4163820 TGTCCTCCCCACATGGTGACTGG + Intronic
1169432364 20:5549392-5549414 CTTCCTCCAAACATCGTGATTGG + Intronic
1169507796 20:6231909-6231931 CTTCCTGAAAGCATGGTGGCTGG - Intergenic
1169836920 20:9890636-9890658 CATCCTCACAACATGGTAGCTGG - Intergenic
1169846612 20:9999984-10000006 CTTGTTCCCAAGATGCTGGCAGG - Intronic
1169917581 20:10698847-10698869 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1170130829 20:13017941-13017963 CTTCCTTAAAGCATGGTGGCTGG - Intronic
1170284849 20:14695590-14695612 TTCCCTCACAACATGGTAGCTGG - Intronic
1170408892 20:16067378-16067400 CTTCCTCCCAATATGGTGGCTGG - Intergenic
1170417888 20:16163995-16164017 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1170705271 20:18738738-18738760 CTTCCTCCCTCCCTGCTGGCAGG - Intronic
1170826482 20:19800551-19800573 CTTCCCAGAAACATGGTGGCTGG - Intergenic
1170877305 20:20262356-20262378 CTTCCTCATAACGTGGTGGCTGG - Intronic
1171022657 20:21600778-21600800 CTTCCTCACAATATGGTGGCTGG - Intergenic
1171040620 20:21759106-21759128 CCTCCTCACAACATGGCAGCTGG - Intergenic
1171209980 20:23309497-23309519 CTTCTTTATAACATGGTGGCCGG - Intergenic
1171311515 20:24148883-24148905 CTTCCTCACAGCATGGCAGCTGG + Intergenic
1171365539 20:24620504-24620526 CTTCCTCACAACACGGCAGCTGG + Intronic
1171406900 20:24917847-24917869 CTTCCTCACAGCCTGGTGGCCGG - Intergenic
1171502784 20:25606794-25606816 TTTCCTCTCAACATGGTGGCTGG - Intergenic
1172159244 20:32854059-32854081 CTTCCTCCCCAAATGCTGGGAGG + Intergenic
1172179220 20:32990603-32990625 CTTCCTCTCAACATGGCAGCTGG - Intronic
1172200179 20:33120362-33120384 TTTCCTCCTATTATGGTGGCTGG + Intergenic
1172315207 20:33948677-33948699 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1172361797 20:34317830-34317852 CTTCCACACAGCATGGTAGCTGG + Intergenic
1172786144 20:37470030-37470052 GTTACTCTCCACATGGTGGCCGG + Intergenic
1172880807 20:38198855-38198877 CTTCCCCACAGCATGGTGGCTGG + Intergenic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1172936504 20:38624277-38624299 CTTCCTCACAGCATGGCGGCTGG + Intronic
1172946833 20:38696066-38696088 TGTCCTCACAACATGGTGACTGG + Intergenic
1172959713 20:38790109-38790131 CTTCCTCACAGCATGGCAGCTGG - Intergenic
1173012787 20:39197459-39197481 CTTCCTCACAAAATGGTGGGGGG - Intergenic
1173185131 20:40834611-40834633 CTTCCTCACAGCATGGTGGTTGG - Intergenic
1173386177 20:42590103-42590125 CTTCCTCCCAGCATAGTGGCTGG - Intronic
1173538066 20:43830936-43830958 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1174544963 20:51318371-51318393 TTTCCTCACAGCACGGTGGCTGG - Intergenic
1174696781 20:52567771-52567793 CTTCCTTACAACATGATGGTTGG + Intergenic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1175801328 20:61802700-61802722 CTGCCTCCCAGCCTGGGGGCCGG + Intronic
1176023685 20:62975225-62975247 CTTCCTCACAGCATGGTGGCCGG - Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176082952 20:63283115-63283137 CCTGCTCCCAACAAGGTGGCCGG - Intronic
1176106406 20:63391644-63391666 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1176209855 20:63914013-63914035 GGTCCCCCCAAGATGGTGGCTGG - Intronic
1176407795 21:6430869-6430891 CTTCCTTCCAACATGGCACCCGG - Intergenic
1176943284 21:14949863-14949885 CTTCCTCACAACACAGTGGCTGG + Intergenic
1177805660 21:25872351-25872373 CTTTCTCAGAGCATGGTGGCTGG - Intergenic
1178432635 21:32529927-32529949 CCTCCACCCAGCATGGTGTCTGG - Intergenic
1178638256 21:34324074-34324096 CTTCCTCACAACATGGTGGTTGG - Intergenic
1178814808 21:35919428-35919450 CTTCCTCTCAACATGGTGGCTGG + Intronic
1178901317 21:36601240-36601262 CTTCCTCCCAACAGCACGGCTGG + Intergenic
1179257805 21:39731990-39732012 CTTCCTCACAGCATGGCTGCTGG - Intergenic
1179293661 21:40042026-40042048 CTTCCTCACAGCATGGTGGCTGG - Intronic
1179683286 21:43039200-43039222 CTTCCTTCCAACATGGCACCCGG - Intergenic
1179717247 21:43295758-43295780 CTTCCTCACAACATGGCGGCTGG + Intergenic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179837183 21:44043823-44043845 CTTCCCCACAGCATGGTGGCTGG - Intronic
1180235305 21:46455737-46455759 CTTTCTCACAATATGATGGCTGG - Intergenic
1180834015 22:18920839-18920861 CTTTTTCCCAACATGGCAGCTGG - Intronic
1181065803 22:20305400-20305422 CTTTTTCCCAACATGGCAGCTGG + Intergenic
1181086121 22:20440185-20440207 CGTCCTGACAACATGCTGGCTGG - Intronic
1181475559 22:23165820-23165842 CTTCCTCACAGTGTGGTGGCTGG + Intergenic
1181768440 22:25109007-25109029 CATCCTCACAACATGGCGGCTGG + Intronic
1181969946 22:26682284-26682306 CTTCCTCACACCATGGTGGCTGG - Intergenic
1182009473 22:26988522-26988544 TTTCCTCCTAACAGTGTGGCAGG + Intergenic
1182021855 22:27088356-27088378 CTTCCTCACAACATGGCAGTTGG + Intergenic
1182061708 22:27403079-27403101 CTTCCTCACAACATGGCAGCTGG - Intergenic
1182673442 22:32017395-32017417 CTTCTTCCCAACCTGTTGACTGG + Intergenic
1182985288 22:34710538-34710560 CTTCCTCAGAGCATGGTGGCTGG - Intergenic
1183395748 22:37569754-37569776 CAGCCTCCCAACATGGCAGCCGG + Intergenic
1183797862 22:40135121-40135143 GTTTCTCACAGCATGGTGGCAGG + Intronic
1184420354 22:44378549-44378571 CTTCCTCACAACATGGCTGCTGG - Intergenic
1184715481 22:46279547-46279569 CTGCCTCCCAACATCCTGGCTGG + Intronic
1185158015 22:49205764-49205786 CTTCCTCCCAGCCTGGAGGATGG - Intergenic
1203284103 22_KI270734v1_random:146137-146159 CTTTTTCCCAACATGGCAGCTGG - Intergenic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
949918111 3:8980804-8980826 CTTCCTCCCCAAATTGTGACAGG - Exonic
950291372 3:11787113-11787135 CACCCTCACAACATGGCGGCTGG + Intergenic
950386118 3:12662073-12662095 CTCCCTCCCAACGTGCTTGCTGG - Intronic
950445623 3:13035885-13035907 CGTCCTCAAAACATGGCGGCTGG - Intronic
950472649 3:13196138-13196160 CTTCCTCACAGCATGGTGGCTGG - Intergenic
950643827 3:14365341-14365363 CTTCCTCACAACATGGTGGCTGG + Intergenic
950703206 3:14764737-14764759 CTTCCTCACAACATGGTGGCTGG + Intronic
950721458 3:14885660-14885682 CTTCTGCACAGCATGGTGGCTGG + Intronic
950901205 3:16499404-16499426 CTTCCTCATGGCATGGTGGCTGG - Intronic
951110490 3:18798091-18798113 CTTCCTTGCAACATGGTGGATGG + Intergenic
951334534 3:21405747-21405769 CCTCCTCCCCACCTCGTGGCTGG + Intergenic
951483948 3:23191480-23191502 CTTCCACCCAGCATAGTGGTTGG - Intergenic
951774801 3:26297905-26297927 CATCCTAACAACATGGTGGCTGG - Intergenic
951919109 3:27834042-27834064 CTTCCTCACAGCATGGTGGCTGG + Intergenic
952116562 3:30188825-30188847 CTTTCTCCTAGCATGGTGGCTGG - Intergenic
952129910 3:30349694-30349716 CTTCCTCTAATCAGGGTGGCAGG - Intergenic
952501087 3:33962613-33962635 CTTCCTCCAAGCATGGTAGCTGG + Intergenic
952865242 3:37850856-37850878 CTTCCTCACAACATGGTGGCTGG - Intergenic
953007979 3:38995499-38995521 CTGCCTCCCAACATGGAGGAAGG - Intergenic
953035221 3:39205271-39205293 CTTCCTCACAGCATGGTGGCTGG - Intergenic
953686408 3:45081679-45081701 CTTCTTCACAACATGGTGGCTGG - Intergenic
953697341 3:45170310-45170332 CTTCTTCACAGCATGGTGGCTGG + Intergenic
953854533 3:46490931-46490953 CCTCCTCCCAACCCTGTGGCAGG - Intergenic
953980255 3:47410040-47410062 CTCCCCCCTGACATGGTGGCTGG + Exonic
954185668 3:48915427-48915449 CTTCCTGGTAACATGGTGGCTGG - Intergenic
954295460 3:49672373-49672395 TTTCCACCCAAATTGGTGGCTGG + Intergenic
956125201 3:66004434-66004456 CTTCCTCATAGCATGGTGGCTGG + Intronic
956209410 3:66787793-66787815 CTTCCTTACAACATGGTGGCTGG + Intergenic
956483886 3:69700852-69700874 CTTCCTTACAGCATGTTGGCTGG - Intergenic
956564298 3:70617821-70617843 CGAGCTCCCAAGATGGTGGCAGG - Intergenic
956723480 3:72138366-72138388 CTTCTGCACAGCATGGTGGCTGG - Intergenic
956749398 3:72334215-72334237 CTTCCTCACAGTATGGTGGCTGG - Intergenic
956764472 3:72472726-72472748 TGTCCTCCCAACATGGCAGCTGG + Intergenic
956767292 3:72494394-72494416 CTTCCTCACAACATGGCAGCTGG + Intergenic
956783537 3:72623644-72623666 CTTCCTTAAAATATGGTGGCTGG + Intergenic
956791307 3:72682198-72682220 CTTCCTCACAACATGGTGACTGG - Intergenic
956836211 3:73098200-73098222 CTTCCTCACAACATGGCAGCTGG - Intergenic
956844165 3:73167062-73167084 TGTCTTCACAACATGGTGGCTGG + Intergenic
957275843 3:78090524-78090546 CTTCCTCACAGCATGGCAGCTGG + Intergenic
957312537 3:78539509-78539531 TGTCCTCCCAACATGGTGGATGG + Intergenic
957380153 3:79417259-79417281 ATTTCTCACAATATGGTGGCTGG - Intronic
958151600 3:89700105-89700127 CATCCTTTTAACATGGTGGCAGG + Intergenic
958454732 3:94316230-94316252 CTTTCCCACAACATGGTGGCTGG + Intergenic
958850221 3:99316000-99316022 CTTCCTCACAGCGTGGTGGATGG - Intergenic
959089055 3:101882918-101882940 CTTCTTTACAGCATGGTGGCTGG - Intergenic
959691922 3:109207012-109207034 CTTCCTCACAGCATTGTGGATGG - Intergenic
960444738 3:117733956-117733978 CTTACTCCCAAGATGTTGACAGG + Intergenic
961033643 3:123627327-123627349 CCTCCTCCAGACAGGGTGGCAGG - Intronic
961064741 3:123865925-123865947 CTTCCTCACAGCATGGTGGCTGG - Intronic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
961318756 3:126058026-126058048 CTTCCTCACAGCAGAGTGGCTGG - Intronic
961363379 3:126382279-126382301 CTTCCTCACTACATGGAGGCTGG + Intergenic
961452743 3:127009691-127009713 CCCCCTCCCAGCATGGGGGCAGG - Intronic
961667565 3:128503274-128503296 CCTCCTGCCCACAAGGTGGCAGG - Intergenic
961735053 3:128996097-128996119 CTTCCTCACAACATGCTAGCTGG - Intronic
961951805 3:130757341-130757363 CTTCCTCACAACATTCTGGATGG + Intergenic
961986490 3:131140252-131140274 CTTCCTCACAACAGGGTAGTTGG - Intronic
962056039 3:131872745-131872767 CTTCCTCACAACATGGTGTTTGG - Intronic
962090679 3:132241217-132241239 CTTCCTCATAGCATGGTGGCTGG - Intronic
962196869 3:133371486-133371508 CTTCCTCGCAGCATGGCAGCTGG + Intronic
962255867 3:133869751-133869773 CTTCCTCACAGCATGGTTGCTGG - Intronic
962399909 3:135049508-135049530 CTCCCTCACAGCATGGTGGCTGG + Intronic
962625296 3:137220077-137220099 CTTCCTTACAACATGGTGGCTGG + Intergenic
962850609 3:139305964-139305986 CTTCCTCCCAGCATGGCATCTGG - Intronic
962903697 3:139782236-139782258 TTTCCTCCCACCATGATGACTGG + Intergenic
963304425 3:143635238-143635260 CTTCCTCACAGCAAGGTGGCTGG + Intronic
963465385 3:145674051-145674073 TGGCCTCCCAGCATGGTGGCTGG + Intergenic
963905205 3:150767865-150767887 GCTACTCCCAACATGGTAGCTGG - Intergenic
965628198 3:170703481-170703503 CTTCCTCACAGCATGGTGGCTGG + Intronic
965902057 3:173653868-173653890 CTTCCTAACAGCATGGTGTCTGG - Intronic
967044573 3:185724957-185724979 CTTCCTCACAGCATGGTGGCTGG - Intronic
967992915 3:195144874-195144896 CTTCCTGCCAAGATGTTGGCAGG - Intronic
968290222 3:197533294-197533316 CTTCCTCCCCACATGGATGGGGG + Intronic
968647550 4:1748151-1748173 CTTCCATCCAGCCTGGTGGCTGG - Intergenic
968676898 4:1887224-1887246 CTTCCTTGCAGCGTGGTGGCTGG + Intronic
969203983 4:5628378-5628400 CTTCATCATAACATGGTGGAAGG - Intronic
969328608 4:6459312-6459334 CTTCCTCACAATATGGTGGCTGG + Intronic
969589918 4:8115895-8115917 CTTCGTCCCAGCATGGCCGCCGG - Intronic
969790863 4:9493418-9493440 CTTACTCCCCGCATGGTGGGTGG - Intergenic
969958160 4:10912992-10913014 TTTCTTCCCAACTTGCTGGCTGG + Intergenic
969967157 4:11008794-11008816 CTTCCTCACAGCATGGCAGCGGG + Intergenic
970082466 4:12302889-12302911 CTTCCTCAGTACATGGTAGCTGG - Intergenic
970519418 4:16867094-16867116 CTTCCCCACAGCATGGAGGCTGG - Intronic
971755287 4:30699630-30699652 GCTACTCCCAACATGGTAGCTGG + Intergenic
972286506 4:37653802-37653824 CTTCCTCACAGCATGGTGGCTGG - Intronic
972306115 4:37831622-37831644 CTTCCTTATAACATGGTGGTTGG + Intronic
972554025 4:40162976-40162998 TGTCCTTACAACATGGTGGCTGG + Intergenic
973635643 4:52859916-52859938 CTCTCTCACAACATGGTGACGGG - Intergenic
973669959 4:53207013-53207035 CTGCATCATAACATGGTGGCAGG + Intronic
974125251 4:57688078-57688100 CTTCCCCACAGCATGGTGACTGG + Intergenic
974135364 4:57810046-57810068 TCTCCTCACAACATAGTGGCTGG - Intergenic
974392890 4:61295703-61295725 CTGCCTCCCAAAATGCTGGACGG - Intronic
974636551 4:64570847-64570869 GTTCCTGACAACATGGTGGCTGG + Intergenic
974771517 4:66420758-66420780 CTTCCTCACAATATGGTAACTGG + Intergenic
975504715 4:75125151-75125173 CTTCCTCCTAGCATGGAGACTGG - Intergenic
976598997 4:86920621-86920643 CTGCATCACAACATGGTGGAAGG + Intronic
976864010 4:89702366-89702388 CTTCCTCACAACATGGTGGCTGG + Intergenic
977195478 4:94053654-94053676 CTTCCTCCCAGCACTTTGGCAGG - Intergenic
977664896 4:99634996-99635018 CTTCCTCAGAATATGATGGCTGG - Intergenic
977864212 4:102003516-102003538 CTACCTCACAGCATGGTGGCTGG + Intronic
980189162 4:129501354-129501376 GTTCCTCACAGCATGGTGCCTGG + Intergenic
980523703 4:133962006-133962028 ATTGCTCCCAAGATGGTGGCAGG - Intergenic
980888465 4:138788537-138788559 TTTCCTCACAGCATGGTGACTGG + Intergenic
981667790 4:147249373-147249395 CTTCATCATAACATGGTGGAAGG - Intergenic
981688305 4:147479973-147479995 CTTCCTCACAGCATGGTGGCGGG - Intergenic
981850552 4:149224668-149224690 CTTTCTCACAACATGGTGCAGGG - Intergenic
982670868 4:158318878-158318900 CTTCCTCTGAGCATAGTGGCTGG + Intronic
983669688 4:170221714-170221736 CTGCCTCCACACATGGTGGAAGG - Intergenic
985877375 5:2610183-2610205 CATCCTCCTGACATGGCGGCTGG + Intergenic
986123062 5:4860325-4860347 CTTCCTCCCAGGATCCTGGCAGG - Intergenic
986247411 5:6022823-6022845 CTTCCTCACAGCATGGCAGCTGG - Intergenic
986296423 5:6443153-6443175 CTTCCTCTCACCATGGCGTCTGG + Intergenic
986296632 5:6444724-6444746 CTTCCTCTCAACATGGTGTCTGG + Intergenic
986492555 5:8307490-8307512 AGTGCTCCCAAGATGGTGGCAGG + Intergenic
986667905 5:10119082-10119104 CTTCCTCACAACATGGCTGCTGG + Intergenic
987265114 5:16245376-16245398 CATCCTCACAGCATGGTGGCTGG - Intergenic
988650293 5:33141554-33141576 CTGCCTCATAACATGGTGGATGG - Intergenic
988663769 5:33302349-33302371 CTTCCTCACAGCATGGCAGCTGG + Intergenic
988784403 5:34552810-34552832 CTTCTCCCCAAAATGGAGGCCGG + Intergenic
988803570 5:34719265-34719287 CTTTCTCACAGCATGGTGGCTGG + Intronic
990215841 5:53530908-53530930 CTTCATCCCCAAATGGAGGCAGG - Intergenic
990314835 5:54574261-54574283 CTTCCTCACAGCATAGTGGCTGG + Intergenic
990335902 5:54772564-54772586 CTTCCTCAGAACATGGAGGCTGG + Intergenic
990866867 5:60389719-60389741 CTTCTTCACAACATGTTGGCTGG + Intronic
991435358 5:66592750-66592772 CTTCCTCCCAACCTGATGTTTGG + Intergenic
991454561 5:66788678-66788700 CTTCTTCCAAACCCGGTGGCGGG + Exonic
991948768 5:71927456-71927478 CTTCCTCACAGCATGGAGGCAGG - Intergenic
991994574 5:72374646-72374668 TGTCCTCACAACATGGTGTCTGG - Intergenic
992034700 5:72761245-72761267 TGTCCTCTCAACATGGTGTCTGG - Intergenic
992057826 5:73009788-73009810 CGGCCTCCCAAAATGCTGGCTGG + Intronic
992084250 5:73263835-73263857 CTTCATCCCATCATGGAGCCTGG + Intergenic
993303340 5:86242117-86242139 ATTTAGCCCAACATGGTGGCAGG - Intergenic
993647381 5:90477155-90477177 CTTCCACCCTACATGGAGGTAGG - Intronic
993775849 5:91994572-91994594 CTGCGTCCTTACATGGTGGCAGG + Intergenic
994488264 5:100407258-100407280 CTCCCTCACAGTATGGTGGCTGG - Intergenic
995551875 5:113289600-113289622 CTTCCTCTCAGCATGGCAGCTGG - Intronic
996643864 5:125792014-125792036 TTTGTTCCCAACATGGTGGTGGG + Intergenic
997526891 5:134559489-134559511 CTTCCTGCCATCAGGGTAGCGGG - Intronic
998424734 5:142016824-142016846 CTTCCTCACAACATAGCGGTGGG + Intergenic
999623115 5:153491770-153491792 CATCCTCTCAACTTGGAGGCAGG + Intronic
999630377 5:153564634-153564656 CTTCCTCACAACATGGTGACTGG + Intronic
999646242 5:153719556-153719578 CTTCCTCACAGCACGATGGCTGG + Intronic
999706334 5:154275729-154275751 CTTCTTCATAGCATGGTGGCTGG + Intronic
999897848 5:156053885-156053907 CTTTGTCCCCACATGGTGGAAGG + Intronic
1000242975 5:159425783-159425805 CCTCGTCACAGCATGGTGGCTGG + Intergenic
1000369049 5:160517477-160517499 CTTCCTCACAACATGGTGGTTGG + Intergenic
1000849571 5:166323326-166323348 CTTCCTCCTAAGACTGTGGCTGG - Intergenic
1001676913 5:173526287-173526309 TGTTCTCACAACATGGTGGCTGG - Intergenic
1001827641 5:174758751-174758773 CATCCTCACAACATGGCAGCTGG - Intergenic
1002063435 5:176640168-176640190 CTTCTTCCCGGCGTGGTGGCTGG - Intronic
1003152609 6:3565230-3565252 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1003273261 6:4625599-4625621 CTGCCTCCCAGAATGGAGGCAGG + Intergenic
1003332584 6:5142266-5142288 CTTCCTCACAACATGGCGGCTGG - Intronic
1003714555 6:8632029-8632051 CTTCCTTTCAATATGGTGGCTGG - Intergenic
1004083403 6:12419228-12419250 CATCCTACCAACATGGCAGCTGG + Intergenic
1004918343 6:20353303-20353325 CTTCCTCACAACATGGCCGCTGG - Intergenic
1005256740 6:24011338-24011360 GTTCTTCCTCACATGGTGGCAGG - Intergenic
1005854789 6:29852707-29852729 TTTCCTCCTTGCATGGTGGCTGG - Intergenic
1006739401 6:36296679-36296701 CTTTCTCCCAACAAGGGGGGTGG + Intronic
1006917531 6:37604099-37604121 CTTCCTCACTGCATGGTGGTTGG + Intergenic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1006935543 6:37715064-37715086 CTTCCTCACAGCATGATGGATGG + Intergenic
1007106032 6:39283608-39283630 CTTCCTGACAACACGGCGGCTGG - Intergenic
1007364730 6:41383432-41383454 GCGCCTCCCCACATGGTGGCTGG + Intergenic
1007488550 6:42199626-42199648 CTTCCTCACAACATGGTGGCTGG - Intergenic
1007514989 6:42403972-42403994 CTAGCTCCCAACTTGGTGCCAGG + Intronic
1007990163 6:46246818-46246840 CTTCCTCCCCACCTGTTGGCTGG - Exonic
1008151270 6:47954920-47954942 CTTCCTCACAACATGGTGGCTGG - Intronic
1008269084 6:49468270-49468292 CTTCCTCCTATGGTGGTGGCTGG + Intronic
1008465459 6:51825427-51825449 CTTCCTCACAGCATGATGGCTGG - Intronic
1009366498 6:62861278-62861300 CTTACTCCCAATATGGTGGGAGG + Intergenic
1009447781 6:63763641-63763663 GTCCTTCCTAACATGGTGGCAGG - Intronic
1009572348 6:65402943-65402965 CTTCCTGAGAGCATGGTGGCTGG - Intronic
1010056507 6:71571423-71571445 ATTCCTCCCAACAGGGTGCAAGG + Intergenic
1010296779 6:74207710-74207732 ATTCCTCCCAGTCTGGTGGCAGG + Intergenic
1011547508 6:88497626-88497648 GTTCCTCTTCACATGGTGGCAGG - Intergenic
1011826202 6:91308602-91308624 CTTCCTTGCTGCATGGTGGCTGG - Intergenic
1011862829 6:91782140-91782162 CTTCCTGCCATCATGGCTGCAGG + Intergenic
1012120070 6:95355068-95355090 GTGGCTCCCAAGATGGTGGCGGG - Intergenic
1013787378 6:113796779-113796801 CATCCTTATAACATGGTGGCTGG + Intergenic
1013936883 6:115606941-115606963 CTACATCACAACATGGTGGAGGG + Intergenic
1014228639 6:118877056-118877078 CTTCTTTACAACATAGTGGCTGG - Intronic
1015285985 6:131487107-131487129 CTTCTTCCACTCATGGTGGCAGG + Intergenic
1015313091 6:131786409-131786431 CTTCCTCAAAACATGGTGCCTGG - Intergenic
1015365840 6:132397073-132397095 CTTTGTCACAGCATGGTGGCAGG - Intronic
1015589844 6:134812632-134812654 CTTCATCATAACATGGTGGGAGG - Intergenic
1016983395 6:149874927-149874949 CTGCATCCCCACATGGTGGAAGG + Intergenic
1017589423 6:155962402-155962424 CCTCCTTACAGCATGGTGGCTGG + Intergenic
1018427764 6:163698878-163698900 CTTCCTCCCAGCTCAGTGGCTGG - Intergenic
1018949391 6:168369279-168369301 CTTCTTCCCACCATGGTGTGGGG - Intergenic
1019347227 7:537137-537159 TGTCCTCACAACATGGCGGCTGG + Intergenic
1019369396 7:653041-653063 CTTCCCCACTGCATGGTGGCTGG + Intronic
1019426369 7:979021-979043 CTTCCCCACAGCATGGCGGCTGG + Intergenic
1019501274 7:1366055-1366077 CTTCCTCACAACATGGTGGCAGG + Intergenic
1019507875 7:1402287-1402309 CTTCCTACCAGCATGGCCGCTGG - Intergenic
1019556644 7:1634792-1634814 CTTCCTCACATCATGGCAGCTGG + Intergenic
1019804596 7:3114027-3114049 CATCCTCACAACATGGTGGCTGG - Intergenic
1019826659 7:3290110-3290132 CTTCCCCACAACATGGCAGCTGG - Intergenic
1021276492 7:18657996-18658018 CTTCCACACAAAATAGTGGCTGG - Intronic
1021409560 7:20314921-20314943 CTTTCTCACAGCATAGTGGCTGG - Intergenic
1021429786 7:20547255-20547277 TTTCCTCTTAAAATGGTGGCTGG + Intergenic
1021476620 7:21068807-21068829 CTTCCTCACAATATGGAAGCTGG + Intergenic
1022538083 7:31110489-31110511 CTGGATCCCACCATGGTGGCAGG - Exonic
1023173180 7:37409662-37409684 CTTCTTCACAGCATGGTGGCTGG + Intronic
1023329971 7:39104501-39104523 ATTCTTCACAATATGGTGGCTGG + Intronic
1023636177 7:42213079-42213101 TTCCCTCCCCACATGGTGACGGG - Intronic
1025220263 7:57102000-57102022 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025631042 7:63273582-63273604 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1025651419 7:63473011-63473033 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1025828614 7:65031252-65031274 CTTCCTCACAGCATGGTAGCTGG + Intergenic
1025916143 7:65867664-65867686 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1026178442 7:68018016-68018038 CTTCCTCCAAACATGGTGGCTGG + Intergenic
1026180021 7:68030737-68030759 CTTCCCCACAACATGGCGACTGG + Intergenic
1026490803 7:70861701-70861723 CTTCCTCACATCATGGCAGCTGG - Intergenic
1026490972 7:70863107-70863129 CTTCCTCACATCATGGCAGCTGG + Intergenic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1028210516 7:88068827-88068849 CTTCCTGACAGCATGGTGGCTGG + Intronic
1028400463 7:90419942-90419964 TGTCCTCACAACATTGTGGCCGG - Intronic
1029350776 7:100011372-100011394 CTTCCTCACAGGATGGTGGCTGG - Intergenic
1029812942 7:103067559-103067581 CTTCCTCACAGCGTGGAGGCTGG - Intronic
1029985763 7:104921910-104921932 CTTCCTCACAACATGGCAGCTGG + Intergenic
1032442339 7:131951576-131951598 CTTCCTCACAACATGGTGGCTGG - Intergenic
1032644182 7:133803155-133803177 CTGGCTGCCAACATGATGGCTGG + Intronic
1032706857 7:134427536-134427558 CTTCCTCAGAACATGGTGGCTGG - Intergenic
1032888982 7:136173045-136173067 CCTCCTCCTATCATGGTTGCTGG - Intergenic
1034927795 7:155136890-155136912 TGTCCTCCCAACATGGTGGCTGG - Intergenic
1035237230 7:157506407-157506429 CTGCCTCACAACACAGTGGCTGG + Intergenic
1035678750 8:1472213-1472235 TCCCCTCCCAACATGGCGGCAGG - Intergenic
1036222245 8:6930541-6930563 CTTCCTCAAAACACGGTGTCTGG - Intergenic
1036227651 8:6973335-6973357 CTTCCTCCAAGCATGGTATCCGG - Intergenic
1036229126 8:6984563-6984585 CTTCCTCCAAGCATTGTAGCTGG - Intergenic
1036230106 8:6992494-6992516 CTTCCTCCAAGCATGGTATCCGG - Intergenic
1036231579 8:7003668-7003690 CTTCCTCCAAGCATTGTAGCTGG - Intronic
1036232558 8:7011597-7011619 CTTCCTCCAAGCATGGTATCCGG - Intronic
1036234052 8:7022874-7022896 CTTCCTCCAAGCATGGTATCTGG - Intergenic
1036236601 8:7044351-7044373 CTTCCTCTAAGCATGGTGCCTGG - Intergenic
1036639433 8:10573068-10573090 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1036660972 8:10708403-10708425 CTTCCTCACAACATGGCAGTTGG + Intronic
1036781407 8:11650422-11650444 ATTCCTCACAGCCTGGTGGCTGG + Intergenic
1037947079 8:22996307-22996329 CTTCCTGGCAGCATGGAGGCAGG - Intronic
1039079809 8:33723046-33723068 CCTCCTCCCCACCTCGTGGCCGG - Intergenic
1039877995 8:41603761-41603783 CTTCCTTACAACATGGTAGCTGG - Intronic
1042307154 8:67343758-67343780 TTTCCTCCCAACATGGCGGCCGG - Intergenic
1042421223 8:68591106-68591128 CTCCCTTCCAAGATGGTGGCAGG - Intronic
1042857238 8:73279801-73279823 CTTCCTCACAAAATGGTGGCTGG - Intergenic
1042894368 8:73651023-73651045 CCTCCTCCCCACCTTGTGGCGGG + Intronic
1042904150 8:73756333-73756355 CCCCCTCACAGCATGGTGGCTGG + Intronic
1043283577 8:78501337-78501359 CACCCTCTCCACATGGTGGCAGG + Intergenic
1043549725 8:81356932-81356954 CTTCCTCACAGCATGGTGGCTGG - Intergenic
1044271085 8:90244799-90244821 CTTTCTCATAGCATGGTGGCTGG + Intergenic
1045193997 8:99911650-99911672 CTGCCTCACAACATGGTGGAAGG + Intergenic
1045320166 8:101076450-101076472 CTTCCTCACAACATGGCAGCTGG - Intergenic
1045526662 8:102946176-102946198 CTTCCTGCCACCATGGAAGCTGG - Intronic
1045724501 8:105156417-105156439 CTTCCTCACACTATGGTGGCTGG + Intronic
1045926390 8:107582085-107582107 ATTGCTCCCAATATGGTGGGAGG - Intergenic
1046758528 8:117996163-117996185 GTTCCTCCTCATATGGTGGCTGG - Intronic
1046802289 8:118441864-118441886 CTTCCTCACAACATGGTGGTTGG - Intronic
1047478105 8:125255087-125255109 CTTCATCACAGCATGGTAGCTGG - Intronic
1048495643 8:134933587-134933609 CTGCCTCATGACATGGTGGCTGG + Intergenic
1048649826 8:136463322-136463344 ATTCCTCACAATATGGAGGCTGG + Intergenic
1048895415 8:138988136-138988158 CTTCCTCACAGCCTGGTGGCTGG - Intergenic
1049546774 8:143235736-143235758 TTTCCTCACAACATGGCGGCCGG + Intergenic
1049586203 8:143433496-143433518 CTTCCTCACAGCATGGCTGCTGG + Intergenic
1050036403 9:1440373-1440395 CTCCATCACAACATGGGGGCTGG - Intergenic
1050593559 9:7183902-7183924 AGGGCTCCCAACATGGTGGCAGG - Intergenic
1052068052 9:24047217-24047239 CTTTCTCACAAAATGGTGGTTGG + Intergenic
1052268452 9:26601497-26601519 CTTCTTCAGAGCATGGTGGCTGG - Intergenic
1053215250 9:36265347-36265369 AGAGCTCCCAACATGGTGGCGGG - Intronic
1053272267 9:36758573-36758595 CTGTCTCCCTACATGGTGGAAGG - Intergenic
1054764442 9:69031784-69031806 TTTCCTCAAAACATGATGGCTGG + Intergenic
1054793344 9:69276224-69276246 CTTCCTCACAGCGCGGTGGCTGG + Intergenic
1055102915 9:72483449-72483471 CTTCCTCACATCATGGTGTCTGG + Intergenic
1056690303 9:88802704-88802726 CTTCCCCACAGCATGGTGACTGG - Intergenic
1056785358 9:89588843-89588865 CTTCCTCAGAACATGGCGACTGG + Intergenic
1056809192 9:89751077-89751099 CTTTCTCACAGCATGGTGGCTGG + Intergenic
1056946143 9:90998822-90998844 CTTCCTCACAATGAGGTGGCTGG + Intergenic
1056947570 9:91012980-91013002 CTTCCTCACAATATGGCAGCTGG - Intergenic
1057044138 9:91871772-91871794 CCTTCTCACAGCATGGTGGCTGG - Intronic
1057190718 9:93085856-93085878 CTTCCTCACAACATGGCAGCCGG + Intergenic
1057904626 9:98974466-98974488 CACCCTCCCAACTTGCTGGCAGG + Intronic
1058143222 9:101380512-101380534 CTTACTCACAGCATGGTGGCTGG + Intronic
1058183181 9:101822569-101822591 CTTCCTCACAGCATGGTGGCTGG + Intergenic
1059356136 9:113700989-113701011 CTTCCTCACAGCATGGTCTCTGG - Intergenic
1059887713 9:118765351-118765373 TTTCCTCACAACATTGTGGTAGG - Intergenic
1060247256 9:121957270-121957292 CTTCCTCCCATGGTGGTGGAGGG - Intronic
1060490525 9:124080830-124080852 CTTCCTCACAGCATGGTGGCGGG + Intergenic
1060496426 9:124122661-124122683 CTTCCTCACAGCATGGTATCTGG - Intergenic
1061346227 9:130027833-130027855 CTTCCTAACAATATGGTGACTGG + Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1062174256 9:135152279-135152301 CCTCCCCCCAACTTGGGGGCTGG + Intergenic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1185647470 X:1625345-1625367 CTGCCTGCCTACATGGTGGCAGG + Intronic
1186415307 X:9378392-9378414 CATCCTCACAACATGCTGTCTGG + Intergenic
1186543300 X:10422843-10422865 CTTCCTCACAGCATGGTGTCTGG + Intergenic
1186567693 X:10681519-10681541 CTCCCTCACAACATGCTGTCTGG + Intronic
1187075463 X:15930050-15930072 CTTCCTCAGAGCACGGTGGCTGG + Intergenic
1187077671 X:15951853-15951875 CTTCTTCACAGCATGGTGGCTGG - Intergenic
1187445810 X:19359942-19359964 TCTCCTCCCAAAAAGGTGGCTGG - Exonic
1187572813 X:20521898-20521920 TTTCCTCACAGCATGGTGGCTGG + Intergenic
1187741454 X:22360376-22360398 CTTCCTCTCAGCCTTGTGGCTGG + Intergenic
1189269498 X:39740888-39740910 CTTCCTCACAGCATGGCAGCAGG + Intergenic
1189281670 X:39823491-39823513 CTCCCTTACAACATGGTGGATGG - Intergenic
1189307010 X:39994527-39994549 CTTCCTACCAAGATGGAGGTGGG + Intergenic
1189345751 X:40240065-40240087 CTTCCTCATAGCATGGAGGCTGG + Intergenic
1189370934 X:40428644-40428666 CTTCCTCACAGCATGGTTGCTGG - Intergenic
1189928405 X:45982119-45982141 CTTCCTCATAGCATGGTGGCTGG - Intergenic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1194197864 X:90917736-90917758 CTTCCTCACCACATGGTGAGTGG - Intergenic
1195841426 X:109180214-109180236 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1196545587 X:116961388-116961410 GCTACTCCCAACATGGCGGCAGG - Intergenic
1199060687 X:143351890-143351912 GTTCTTCTCTACATGGTGGCAGG + Intergenic
1199978123 X:152906078-152906100 CTTTCTCCCCTCATGGTGTCTGG - Intergenic
1200384372 X:155874912-155874934 CCTCCTCCCAAGATGGGGACAGG - Intergenic
1200543874 Y:4495083-4495105 CTTCCTCACCACATGGTGAGTGG + Intergenic