ID: 1106175715

View in Genome Browser
Species Human (GRCh38)
Location 13:27329508-27329530
Sequence ATCTTCAGAGGGAAGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106175715_1106175722 28 Left 1106175715 13:27329508-27329530 CCTTAGTTCTTCCCTCTGAAGAT 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1106175722 13:27329559-27329581 CTATGTGCAATGTTCAGCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 131
1106175715_1106175718 1 Left 1106175715 13:27329508-27329530 CCTTAGTTCTTCCCTCTGAAGAT 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1106175718 13:27329532-27329554 GTCGTGATGAGAAAGAATCCAGG 0: 1
1: 0
2: 1
3: 3
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106175715 Original CRISPR ATCTTCAGAGGGAAGAACTA AGG (reversed) Intergenic
900765083 1:4499608-4499630 GTCTTCAGAGAGAAGATCTGAGG - Intergenic
904833350 1:33319789-33319811 ATCCCCAGGGGGTAGAACTAGGG - Intronic
904833846 1:33322347-33322369 ATCCCCAGGGGGTAGAACTAGGG - Intergenic
908650520 1:66328286-66328308 ACTTCCAGAGGGAAGAAGTAGGG - Intronic
908902711 1:68974600-68974622 ATCTTCAGAGGGGAGATATATGG - Intergenic
909410851 1:75349655-75349677 AAATGCAGAGTGAAGAACTATGG + Intronic
909732306 1:78908664-78908686 ATGATGAAAGGGAAGAACTATGG - Intronic
909950426 1:81713157-81713179 ATCTTGAGAGGGAAGGACCTAGG + Intronic
910576540 1:88771445-88771467 AACTTCGGATGGAAGAATTAAGG + Exonic
910951407 1:92652752-92652774 CTCTTCAGAAAGAAGAACCAAGG + Intronic
911604276 1:99885171-99885193 ATCTAGAAAGGGAATAACTAAGG - Intronic
911762527 1:101632675-101632697 ATCTTCAGGGTGAAGCACTGAGG - Intergenic
911766068 1:101676492-101676514 ATCCTCAGAAAGAAGGACTAAGG - Intergenic
912165123 1:107034435-107034457 AACTTCAAAGTGAAGAACAATGG + Intergenic
912473312 1:109920702-109920724 AGCTTCACAGGGAAGAAACATGG - Intronic
914915016 1:151814349-151814371 ATTTTAATAGGCAAGAACTAAGG + Intronic
915319585 1:155049006-155049028 TTCTTCAGAGGGAGAAACTGAGG - Intronic
916378858 1:164186819-164186841 CTATGCAGAGAGAAGAACTAGGG - Intergenic
917310416 1:173672071-173672093 TTCTTCTGAGGCAAGAATTAAGG + Intergenic
917567576 1:176229226-176229248 ATCTTCAGAGGGAAGAAACCAGG + Intergenic
917688941 1:177447861-177447883 GTTTTCAGAGGGAAGAAGGAAGG - Intergenic
919444674 1:197688367-197688389 ATCTTGAGAAAGAAGAACAAAGG + Intronic
922101597 1:222481843-222481865 ATGGTCAGAGGGGAGAAGTAGGG - Intergenic
922262678 1:223956959-223956981 ATGGTCAGAGGGGAGAAGTAGGG - Intergenic
923519185 1:234722818-234722840 GTCTTCAGCGAGAAGGACTAGGG - Intergenic
924298203 1:242610565-242610587 CTCTTCATAGGTAAAAACTAAGG + Intergenic
924344517 1:243061960-243061982 ATGGTCAGAGGGGAGAAGTAGGG - Intergenic
1062894241 10:1090722-1090744 ATCTAAAGAGAGAAGAACAAAGG - Intronic
1063554366 10:7064253-7064275 AGCCTCAGAGAGAAGAAATATGG + Intergenic
1064565015 10:16631271-16631293 GTCTCCAGAGGGAAGAATTCAGG + Intronic
1066264810 10:33766264-33766286 AATTTCAGAGGGAAGAAAAAGGG - Intergenic
1066731816 10:38443112-38443134 ATGGTCAGAGGGGAGAAGTAGGG + Intergenic
1066754914 10:38701431-38701453 AACTTAAGAGTGATGAACTAGGG - Intergenic
1070790767 10:79188004-79188026 ATCTACAGATGGGAAAACTAAGG - Intronic
1070945331 10:80386642-80386664 ATCTTCAGAGGAAAAGACTCTGG - Intergenic
1071315333 10:84390042-84390064 ATCTTCAGTGGTGAGAGCTAGGG + Intronic
1075378337 10:121997598-121997620 GTTTTCAGAGAGAAGAACAAAGG + Intronic
1075923314 10:126231345-126231367 ATCTTAGGAGGGAGGAAATAAGG + Intronic
1076502356 10:130947283-130947305 TTCTTCAGAGGGAAAAGTTATGG - Intergenic
1080311949 11:30904908-30904930 ATCTTCAGAGGTAATGACAATGG - Intronic
1080474282 11:32575219-32575241 TCCTTCAGAGGGCAGAACCAGGG - Intergenic
1082104034 11:48200394-48200416 TATTTCAGAGGGAAGATCTAGGG - Intergenic
1088029804 11:105233717-105233739 ATATAAAGAGAGAAGAACTATGG + Intergenic
1088629732 11:111763191-111763213 TTCATTAGAGGGAAGACCTAGGG + Intronic
1088633395 11:111795799-111795821 ATATTCAGAGTGAGGAACTGGGG + Intronic
1089934519 11:122350000-122350022 ATCTTCAGAGGCAAAGACGATGG - Intergenic
1095809901 12:46361876-46361898 ATCTTCAGAGCGAAGCTCTCAGG - Intronic
1095817144 12:46436466-46436488 ATCTTTAGATGGTAGAATTACGG - Intergenic
1097646603 12:62242021-62242043 AACTTCAGAGAGAAGAAAAAAGG + Intronic
1098064385 12:66597491-66597513 ATGTTCAGAGGGAAGACCAGAGG + Intronic
1099297887 12:80852995-80853017 AACTTCAGAGAGAAGGACCAAGG + Intronic
1099694963 12:86006674-86006696 ATGTTGAGAGGGATGAAATATGG - Intronic
1099848003 12:88054186-88054208 AGCATTAGAGGGAAGAAATAAGG + Intronic
1100767854 12:97887452-97887474 GTTTTCAGAGGTAAAAACTAAGG + Intergenic
1101115955 12:101531363-101531385 ATTTTCAGACGAAAGAACTGAGG - Intergenic
1105314532 13:19244823-19244845 TACGTCAGAGGGAAGATCTAGGG - Intergenic
1106083456 13:26519640-26519662 CTCTTCAGACGGAAGAACACTGG - Intergenic
1106175715 13:27329508-27329530 ATCTTCAGAGGGAAGAACTAAGG - Intergenic
1108703070 13:52960061-52960083 ATTTTCAGATGGAAAAACCAAGG + Intergenic
1109648952 13:65299242-65299264 ATTTTCAGATGAAAAAACTAAGG - Intergenic
1111939235 13:94591947-94591969 ACCTTCATAGGGAAAGACTAGGG + Intronic
1112302525 13:98242904-98242926 ATTTTCTGTGGGAAGAACTTAGG + Intronic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114938160 14:27571104-27571126 AACGTCAAAGGGAAGAACAAAGG - Intergenic
1115302111 14:31895951-31895973 GTCTTCAGAGAAAAGAGCTATGG + Intergenic
1116318552 14:43429727-43429749 ATGTTCTCAGGGAAGAACTATGG - Intergenic
1116836299 14:49771625-49771647 ATCTGCCTAGAGAAGAACTATGG + Exonic
1118279671 14:64417196-64417218 ATCAGCTGAGGGAAGAAATATGG + Intronic
1118484421 14:66200511-66200533 AACTTGAGAGGGATGAATTAGGG + Intergenic
1119166705 14:72500760-72500782 TTCCTGAGAGGGGAGAACTAAGG + Intronic
1120368797 14:83606314-83606336 AACTTCTGAAGGAAGCACTAAGG - Intergenic
1120564471 14:86038034-86038056 AACTTGAGAGTGATGAACTAAGG + Intergenic
1123213227 14:106781667-106781689 ATATGCAGAGGGAAGAAGCAGGG - Intergenic
1123825946 15:24082249-24082271 ATCTTCAGAGTGATGAACTAGGG - Intergenic
1123872989 15:24595147-24595169 AACTTCAGAGTGATGAACTGGGG - Intergenic
1124111006 15:26787329-26787351 TTCTTCAAAGGGAAGGTCTAAGG + Intronic
1124195292 15:27620256-27620278 TTCTTCAGTGTGAAGAACTACGG + Intergenic
1124449429 15:29772602-29772624 ATCTTCATAGGGAATAAAAAGGG + Intronic
1125739697 15:41953548-41953570 AACTTGAGAGGGCAGAGCTAAGG - Intronic
1125751781 15:42033998-42034020 AAATTCAGAGGGAAGGACTCTGG + Intronic
1126084580 15:44999911-44999933 AACTTAAGAGTGATGAACTAGGG + Intergenic
1126177556 15:45751789-45751811 ATCTTCACATGGAGGAAATAGGG + Intergenic
1126822938 15:52522690-52522712 ACCTTCTGAGGTAAGAAGTAAGG + Intronic
1127053297 15:55106955-55106977 AACTTCAGAGTGAAGATTTAGGG + Intergenic
1130349066 15:83074568-83074590 AACTTCAGAGTGATGACCTAGGG - Intergenic
1130918038 15:88321313-88321335 AGCATCAGAGTGAAGGACTAGGG - Intergenic
1132136077 15:99340584-99340606 ATCTGCAGTTTGAAGAACTATGG + Intronic
1136026559 16:27472514-27472536 ATCTGCAGAGGGAAGTCCTTGGG - Intronic
1136181126 16:28553210-28553232 ATCTTCTCAGGAAAGTACTAAGG - Intergenic
1136727773 16:32375407-32375429 AACTTAAGAGTGATGAACTAGGG + Intergenic
1139199892 16:64963961-64963983 TTCTTTAGAGGGAAGAACATGGG + Intronic
1140515446 16:75537937-75537959 ATCTACCTGGGGAAGAACTAGGG + Exonic
1141255207 16:82395773-82395795 AGCTACAGAGAGAAGACCTAGGG - Intergenic
1202998662 16_KI270728v1_random:142347-142369 AACTTAAGAGTGATGAACTAGGG - Intergenic
1203130259 16_KI270728v1_random:1678751-1678773 AACTTAAGAGTGATGAACTAGGG - Intergenic
1143484269 17:7244473-7244495 ATCCTCAGAGGGAATAAAAAAGG - Intronic
1145303993 17:21661414-21661436 ATCTTCAGAAGGAAAAAATGAGG - Intergenic
1149408350 17:56378015-56378037 ATCTTTGTAGGGAGGAACTAGGG - Intronic
1150487658 17:65555031-65555053 ATCCTCAGAGGGCAGGACTCTGG - Intronic
1151901922 17:77021799-77021821 AACTTCAGAGTGATGATCTAGGG + Intergenic
1152000854 17:77644593-77644615 GTCTTCAGAGGGAAGAGTGAGGG + Intergenic
1152075611 17:78157931-78157953 ATCTTTACTGGGAAGAAATATGG + Intronic
1153296660 18:3552687-3552709 TTCTTCAGAGGCTAAAACTAAGG - Intronic
1158894308 18:61898703-61898725 ATCATCAGAGGGAACAAGTGGGG + Intergenic
1159330695 18:66990910-66990932 ACCTACAGAGTGAAGAATTAGGG + Intergenic
1159404567 18:67983352-67983374 TTCTTCAGAGGAAGGAATTAGGG + Intergenic
1159630728 18:70746454-70746476 ATCTTCTGTGGGGAGAAATAGGG + Intergenic
1159880061 18:73850685-73850707 AATTTCAGGGGGAAGATCTAAGG - Intergenic
1161271062 19:3389585-3389607 TTCTACAGAGGCAAAAACTAAGG - Intronic
1165466170 19:35976442-35976464 ATCTTGAGAGGTAAGAATTATGG - Intergenic
926894915 2:17675482-17675504 ATCTTCAGATGAAAGAAAAATGG - Intronic
927387798 2:22556172-22556194 ATTTTCAGAGGAATCAACTAAGG + Intergenic
928187514 2:29125751-29125773 AACACCAGAGGGAAGAACAATGG - Intronic
930360252 2:50368893-50368915 ATGTTCAGAGGCAAGATCTTAGG - Intronic
930549252 2:52810929-52810951 GTCTGGAGAGGGAACAACTATGG - Intergenic
931557097 2:63518239-63518261 ATCTTCAGAGGGAAGGCATTGGG + Intronic
931849549 2:66238410-66238432 ATCTCCAGTGGGAAGGAGTAAGG - Intergenic
932847971 2:75154606-75154628 CTCTTCAGAGGGAATCACCATGG - Intronic
934318199 2:91945666-91945688 AACTTAAGAGTGATGAACTAGGG - Intergenic
938635622 2:133223149-133223171 ATCTTCACAGGGAAACAATATGG - Intronic
940287430 2:152046638-152046660 ATCTTAAAAGGGCAGAAATAAGG - Intronic
940774234 2:157870229-157870251 ATGTACAGAGGGGAGAACGAAGG - Intronic
942378743 2:175364731-175364753 TTGTTCAGAGGAAAGAACAAAGG - Intergenic
942436710 2:175985871-175985893 AACTGCAGAGGGCAAAACTATGG + Intronic
942763102 2:179423614-179423636 ATTATCAGAGGGAAAAACTGAGG + Intergenic
943288942 2:186043293-186043315 AACTTGATAGTGAAGAACTAGGG - Intergenic
943859267 2:192838800-192838822 ATCATCAGAGAGAAGGAATAAGG + Intergenic
945672940 2:212823966-212823988 AGTTTCAGGGGGAAGAACTAGGG - Intergenic
946387788 2:219395745-219395767 ATCTCCAGAGGGAAGTGCTTAGG + Intronic
947230906 2:227885158-227885180 ATATTTAGAGGGAAGGACCAGGG + Intronic
1168898811 20:1342632-1342654 GTCTTCACAGGGGAGAACCAGGG - Intronic
1169778417 20:9282045-9282067 GTCTTCAGAGGAAGGAACAAGGG - Intronic
1170389979 20:15861692-15861714 ATCTACAGGGGCAAGAAGTAGGG - Intronic
1170947405 20:20903695-20903717 CTCTTCAGAGGGAAGTAACAAGG + Intergenic
1171261212 20:23736261-23736283 AACTTCAGAAGGAACAACTCTGG + Intergenic
1171270340 20:23812152-23812174 AACTTCAGAAGGAACAACTCTGG + Intergenic
1171352188 20:24511676-24511698 ATCTTCAGGGGCTAGAATTAAGG - Intronic
1171521534 20:25779048-25779070 ATCTTCAGAAGGAAAAAATGAGG - Intronic
1171555282 20:26076817-26076839 ATCTTCAGAAGGAAAAAATGAGG + Intergenic
1174054625 20:47789224-47789246 ATCTGCAGAGGGAAGAAACGAGG - Intergenic
1175676602 20:60951498-60951520 GACTTCAGAGGGTAGAACTCAGG + Intergenic
1176338488 21:5621057-5621079 GTCTTCTGAGGGAAGAACCAAGG - Intergenic
1176339896 21:5684130-5684152 GTCTTCTGAGGGAAGAACCAAGG - Intergenic
1176472150 21:7116283-7116305 GTCTTCTGAGGGAAGAACCAAGG - Intergenic
1176495711 21:7498061-7498083 GTCTTCTGAGGGAAGAACCAAGG - Intergenic
1176504931 21:7640326-7640348 GTCTTCTGAGGGAAGAACCAAGG + Intergenic
1176655356 21:9584157-9584179 ATCTTCAGAAGGAAAAAATGAGG - Intergenic
1178051791 21:28755535-28755557 ATCTTCTGTGGGAAGAGCTCTGG + Intergenic
1179416933 21:41206249-41206271 ATCTTCAGATGGCAGAAAGAGGG + Intronic
1182745727 22:32604146-32604168 ATCTTCAGAGTCAAGAACATAGG - Intronic
1183365030 22:37402472-37402494 CTTTTGAGAGGCAAGAACTAGGG - Intronic
951839829 3:27022578-27022600 GTCTAAAGAGGGAAGCACTAAGG + Intergenic
956339211 3:68202944-68202966 TTCTTTAGAGAGAAGAAATATGG - Intronic
956421309 3:69088849-69088871 ATCTTCAAAGTGAAAAACAAAGG + Intronic
957678812 3:83404749-83404771 ATCTACAGAGAGAAGCACTATGG + Intergenic
960816274 3:121676494-121676516 CTCTCAAGAGGGCAGAACTAGGG + Intronic
960820370 3:121724444-121724466 AGCTTGAGAGTGATGAACTAGGG + Intronic
961163533 3:124749341-124749363 GTCCTCAGAAGGAAGAACAAAGG - Intergenic
962102056 3:132352929-132352951 ATATTCAGAGGGAAGAATGGTGG + Intronic
963223920 3:142841386-142841408 ATGATCAAAGGGAAGAACAATGG + Intronic
964342054 3:155718075-155718097 AACTTCAGAGTGATGATCTAGGG - Intronic
964955844 3:162355056-162355078 ATGGTCAGAGGGAAGAATTCAGG - Intergenic
965673246 3:171168767-171168789 ATTTTCAGTGGGAAGAAGCAAGG - Intronic
966125248 3:176568718-176568740 CTTTTAAGAGGGAAGAACTCAGG - Intergenic
966640145 3:182180638-182180660 ATCTTCAGTGGTAAAAACTCTGG - Intergenic
967582535 3:191177128-191177150 ATCTGCAAAGGGAAGACCTGTGG + Intergenic
967650104 3:191975035-191975057 AAGGTCTGAGGGAAGAACTAAGG + Intergenic
968746630 4:2363853-2363875 ATTTACAGAGGGAAGAACCAAGG + Intronic
969805230 4:9602599-9602621 TTCTTCAGAGGGAGGCAGTACGG - Intergenic
971329946 4:25674102-25674124 ATATTCAGATGGAAAAACCAAGG - Intronic
971500359 4:27312041-27312063 AGCTTCTGAGGGAACAGCTAGGG + Intergenic
972136653 4:35901969-35901991 ATTTTAAGAGGGAAGCAATATGG + Intergenic
972883597 4:43456907-43456929 ATCTTCAGATGGAATAATTCAGG - Intergenic
974560694 4:63513275-63513297 ATCTTCAGAGCTTAGGACTAGGG - Intergenic
976314592 4:83645780-83645802 CAATGCAGAGGGAAGAACTACGG + Intergenic
977950685 4:102966952-102966974 AACTTAAGAGTGATGAACTAGGG - Intronic
979258202 4:118625739-118625761 ATGGTCAGAGGGGAGAACTAGGG + Intergenic
979330147 4:119414829-119414851 ATGGTCAGAGGGGAGAACTAGGG - Intergenic
979945275 4:126823121-126823143 ATCTTCACAGGGAACACCAAGGG + Intergenic
980023352 4:127735513-127735535 ATCTTAAGAGGGAGGGACCAGGG - Intronic
982210261 4:153029035-153029057 AACTTAAGAGTGAAGACCTAGGG - Intergenic
982631584 4:157836746-157836768 ATCTTTAGAAGGAAAAACAATGG + Intergenic
982690611 4:158543712-158543734 TTCTTCAGGAGGAAGTACTAGGG - Intronic
982955156 4:161755550-161755572 ATATCCAGAGGGATAAACTAAGG - Intronic
982965824 4:161906279-161906301 GTCTCCAGAGGGAGGAACAACGG + Intronic
985288790 4:188364771-188364793 ATAATCAGAGGGAAGGTCTAGGG - Intergenic
988612624 5:32741611-32741633 ACCATCAGAGGGAAGCAGTATGG - Intronic
990135535 5:52640132-52640154 ATGTTCAGAGGTAAGACCTTTGG + Intergenic
990340779 5:54820904-54820926 ATCTTCTGAGGGAAGAGATTGGG + Intergenic
993309629 5:86313379-86313401 AACTTCAGAGGGATGATTTAGGG + Intergenic
993426360 5:87769734-87769756 ATCTACAGAGGTAAAAAATAAGG - Intergenic
994124096 5:96150670-96150692 AACTTAAGAGGGAGAAACTACGG + Intergenic
995036739 5:107542928-107542950 ATGCTCAGAGGGAAGAAAGATGG + Intronic
995727075 5:115192432-115192454 CTCTTCAGAGGAGAGAACGATGG + Intergenic
995907525 5:117143275-117143297 AACTTCAGAGGGCAGAAGAAAGG + Intergenic
997242467 5:132317922-132317944 ACCGTAAGAGGGAAGAACTGGGG + Intronic
998505056 5:142665732-142665754 ACCTTCAGTGGGAAGGACCATGG - Intronic
998848359 5:146332403-146332425 TTTTACAGAGGGAAGAACTAAGG - Intronic
998964935 5:147529055-147529077 ATCTTCAGAGATGAGAAATAAGG + Intergenic
999225991 5:150025119-150025141 TTCTTCAGAGGAGAGAACTGAGG - Intronic
1000273831 5:159714205-159714227 ATCTACAGCAGAAAGAACTACGG + Intergenic
1000459927 5:161502617-161502639 ATCTTTAGAGGAAAGAAACATGG + Intronic
1001307873 5:170588907-170588929 TTCATCAGAGGGAAAAACTGAGG - Intronic
1002682955 5:180982254-180982276 CTCTGCAGAGGGAGCAACTATGG + Intergenic
1002794119 6:456977-456999 AACTTCAGAGTGATGACCTAGGG - Intergenic
1003029340 6:2588702-2588724 ATTGTCAGAGGGAAGGTCTAGGG + Intergenic
1003134182 6:3420533-3420555 ATCTCCAAAGAGAAAAACTAAGG + Intronic
1003384813 6:5657505-5657527 ATCTTCAGAGGGGAAACCTCTGG - Intronic
1006456878 6:34136994-34137016 TTCTGCAGAGGGAAGAGCTGGGG + Intronic
1006815898 6:36849617-36849639 TTCTACAGATGGAAAAACTAAGG + Intergenic
1007071921 6:39044261-39044283 ATCTTCTGAGTGATGAAATAAGG - Intergenic
1008275245 6:49536564-49536586 CTTTTCAGTGGGTAGAACTAGGG - Intergenic
1010317830 6:74471066-74471088 ATCTGCACAGGGATGAACAAGGG - Intergenic
1011236587 6:85225051-85225073 ATCTTGAGAAAGAAGAACAAAGG + Intergenic
1012098848 6:95003861-95003883 ATCTTCAGAGAAATGCACTAAGG - Intergenic
1015842781 6:137491566-137491588 ATCTTCTAAGGGAAGAAAGAAGG + Intergenic
1016469803 6:144363478-144363500 GTCTTGAGAGGGAAGATGTAAGG - Intronic
1017239192 6:152148100-152148122 ATCCTCAGAGGGCAGAGCTCTGG + Exonic
1018714386 6:166520766-166520788 ATCTTCTTAGGGAATAACTAAGG + Intronic
1019998509 7:4740935-4740957 ATCTTCAGAGGGGAGATCTGGGG - Exonic
1021408194 7:20298587-20298609 ATTCTAAGAGGGAAGAAATAGGG - Intergenic
1021518261 7:21510240-21510262 AATTTTAGAGGGAAGATCTACGG + Intronic
1022204373 7:28149382-28149404 ATCTTCAGAGGGAAAAAAATAGG - Intronic
1022612080 7:31885981-31886003 ATCCTCAGAGGGAATAACCTTGG - Intronic
1022952155 7:35349348-35349370 ATATTCACAGGGAAGGACTGAGG + Intergenic
1023400187 7:39787033-39787055 ATGGTCAGAGGGGAGAAGTAGGG + Intergenic
1023493483 7:40769004-40769026 TCCTTGAGAGGGCAGAACTAGGG + Intronic
1023831858 7:44044122-44044144 AACTGCAGAGGGAAAAACTCAGG + Intergenic
1024073115 7:45802784-45802806 ATGGTCAGAGGGGAGAAGTAGGG + Intergenic
1024114871 7:46183140-46183162 ATCTTAAAAGGGAAGAATGAAGG - Intergenic
1024179148 7:46871638-46871660 ATCTGCAAATGGAAGGACTAGGG - Intergenic
1024755036 7:52519144-52519166 ATATTCAGAGGGAGGAATTCAGG - Intergenic
1024978997 7:55141174-55141196 ATCTTAAGAGTGAAGAAATATGG - Intronic
1025054363 7:55753053-55753075 ATGGTCAGAGGGGAGAAGTAGGG - Intergenic
1025132413 7:56383206-56383228 ATGGTCAGAGGGGAGAAGTAGGG - Intergenic
1025194079 7:56919031-56919053 AACATCAGAGGGAAGAAGCAAGG + Intergenic
1025677869 7:63657913-63657935 AACATCAGAGGGAAGAAGCAAGG - Intergenic
1026056235 7:66986188-66986210 AGCTTCAGAGAAAAGAACTGTGG + Intergenic
1026721851 7:72838880-72838902 AGCTTCAGAGAAAAGAACTGTGG - Intergenic
1026942601 7:74296129-74296151 ATGTTCAGAGGGAAGACCACAGG + Intronic
1027936455 7:84610180-84610202 TTTTTCACAGAGAAGAACTAGGG - Intergenic
1029411998 7:100419230-100419252 CTGTTCAGAGGGGAAAACTATGG - Intronic
1030598302 7:111564575-111564597 ATCTGGAAAGGGCAGAACTATGG + Intergenic
1031303424 7:120092600-120092622 AATTTCAGAGGGAAAAACTTGGG - Intergenic
1032050502 7:128646478-128646500 ATGGTCAGAGGGGAGAAGTAGGG + Intergenic
1032521144 7:132546190-132546212 ATCTTCAGAATGAAAAACAATGG + Intronic
1033824728 7:145175482-145175504 AGCTTCAGATAGAAGAACTCTGG + Intergenic
1033843436 7:145403234-145403256 AACTTCAGAGTGATGACCTAAGG + Intergenic
1037225248 8:16579848-16579870 AAGTTCAGAGGCAAGAACTGAGG - Intergenic
1037587173 8:20285318-20285340 ATCTACACATGGAAGAACTGAGG - Intronic
1037656732 8:20890078-20890100 TTTTTCAGATGGAAAAACTAAGG + Intergenic
1037822740 8:22142936-22142958 ATTTTCAGAGGGAACAACAGAGG - Intergenic
1039008789 8:33070398-33070420 ATTAACAGAGGGAAGAACTGGGG - Intergenic
1039550292 8:38438569-38438591 ATCTTCAGAGGGGGAAACTGGGG + Intronic
1041293618 8:56332643-56332665 TTTGTCAGAGGGAAGATCTAGGG + Intergenic
1041840592 8:62266112-62266134 CTCCTCAGAGGGGAGAAATAAGG + Intronic
1042204538 8:66315473-66315495 ATATACAGAGGGAATAGCTAAGG + Intergenic
1043874267 8:85466281-85466303 ACCTTCAGAGGAAAGCACTCAGG - Intronic
1044906330 8:97007808-97007830 AACTTCAGGGGGATGAAGTAAGG + Intronic
1045466001 8:102470381-102470403 ATACTCAGTGGGAAAAACTAGGG - Intergenic
1045597625 8:103674003-103674025 AACTTCAGAGTGATGACCTAGGG - Intronic
1045714289 8:105023514-105023536 ATTTTCAGAGGGATGATCTATGG + Intronic
1047796619 8:128263447-128263469 ATCTTCTGAGGAAAGGACAAAGG - Intergenic
1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG + Intergenic
1048911310 8:139138055-139138077 AGCTTCAGACAGGAGAACTATGG + Intergenic
1049183168 8:141233893-141233915 AGCTTCAGAGGCCAGCACTAGGG + Intronic
1049838381 8:144754802-144754824 ACCTTCAGTGGGGAGAACTCAGG + Exonic
1050489612 9:6173863-6173885 CTCTTCATATGGAAAAACTAAGG + Intergenic
1052387446 9:27838378-27838400 CCCTTCAGAAGGAAGAAATATGG + Intergenic
1056161322 9:83897534-83897556 ATCCTCAGAGGAAACAACTGGGG + Intronic
1057942928 9:99300464-99300486 AAGTTCAGAAGGAAGAACCATGG - Intergenic
1058406558 9:104682904-104682926 ATCTTCAGAAGGAAGCAGGATGG - Intergenic
1058847770 9:108978939-108978961 TTCTTCAGAGTGAAGAACAGAGG - Intronic
1058871502 9:109205809-109205831 ATTTTCATAGGAGAGAACTAAGG + Intronic
1059532348 9:115047294-115047316 ATGTTCAGATGGTAGAACTGAGG + Intronic
1061571118 9:131477965-131477987 ATCTTCAGGGGAAAGAACTCAGG + Intronic
1203423171 Un_GL000195v1:13863-13885 GTCTTCTGAGGGAAGAACCAAGG + Intergenic
1203633075 Un_KI270750v1:87629-87651 ATCTTCAGAAGGAAAAAATGAGG - Intergenic
1186093774 X:6078290-6078312 ATCTTCAGAGTCAACAACAATGG + Intronic
1187768744 X:22671615-22671637 ATTTTCAGAGTGAAGAAGAATGG - Intergenic
1190224459 X:48534516-48534538 ATCTTCAGAGTGAAGATTTTGGG - Intergenic
1191169315 X:57424710-57424732 ATCTCCAAAGGGAATAAATATGG + Intronic
1195137582 X:101924834-101924856 TTCTTCAGAGTGGAGAAATATGG + Intronic
1195803711 X:108738242-108738264 TTCTTAAGAGGGCAGAAATATGG - Intergenic
1195859019 X:109360771-109360793 ATCTACAAAGGAAAAAACTAAGG - Intergenic
1196424799 X:115559984-115560006 TTCTTAAAAGGGAAGAACTTGGG - Intergenic
1196890644 X:120287693-120287715 ATTTTCAGAAGGAAGAGCTCAGG + Intronic
1197616378 X:128696331-128696353 ATCCTCAGAGGGAAAAATAATGG - Intergenic
1198569260 X:137937806-137937828 AACTTAAGAGGGATGACCTAGGG + Intergenic
1199408117 X:147486079-147486101 ATCTTCAGAAGGAAGGAATTCGG - Intergenic