ID: 1106176073

View in Genome Browser
Species Human (GRCh38)
Location 13:27333033-27333055
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106176073 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intergenic
Too many off-targets to display for this crispr