ID: 1106178823

View in Genome Browser
Species Human (GRCh38)
Location 13:27353682-27353704
Sequence TGCTGTCTGGTCTCTCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106178815_1106178823 26 Left 1106178815 13:27353633-27353655 CCACACAGCCAATGATTAGCAGA 0: 1
1: 0
2: 4
3: 43
4: 284
Right 1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 156
1106178818_1106178823 18 Left 1106178818 13:27353641-27353663 CCAATGATTAGCAGAGCAGGGAT 0: 1
1: 0
2: 1
3: 7
4: 145
Right 1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106178823 Original CRISPR TGCTGTCTGGTCTCTCCTAA AGG Intergenic
900714123 1:4133208-4133230 GGCTGGCTGGTCTCTCCTCGGGG + Intergenic
906448172 1:45921750-45921772 TCAGGTCTGGTCTCTCCAAAGGG + Intronic
907360900 1:53913793-53913815 TGCACTCTGGTGTCTCTTAAGGG - Intergenic
907408392 1:54268077-54268099 TGCTGTCTGGACTCTCCCCGTGG - Intronic
907868761 1:58424017-58424039 AACTCTCTAGTCTCTCCTAAAGG + Intronic
908346479 1:63238571-63238593 TGGTGTGTGGTCTCTCAAAAGGG + Intergenic
912731555 1:112111446-112111468 GCCTGGCTGGTTTCTCCTAAAGG - Intergenic
915745557 1:158154321-158154343 TCCTCTCTAGACTCTCCTAATGG - Intergenic
916030136 1:160869443-160869465 TGGTGTCTTGCTTCTCCTAAAGG - Intergenic
917158919 1:172035406-172035428 TACTCTCTGTTCTCTCTTAAGGG - Intronic
917337188 1:173937131-173937153 TTCTGTTTGGACTCTCCTACTGG + Exonic
917631260 1:176893620-176893642 TGCTTTCTGTTTTCTCCTTAAGG - Intronic
917930062 1:179816841-179816863 TGCTGTCTAGTCTGTGCTAAGGG + Intergenic
918575371 1:186052334-186052356 TGCTGGCTGAACTCTCCTTAAGG - Intronic
919945700 1:202317930-202317952 TAATGTCTGATCTCTCCTACAGG + Exonic
923147082 1:231205788-231205810 TGTTTTCTGGTCTTTCCAAAGGG - Intronic
923306494 1:232693630-232693652 TGCTCTCCTCTCTCTCCTAATGG - Intergenic
923832518 1:237573836-237573858 TGCTGTTAGGTCTCTTCTAAGGG + Intronic
923999547 1:239535349-239535371 TGTTGTCTTCTCTCTCCAAAGGG + Intronic
924850470 1:247824122-247824144 TGCTGGCTGGTCCCTCCTTTCGG - Intergenic
1064001341 10:11665972-11665994 GGCTATCTAGTTTCTCCTAAGGG - Intergenic
1064337082 10:14453414-14453436 TGCAGTCTGCTCTCTCCTTGTGG - Intronic
1066093496 10:32050061-32050083 TGCTCTCTAGTTTCTCCTAAAGG + Intronic
1067430448 10:46240130-46240152 TGGTGGCTGGGCTCTCCAAATGG - Intergenic
1068030358 10:51698378-51698400 AGCAGTCTGGGATCTCCTAATGG + Exonic
1068905075 10:62313307-62313329 GGCTGTCTGGCCTTTCTTAATGG - Intergenic
1070314012 10:75294234-75294256 TGATGTCTGGTCTGTCTGAAAGG - Intergenic
1071010762 10:80937828-80937850 TGCTCTCTGGTCACTCCTGTTGG + Intergenic
1073718928 10:106142769-106142791 TGTTGGCTGTTCTTTCCTAAAGG - Intergenic
1076075504 10:127530761-127530783 TGCTGGCTGCTTTCTCTTAAGGG + Intergenic
1076905932 10:133361104-133361126 TGCCCTCAGGGCTCTCCTAAGGG + Intergenic
1084690724 11:70724574-70724596 TGCTGTCTGATATTTCCAAAAGG - Intronic
1084784683 11:71435372-71435394 TGCTGCCTGGAATCTTCTAAGGG - Exonic
1085085188 11:73661951-73661973 GGCTCTCTGCTCTCTCCTTAGGG + Exonic
1085206703 11:74737898-74737920 AGCTGCCTGGTCCCTCCTCAGGG + Intergenic
1088438856 11:109845881-109845903 TAATGTCTAATCTCTCCTAAGGG + Intergenic
1091028909 11:132166138-132166160 TGCTGTCTGTTCACTTCTGATGG - Intronic
1092879895 12:12879968-12879990 AGCTCTCTGGTGTCTTCTAAGGG + Intergenic
1097633831 12:62097607-62097629 GGCTGTCTTGTCTGTCCTATAGG + Intronic
1099704747 12:86137810-86137832 TACTGTCTGTTCTCTGCAAAAGG - Intronic
1101470255 12:104989711-104989733 TCCTGTCTCGCCTCTCCTGAAGG + Intronic
1103019614 12:117523514-117523536 TGCTCTCTGGCCTCTCCCAGAGG - Intronic
1104675958 12:130712576-130712598 TGCTGTCGGATCCCTCCTGAAGG + Intronic
1105451704 13:20505644-20505666 TGATGTATGGTCTGTCCTGAGGG + Intronic
1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG + Intergenic
1106887592 13:34206623-34206645 TTCTGTGTGGTCTCTCCACATGG - Intergenic
1106927233 13:34625863-34625885 TGCTGTATGGTTTCCACTAAGGG - Intergenic
1110926464 13:81160408-81160430 TCCTGCCTGGTGTCTCCAAAAGG - Intergenic
1111676295 13:91393929-91393951 TGCTGTGTAGTCTCTCCTTTAGG + Intergenic
1113011853 13:105776732-105776754 AGCTCTCTGTTCTCTCCTATTGG + Intergenic
1113441740 13:110334404-110334426 TGCTCTGTGGTCTCATCTAAGGG - Intronic
1113671293 13:112177111-112177133 TGCTGTATTTTCTATCCTAAAGG - Intergenic
1117940912 14:60963603-60963625 AGCTGGCTGATCTCTCTTAATGG + Intronic
1120071061 14:80103161-80103183 TTCTGTCTGGTGTCTCCTCTTGG - Intergenic
1120865255 14:89290937-89290959 CGCTTTCTGTTCTCTCCTGAGGG - Intronic
1123190724 14:106566723-106566745 TGGGCTCTGCTCTCTCCTAAGGG - Intergenic
1124569382 15:30848196-30848218 TTCTGTCTCCTCTCTACTAAGGG - Intergenic
1128873310 15:71181035-71181057 TGTTTTCTGGTCACTCCCAAGGG - Intronic
1130953147 15:88607893-88607915 AGCTGTCTGGTCTGGTCTAAAGG - Intergenic
1135347965 16:21705372-21705394 TGCTGTGTGTTTTCTCCCAAAGG - Intronic
1135495196 16:22945388-22945410 GGCTGTCTGGCCTCTCTTAAAGG - Intergenic
1137897912 16:52234088-52234110 TGCTGTGTGTTCTCAGCTAATGG - Intergenic
1138121132 16:54401840-54401862 TCCTGGCTGGTCTCTCCTTTGGG + Intergenic
1140952629 16:79833814-79833836 TGCTGTCCTGTCTTTCCTATTGG + Intergenic
1147846478 17:43407485-43407507 TTCTGTCTTCTCTCTCCTTAAGG - Intergenic
1151380274 17:73720769-73720791 TGTGGTCTTGTATCTCCTAAAGG + Intergenic
1155483732 18:26317767-26317789 AGCTCTCTGGTCTCTTCTTAGGG + Intronic
1155532687 18:26783225-26783247 TGCTGTCTGCACTCCCCGAAGGG - Intergenic
1157263552 18:46196915-46196937 TGGTGGCTGGTGTCTCCCAAAGG + Intronic
1157329140 18:46690503-46690525 TGCTGTCTTGTCCCTGCCAAAGG + Intronic
1157465833 18:47944290-47944312 TGCTGACTGATCTCACCTTAAGG - Intergenic
1158021278 18:52845160-52845182 TGTTCTCAGATCTCTCCTAAGGG - Intronic
1159212120 18:65337374-65337396 TGCTCTTTGTTCTCTTCTAATGG + Intergenic
1159684070 18:71394688-71394710 TACAGTATGGTGTCTCCTAAAGG - Intergenic
1159991080 18:74908501-74908523 TGCTGTCTGTTCTGTTCTAGTGG + Intronic
1160037031 18:75310866-75310888 TGCTGTCTGGGCTTTGCTGATGG + Intergenic
1161565153 19:4997773-4997795 TACTGTCTGGTCTGTTCCAAAGG + Intronic
1161729115 19:5948117-5948139 TGCTTTCTGGCCTTTCCTAGGGG - Intronic
1164789270 19:30962077-30962099 TGCTGTCCGGGCTGTCCCAAGGG - Intergenic
1165539307 19:36478393-36478415 TCCTTTCTGGTCTCTCCTCCTGG + Intronic
1166907043 19:46118635-46118657 TGATGTCTGGGCTCTCAAAATGG - Intergenic
1167830773 19:52020437-52020459 TGCTGACTGTCCTCTCCTCATGG + Intronic
932229142 2:70068124-70068146 TGGTGTCTGATCTCTCCTCCTGG - Intergenic
934659869 2:96137742-96137764 TGCTGTCTGGTCTCACCGGTGGG - Intronic
935350619 2:102149414-102149436 TGCCGTCTGTTCTCTCCTCTTGG + Intronic
936081915 2:109438099-109438121 TGCTTTCTGGACACTTCTAATGG - Intronic
936607918 2:113976294-113976316 AGCTGTCTGCTGTCTGCTAATGG - Intergenic
938124538 2:128662489-128662511 TGCAGTCTGCTCTGTCCTGAGGG - Intergenic
940733971 2:157428408-157428430 TACTGTCTGTTTTCTCCTTAAGG + Intronic
940958071 2:159751122-159751144 GGCTGTCTGCTGTCTGCTAAGGG + Intronic
941561302 2:167048614-167048636 TGCTGTCTTCTGTGTCCTAAAGG - Intronic
942003955 2:171679036-171679058 TGCTGTCTGTTCTCTGCTATGGG + Intergenic
946111083 2:217418073-217418095 TTTTGTGTGGTCTCTCCTTACGG + Intronic
1169144327 20:3242506-3242528 GGCTTTCTGGTCTAGCCTAATGG + Intergenic
1170440260 20:16372304-16372326 GTCTGTCTCGTCTCTCCAAATGG + Intronic
1172614656 20:36275272-36275294 TGCAGTCTGGTCTCTCAGGAAGG + Intergenic
1174693536 20:52533677-52533699 TCCTCTCTGGTGTCTCCTTAAGG - Intergenic
1176131356 20:63498114-63498136 CGCTGCGTGGTCTCTCCAAATGG - Intronic
1178677408 21:34642857-34642879 TGCAGACTGGTCTCTGCTATAGG - Intergenic
1179420839 21:41235442-41235464 TGCTTCCTGGTGTCTCCTTAGGG + Intronic
1179512644 21:41884071-41884093 TGCTGTCTGTGCTCACGTAAGGG + Intergenic
1183365503 22:37404569-37404591 TGCTGACTGGTCACTCCTTTGGG - Intronic
1185026746 22:48418463-48418485 TGCTTTCTGGTGTCTCCTGTGGG + Intergenic
949681447 3:6519184-6519206 TGCTGTCTGGTGTCTGGTGAGGG + Intergenic
950544920 3:13632564-13632586 TGCTTTCTGTTCTATGCTAATGG - Intronic
954673513 3:52303304-52303326 GGCTGTCTTGTCTCTCTTTAGGG + Intergenic
956405039 3:68919281-68919303 TCCTGTCTGCTCTGTCCTGACGG - Intronic
959607098 3:108253085-108253107 TGGTGCCTAGTCTCTCTTAATGG + Intergenic
960293890 3:115919079-115919101 TGCTGTGTGGTCTGCCCTACAGG - Intronic
969447053 4:7251262-7251284 TGCTCTCTGGTCTCTGCTAAGGG + Intronic
971643035 4:29159631-29159653 TGTTGTCAGGTCTCTCCAAAGGG + Intergenic
978008773 4:103652387-103652409 TGCTGTCCTTTCTCTCCCAAGGG + Intronic
983549984 4:169008258-169008280 TGTTGTCTCATCTCTCCTGATGG - Intronic
989813560 5:45708238-45708260 TTCTTTCTGGTCCCTCCTATCGG - Intergenic
990927057 5:61037980-61038002 TGCTGTCATGTCTTTCCTAATGG - Intronic
991930415 5:71748518-71748540 TGCTGCCAGGTCTCTCATTAGGG + Intergenic
994047599 5:95327299-95327321 TTCTGTCTGCTCTTTTCTAATGG - Intergenic
995377628 5:111494021-111494043 TGTTTTCTAGTCTTTCCTAAAGG + Exonic
996689611 5:126325644-126325666 TGTTGTCTAGTCTTTTCTAAAGG - Intergenic
996967657 5:129323473-129323495 TGATGTCTGGGCTCTCAAAATGG + Intergenic
1000190244 5:158903425-158903447 TTCTCTCTGGCTTCTCCTAAGGG + Intronic
1000729749 5:164818834-164818856 TCCTATCTGGTCTCTCCAAGTGG + Intergenic
1001193131 5:169648827-169648849 TGCTCTCTGCTCTCTCCTGGTGG + Intronic
1002935076 6:1664531-1664553 TGGTGTCTGGCCACTCCTACAGG + Intronic
1003465516 6:6376604-6376626 TGTTCTCTGGTCTCCCCTTAGGG + Intergenic
1003743433 6:8969905-8969927 TCCTGTCTTTTCTCTCCTTATGG + Intergenic
1005601923 6:27434990-27435012 TGCTGTCTAGTCTCTTCCATTGG + Intergenic
1007342377 6:41199735-41199757 TGCTCTCTGTTCTCTACTATGGG - Intronic
1010486678 6:76422799-76422821 TGCTAACTGGTCTCACCCAAAGG + Intergenic
1011250170 6:85363060-85363082 TGCTGTGTGATCTGTCCAAAAGG - Intergenic
1011494957 6:87928432-87928454 GGCCCTCTGGTTTCTCCTAAGGG - Intergenic
1015757411 6:136621659-136621681 AGCTGTCCTGTCTCACCTAAGGG - Intronic
1017076826 6:150626357-150626379 TTCAGTGTGGTCTCTCCTGAAGG + Intronic
1018484711 6:164229178-164229200 AGTTGTCTGGTCTCTCATTATGG - Intergenic
1023395542 7:39748470-39748492 TGCTGACTAGTCTCTTCTAAGGG - Intergenic
1023528828 7:41132497-41132519 TGCAGCATGGTCTCTTCTAATGG - Intergenic
1024470065 7:49759778-49759800 AGATGTCAGGTCTCTCCCAATGG + Intergenic
1027192965 7:76008531-76008553 TGGTGTCTGTTCTTTACTAATGG - Intronic
1028879799 7:95867504-95867526 TGCTGTATGGTCTCACCTGCTGG + Intronic
1029172155 7:98638867-98638889 TGCTATCTAGTCTTTCCTGACGG + Intergenic
1030528195 7:110678740-110678762 TGCTGACTTCACTCTCCTAAGGG + Intronic
1032106632 7:129036850-129036872 TGCTGTTTGGCCTTTTCTAATGG - Intronic
1033973027 7:147066980-147067002 AGCTGTCTGGTCACTTCTTAAGG + Intronic
1034861499 7:154598992-154599014 TGCTGCAGGGTCTCTCCCAAAGG - Intronic
1035464389 7:159065108-159065130 GGCTTTCTTGGCTCTCCTAAAGG + Intronic
1036586049 8:10124584-10124606 TACTGACTGGTGTCTCATAAAGG - Intronic
1039981832 8:42414925-42414947 TGCTGTCTGGGCTCCTCTGAGGG - Intergenic
1041428095 8:57746170-57746192 TTCTGTGTGGTCTCTCCCATAGG - Intergenic
1041863143 8:62536942-62536964 GGCTGTCTTTTCTCTCCTGATGG - Intronic
1045285071 8:100783511-100783533 TCCTGTCTGTTCTCTCCTTCTGG + Intergenic
1047934887 8:129767006-129767028 TGCTGGCTGGTCTCTCTGATTGG - Intronic
1048936975 8:139365530-139365552 TGCTGTTTGGTCTATCCAAATGG + Intergenic
1050031008 9:1385623-1385645 TCCTGTTTGGTCTCTCCCACTGG - Intergenic
1051133750 9:13894019-13894041 TTCTCTCTGGGCTCTGCTAAGGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1057586372 9:96332275-96332297 GGCTGTCTCTTCTCTCCTGACGG - Intronic
1059627583 9:116083932-116083954 TTCTGTGTGGTCTCTCCTGCAGG + Intergenic
1059635141 9:116163100-116163122 TGTTGACTGGTCTGTCCTCAAGG - Intronic
1060116470 9:120945240-120945262 TGCAGCCTGGTGTCTCCTCAGGG - Intergenic
1061480566 9:130895981-130896003 TGCTGTCTGCTCTCCTCCAAAGG - Intergenic
1189674328 X:43445093-43445115 TGCTGTTTGGTCCCTCCTCTTGG - Intergenic
1192124298 X:68487400-68487422 TGCTGACTGGTCTCACTTTAAGG - Intergenic
1195870473 X:109480333-109480355 TGGTGTTTGTTCTCTCTTAAGGG + Intronic
1197848275 X:130828211-130828233 TGCTTTGTGGTCTCTAGTAAAGG + Intronic
1197949499 X:131878865-131878887 TGTCTTCTGGTCTCTCCCAAAGG + Intergenic
1198147905 X:133876564-133876586 CCCTGTCTGGACTCTGCTAAAGG - Intronic
1200341471 X:155401398-155401420 TGATGTCTGATCTCACCCAAGGG - Intergenic