ID: 1106179976

View in Genome Browser
Species Human (GRCh38)
Location 13:27362166-27362188
Sequence GGCCAGCGGGTCATGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106179976_1106179987 26 Left 1106179976 13:27362166-27362188 CCCCAAGGCATGACCCGCTGGCC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1106179987 13:27362215-27362237 AGCTAGTCCCCAAACAAAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1106179976_1106179982 -8 Left 1106179976 13:27362166-27362188 CCCCAAGGCATGACCCGCTGGCC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1106179982 13:27362181-27362203 CGCTGGCCGCAGGCGCGCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 112
1106179976_1106179983 -3 Left 1106179976 13:27362166-27362188 CCCCAAGGCATGACCCGCTGGCC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1106179983 13:27362186-27362208 GCCGCAGGCGCGCCTAGGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106179976 Original CRISPR GGCCAGCGGGTCATGCCTTG GGG (reversed) Intergenic
902755213 1:18544962-18544984 CCCCAGAGGGTCTTGCCTTGGGG - Intergenic
904912668 1:33947133-33947155 GGCTGGAGGGTCCTGCCTTGAGG + Intronic
907663743 1:56416380-56416402 GGCCAGCGGGTCTGAACTTGAGG + Intergenic
907895536 1:58686476-58686498 GGCCAGGCAGTCATGCCTTACGG + Intronic
919904264 1:202067247-202067269 GGGCAGCGAGTCCTTCCTTGAGG - Intergenic
922470651 1:225875125-225875147 GGCCTGCGGGGCCTGCCTTCAGG - Intronic
1066034583 10:31468444-31468466 GGCCAGCAGGTGATGCCTGCAGG - Intronic
1070821381 10:79357264-79357286 AGCCAGCTGGACATCCCTTGGGG + Intergenic
1071273078 10:84026772-84026794 CCCCAGCAGGCCATGCCTTGTGG - Intergenic
1072841000 10:98773792-98773814 GGACAGTGGCTCATGCCTTTGGG + Intronic
1074316997 10:112369881-112369903 GGCCAGCGGGGCAGGCCTGCTGG - Intergenic
1079354653 11:19720121-19720143 GGGCAGCTGGCCATGCCTTGGGG - Intronic
1083554236 11:63613657-63613679 GGACAGCGGGACAGGCCTTGGGG - Intronic
1106179976 13:27362166-27362188 GGCCAGCGGGTCATGCCTTGGGG - Intergenic
1107484179 13:40810684-40810706 GCCCAGAGGGTCAGGCCTTTGGG + Intergenic
1110367973 13:74708971-74708993 GGCCAGCTGGTCCTCTCTTGCGG + Intergenic
1113568486 13:111336253-111336275 GGGCAGTGGGCCCTGCCTTGGGG + Intronic
1116911546 14:50471388-50471410 GGCCTGCAGGTCATGGCTAGGGG - Intronic
1124846540 15:33296785-33296807 GGCCAGCGTGGAATGACTTGAGG + Intergenic
1127329021 15:57920933-57920955 TGCCAGCAAGTCAGGCCTTGTGG - Intergenic
1129458359 15:75687656-75687678 GGCCAACGGCTCCAGCCTTGTGG - Exonic
1129725425 15:77899209-77899231 GGCCAACGGCTCCAGCCTTGTGG + Intergenic
1130254397 15:82319195-82319217 GGCCAGCGGGGCAGGCCTGCAGG - Intergenic
1130600568 15:85270775-85270797 GGCCAGCGGGGCAGGCCTGCAGG + Intergenic
1132941379 16:2510120-2510142 GGCCAGGGGCTCGTGACTTGTGG + Intronic
1135588784 16:23690845-23690867 GGCCAGGAGGCCATGCCCTGGGG - Exonic
1141159806 16:81621725-81621747 GGCCAGCTGTTCATCCCCTGTGG - Intronic
1142966614 17:3585741-3585763 GGCCAGAGGCTCAGGCCTCGTGG - Intronic
1144581923 17:16463996-16464018 GGCCTGGGTGTCATGCCTGGGGG + Intronic
1144831921 17:18136634-18136656 GGACAGTGTGTCCTGCCTTGGGG - Exonic
1145800831 17:27683763-27683785 GGCCAGGGAGCCATGCCTTATGG + Intergenic
1145811190 17:27765348-27765370 GGCCAGGGGGCCATGCCTTATGG + Intronic
1146710994 17:35041261-35041283 GGGCAGTGGGTGATGCCTTGTGG - Intronic
1152593866 17:81228918-81228940 GGCCATCGGGTCAGGCGTTCAGG + Exonic
1157195513 18:45617431-45617453 GGCCAGCGGGTCAGGCTGGGTGG - Intronic
1161778655 19:6277772-6277794 GCCCAGCGGGACTTGCCTGGAGG + Intronic
1162056264 19:8065946-8065968 GGCCATGGGGCCAGGCCTTGAGG - Exonic
1162458986 19:10803184-10803206 GGCCACTGGGCCTTGCCTTGAGG + Intronic
1163397994 19:17075437-17075459 AGCCGGCGGGTCGGGCCTTGAGG - Exonic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163530140 19:17843997-17844019 GAACAGCTGGTCATACCTTGAGG - Intronic
1163655919 19:18544654-18544676 GGGCACCTGGTCTTGCCTTGGGG - Intergenic
1163830288 19:19544289-19544311 GGCGAGCTGGTCCTGCCTTCTGG + Exonic
1164432014 19:28197114-28197136 GCACAGCTGGTCATTCCTTGAGG - Intergenic
926914161 2:17877627-17877649 GGTCAGCGGGTGCTGGCTTGGGG + Intergenic
927338992 2:21959207-21959229 GGCCAGCGTGTCATGTCTCGAGG + Intergenic
932474431 2:71992995-71993017 AGCCAGCGTGTCATCCCTTTGGG + Intergenic
934092973 2:88570417-88570439 GGCCGGCAGGTGTTGCCTTGTGG - Intronic
935894576 2:107720654-107720676 GGCAAGCTGGACATGCCTTCTGG + Intergenic
942365441 2:175221434-175221456 GGGCAACCGGTTATGCCTTGAGG + Intergenic
942566084 2:177265273-177265295 GGCCAGTGGGCCCTGCCTAGGGG + Intronic
948266087 2:236636151-236636173 GGCCAGAGGGTCATTTGTTGGGG + Intergenic
1172228896 20:33323806-33323828 GGCCAGGTGCTCAGGCCTTGAGG - Intergenic
1175324740 20:58115568-58115590 GCCTAGCAGGTCATGTCTTGGGG - Intergenic
1175903857 20:62370411-62370433 GGCCTGCGGGTGAGGCCTTGTGG + Intergenic
1178358682 21:31930520-31930542 GGCCAGGGGGCCAAGCCTGGAGG - Intronic
1180605207 22:17053582-17053604 GGACAGTGGCTCATGCCTTTGGG + Intergenic
1181119147 22:20653887-20653909 GGCCAGGTGGTCATGTCCTGTGG + Intergenic
1183079427 22:35447078-35447100 GGCCAGCAGGACCAGCCTTGGGG - Intergenic
1183600648 22:38838465-38838487 GGTCAGCAGGACAAGCCTTGAGG + Intronic
1184752980 22:46499792-46499814 GGCCAGCGCCTAATGGCTTGGGG - Intronic
950227601 3:11248747-11248769 GCCCTGCGGGTCAGCCCTTGAGG - Intronic
953958178 3:47247289-47247311 GGCCAGCAGAGCATGCGTTGGGG + Intronic
968487644 4:871607-871629 GGTCAGCAGGGCCTGCCTTGGGG + Intronic
970194987 4:13544057-13544079 GGCCAGCGGGGCCGGCCTTGCGG - Exonic
976901127 4:90177607-90177629 GGGCAGTGGGTGATGACTTGAGG - Intronic
978739424 4:112120248-112120270 GGCCAGGGGGTCATTTCCTGGGG - Intergenic
984127419 4:175829203-175829225 GCCCAGTGGCTCATGCCTGGTGG - Intronic
994146354 5:96400120-96400142 GGCCAGCGGGTCATACTCAGAGG + Exonic
996017602 5:118557766-118557788 CTCCAGAAGGTCATGCCTTGTGG - Intergenic
996777062 5:127143866-127143888 GGACAGCGGGTCATTTATTGGGG - Intergenic
997248234 5:132369733-132369755 TGCCAGCGGGGCGCGCCTTGCGG + Exonic
1006392598 6:33767413-33767435 GCCCAGCTGGAGATGCCTTGTGG - Intergenic
1014372833 6:120633933-120633955 GGCCAGCGGGTGAGGACATGGGG + Intergenic
1018153730 6:160965523-160965545 GTCCAGCTGGTTATGGCTTGGGG - Intergenic
1019351437 7:555928-555950 GGGCATCTGGTCATGCATTGAGG - Intronic
1030350292 7:108477572-108477594 GGCCACTGGGCCTTGCCTTGAGG - Intronic
1032502829 7:132412857-132412879 GGCCAGCGTGTCCTGCATGGAGG - Intronic
1034647899 7:152664761-152664783 GGCCACCTGGACATTCCTTGGGG - Intronic
1035261950 7:157667558-157667580 GGCCAGAGGGTCATCCAGTGCGG - Intronic
1036605926 8:10305691-10305713 GCACAGTGGTTCATGCCTTGTGG - Intronic
1037814059 8:22102700-22102722 GGCCACAGGGTCAAGCCTCGTGG + Intronic
1037881970 8:22578004-22578026 GGCCAGGCGGTCATGCCGGGAGG + Intergenic
1039779097 8:40766164-40766186 GGCAAGCGGATCATGCCAAGGGG - Intronic
1045606299 8:103781060-103781082 GGCCAGGGGCTCATGCCCAGGGG + Intronic
1049556186 8:143283402-143283424 GGCCAGCAGCTCCTGCTTTGAGG - Intergenic
1055485882 9:76755999-76756021 GGCCAGGGGATCATACTTTGAGG + Intronic
1055998934 9:82193688-82193710 GGCCAGCTGGCCATGCCGTGCGG - Intergenic
1062001159 9:134216395-134216417 GGCCAGCGGGGCGGGCCTCGAGG + Intergenic
1062413061 9:136434431-136434453 GGCCAGCGGGGCACGCGTAGGGG - Intronic
1203769068 EBV:40062-40084 GGCAAGCGGGGCACGCCCTGGGG - Intergenic
1186499292 X:10038415-10038437 GACCAGCGATTCATTCCTTGGGG + Intronic
1190881399 X:54495194-54495216 GGCCACCGGGTCTTGCCCTGCGG - Exonic
1193041903 X:77012873-77012895 GCCTAGCGTTTCATGCCTTGTGG - Intergenic
1200866258 Y:8046915-8046937 GGCCAGAGAGTCATGCCATTTGG - Intergenic