ID: 1106181690

View in Genome Browser
Species Human (GRCh38)
Location 13:27374730-27374752
Sequence CAGAAAACTGAGAAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106181690_1106181694 20 Left 1106181690 13:27374730-27374752 CCTGCCTACTTCTCAGTTTTCTG 0: 1
1: 0
2: 3
3: 42
4: 449
Right 1106181694 13:27374773-27374795 TGTTTTCCTGATTTCGCTCTAGG 0: 1
1: 1
2: 53
3: 239
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106181690 Original CRISPR CAGAAAACTGAGAAGTAGGC AGG (reversed) Intergenic
900916831 1:5645199-5645221 CGGGAGCCTGAGAAGTAGGCGGG + Intergenic
902421382 1:16283205-16283227 CAAATAACTGAGAAGTAGCAAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902636410 1:17737692-17737714 CAGAAAACTGAGGATTAGAGAGG + Intergenic
903286638 1:22281587-22281609 GAGGAGACTGAGAAGTTGGCTGG + Intergenic
903556926 1:24200818-24200840 CAGAAAACTGAGCCTTAGGCTGG + Intergenic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
904008685 1:27377715-27377737 CAGAAGAGTGAGAACTGGGCTGG - Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904482801 1:30804780-30804802 GAGAAAACTGAAAATCAGGCAGG + Intergenic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905535098 1:38715113-38715135 CAGAAAACTGAGAATCAGAGGGG - Intergenic
905813387 1:40929649-40929671 GAGAAAACTGAGACTTAGGGAGG + Intergenic
906258782 1:44370369-44370391 AAGGAAACTGAGATTTAGGCAGG - Intergenic
906601930 1:47137802-47137824 CTGAAACCAGAGAGGTAGGCTGG - Intronic
907981009 1:59480794-59480816 GAGGAAACAGAGAAGTAGGCAGG + Intronic
909008841 1:70309367-70309389 CTGAAAATTGGGGAGTAGGCTGG - Intronic
909230994 1:73089811-73089833 CAGAAAACTTAGAATTATGGTGG - Intergenic
909305762 1:74074907-74074929 CAAAAACCTGTGAGGTAGGCAGG + Intronic
909701876 1:78534053-78534075 TAGAATTCTGAGAAGTAGACAGG - Intronic
910744864 1:90562358-90562380 CTGACAACTAAGAAGGAGGCTGG + Intergenic
910954915 1:92692185-92692207 CAGAAATCTGATAAGTAAACAGG + Intronic
912387076 1:109276471-109276493 CACAAAACTTGGAACTAGGCCGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914775550 1:150731089-150731111 TTAAAAACTGAAAAGTAGGCTGG + Exonic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915676266 1:157535017-157535039 CAGAAACCTGAGAAGTTGCTTGG - Intronic
915690522 1:157684559-157684581 GAGAAAACTGAGACCTAGACAGG + Intronic
915770547 1:158417938-158417960 CACAACACTGACAAGTGGGCAGG - Intergenic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916891646 1:169117520-169117542 CAGAGACCTGATAAGTAGGAAGG + Intronic
917467140 1:175290010-175290032 CACAAAGGTCAGAAGTAGGCTGG - Intergenic
917477550 1:175381839-175381861 GAGATATCTGAGAAGCAGGCAGG - Intronic
917672381 1:177285322-177285344 TAAAAAATTGAGAAGTTGGCTGG + Intergenic
917929824 1:179815516-179815538 CAGGAAACTGGGGAGTAGGGCGG - Exonic
917930499 1:179819283-179819305 GAGAAAACTGAGAAGGAGAGAGG - Intergenic
917986913 1:180329962-180329984 AAGAAAACTGAGGAGTGGGCTGG - Intronic
918134961 1:181663615-181663637 CAGAGAACTGAGGAAGAGGCTGG + Intronic
919007066 1:191911138-191911160 CAGGAAACTTAGAAGTATGGTGG + Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919816604 1:201444752-201444774 TGGAAAACTGTGAAGGAGGCTGG - Intergenic
919984972 1:202667116-202667138 TAGAGAACTGAGAAGTAAGGCGG + Intronic
920061121 1:203227735-203227757 CAGAAAGCCCAGAAGTAGCCTGG + Intronic
920062470 1:203237053-203237075 CACAAGGCTGAGAGGTAGGCGGG - Intronic
921660355 1:217793817-217793839 GTGAAAACTGAAAAGGAGGCCGG + Intronic
921865535 1:220084033-220084055 TAGAAAACAGAGAAATAGGGCGG + Intronic
924237697 1:242013057-242013079 CAGAAAAGTAAAAACTAGGCCGG + Intergenic
924407684 1:243768539-243768561 TAAAAAACTGAGATATAGGCCGG + Intronic
924859623 1:247907727-247907749 CTGAAAACTGTGAATGAGGCCGG - Intergenic
1063212948 10:3897876-3897898 CAGAAATCTGAAATGGAGGCTGG - Intergenic
1063554671 10:7066744-7066766 CAGCAAACTGTGATGTAAGCTGG - Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064133809 10:12732911-12732933 GAGGAAACTGAGAAGGAGGGAGG - Intronic
1066079904 10:31920155-31920177 TAGAAAACTGAAAATTAGCCGGG + Intronic
1066387384 10:34952706-34952728 CATAAAACTGCGTATTAGGCTGG - Intergenic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068757936 10:60675376-60675398 CAGAAAACTGGGAAGATGGGTGG - Intronic
1069525205 10:69164061-69164083 AAGAAAACTGAAAATTAGGCCGG - Intronic
1069720566 10:70547160-70547182 CTGAGAACTGAGGAGCAGGCAGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070124231 10:73607532-73607554 TTAAAAACTAAGAAGTAGGCCGG + Intronic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070517680 10:77223571-77223593 CAGAAAACTCAGAAGCCGGGAGG + Intronic
1071428160 10:85580435-85580457 CAGAATACTGAGAACTAAGCAGG - Intergenic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1072887314 10:99290009-99290031 CAGAAGACTCAGAGGTAAGCAGG + Intergenic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1075613547 10:123874157-123874179 TAGAAATGTGAGAAATAGGCTGG - Intronic
1076306384 10:129468095-129468117 CAGAGAGCTGAGAATTAGACTGG + Intronic
1077148176 11:1055173-1055195 AACAAAACTGAGAAGTGGCCTGG + Intergenic
1077736930 11:4801157-4801179 CAGAGAACTCAGAAGAAGACAGG - Intronic
1078186685 11:9057826-9057848 TAGAAATCTCAGAATTAGGCTGG - Intronic
1078386749 11:10899269-10899291 CAGAAATCTGAGAACCAGGGAGG + Intergenic
1079158310 11:17969489-17969511 CAGAAAAGCTAGTAGTAGGCTGG + Intronic
1080666009 11:34337067-34337089 CAGTAAACTGAGAAGCAGTAGGG - Intronic
1080918672 11:36686823-36686845 GAGATAACTGAGAATGAGGCTGG - Intergenic
1080920829 11:36707892-36707914 CAGTAAAGTGAGAAATAGACTGG + Intergenic
1081821127 11:45996103-45996125 CAGAAAACTTAAAAATTGGCTGG - Intronic
1082647446 11:55745891-55745913 GAGAAAACTGAGATGTAGAAAGG - Intergenic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1086568175 11:88250759-88250781 CAGACAATTGAGAGATAGGCTGG - Intergenic
1086625884 11:88952056-88952078 CTGACACCTGAGAAGTTGGCTGG - Intronic
1086654962 11:89343034-89343056 CAGAAAGCAGACAAGTAGGAAGG - Intronic
1088003752 11:104915451-104915473 GTGAATACTGAAAAGTAGGCTGG - Intergenic
1088861884 11:113808016-113808038 CAGAGACCTCAGAATTAGGCTGG + Intronic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089313763 11:117576847-117576869 CAGATAATTGAGAACCAGGCAGG + Intronic
1089353370 11:117833988-117834010 CAAAAAACAGAGAGGTAGGAGGG + Intronic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089663790 11:120003673-120003695 CAGAAAACTGAGAGGCATCCTGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090734207 11:129597245-129597267 CATAAAACTTAGAAGGGGGCTGG + Intergenic
1091007665 11:131968199-131968221 CAAAAAACTAAGACGTAAGCAGG + Intronic
1091158069 11:133392473-133392495 CAGAATCCTAAGAAGAAGGCTGG + Intronic
1091434946 12:464989-465011 CAGTAATCTGAGATGCAGGCAGG + Intronic
1091439753 12:503473-503495 CAGAAATCTGAGATGCAGACAGG - Intronic
1092367448 12:7888897-7888919 CAGAGACCTGAGAAGTAAGTAGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1093015678 12:14152236-14152258 GAGAAAACTGAGAATTAGAAAGG + Intergenic
1093287110 12:17277367-17277389 CAGAAAAGTGAGGAGTGGGGAGG + Intergenic
1093994359 12:25625648-25625670 CAGAAAGATGAGTAGTAAGCCGG - Intronic
1094324619 12:29223329-29223351 CATAAAACTGGGAGGTAGGTAGG + Intronic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1095936557 12:47689743-47689765 CATAAAACCAAGAAGCAGGCCGG + Intronic
1096247192 12:49998104-49998126 CAGAAAACTTGGATGTTGGCAGG + Intronic
1096248190 12:50008493-50008515 CTCAAAAGTGAAAAGTAGGCTGG - Intronic
1096486519 12:51985694-51985716 CAGAGAGCTGTGAAGGAGGCAGG + Intronic
1096824367 12:54263437-54263459 CAGAAAAACAAGAGGTAGGCCGG + Intronic
1097212328 12:57381730-57381752 CAGGAAAGTGAGAATTAGGTGGG + Intronic
1098537723 12:71613651-71613673 CAGAACACTGACAAGAAGCCAGG + Intronic
1098771719 12:74560727-74560749 CAGAAAACTTAGAAGCATGGTGG + Intergenic
1100129618 12:91475244-91475266 AAGAAAACAGAGATGTACGCAGG - Intergenic
1100956165 12:99911086-99911108 GAGAAAACTGAGATTTAGGGTGG + Intronic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102371884 12:112388683-112388705 CAGAAAACTGGGAAACAGGTAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102845300 12:116174907-116174929 TAGAAAACTAAAAATTAGGCGGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103586449 12:121959784-121959806 CAGAAAACTGAAAAGGTAGCGGG - Intronic
1104850447 12:131870827-131870849 CACAAAACAGAGAACTAGCCTGG - Intergenic
1105488228 13:20859170-20859192 TAAAAAACTGAAAAGGAGGCTGG + Intronic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106661610 13:31805810-31805832 CAGAAAACTGATATATAGGCCGG - Intergenic
1107646012 13:42495216-42495238 CAGATATCTGAGAAATATGCTGG - Intergenic
1107785219 13:43948983-43949005 CAGAAAACTGGGAATAAGGGAGG + Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1109811164 13:67514485-67514507 GAGAAAACTGTGAAGTAGATTGG - Intergenic
1109899354 13:68744584-68744606 AAGGAAACTGAGGAGTAGACAGG + Intergenic
1110041343 13:70763194-70763216 TAGAGAAGTAAGAAGTAGGCGGG + Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1110773817 13:79382749-79382771 CAGAAAACTGAGAACTAGACAGG + Intronic
1111025826 13:82521575-82521597 AAGAAAAATGAGCAGTAGACTGG - Intergenic
1111608454 13:90571838-90571860 CAGATAAGTGAGAAATAGGATGG + Intergenic
1111887294 13:94038589-94038611 GAGAAAACTGAGATTTATGCAGG - Intronic
1112093079 13:96103375-96103397 CAGGAAACTGATATGTTGGCAGG - Intronic
1112414902 13:99195907-99195929 CAAAAAAATGAAAAATAGGCCGG + Intergenic
1114473043 14:22976942-22976964 TAGAAAACTGTTAAGGAGGCAGG - Intronic
1115072223 14:29337579-29337601 TAAAAAACTGAGAAGTAGATAGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115422252 14:33209511-33209533 CAGAGATCTGACAAGTATGCAGG + Intronic
1117146316 14:52839907-52839929 AAGAAAACATAGGAGTAGGCTGG - Intergenic
1117528709 14:56637980-56638002 GAGCAAGCTGGGAAGTAGGCTGG + Intronic
1117592890 14:57293022-57293044 CAGATAACTGAGAAAAAGGCAGG - Exonic
1118384335 14:65243275-65243297 GAGAGGACTGAGAAGTAGGCAGG + Intergenic
1118413348 14:65505606-65505628 AATAAAACTGAGATGTAGGCCGG - Intronic
1118484070 14:66197303-66197325 CAGAAACCTGAGCAGCAAGCAGG + Intergenic
1120071539 14:80108800-80108822 TAGAACTCTGTGAAGTAGGCAGG - Intergenic
1120510769 14:85411550-85411572 TAGAGAATTGAGAATTAGGCAGG + Intergenic
1120762793 14:88301103-88301125 CAGAACACTGAGACTTAGGGAGG - Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1122187637 14:100013450-100013472 GAGGAAACTGAGACTTAGGCTGG + Intronic
1122495918 14:102155195-102155217 AAAAAAACAGTGAAGTAGGCAGG - Intronic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1124334572 15:28847461-28847483 TAGAAAAGTAAAAAGTAGGCAGG + Intergenic
1124641569 15:31399459-31399481 CAAAAAACTCAGAGATAGGCTGG - Intronic
1125192539 15:37010381-37010403 CTGAAAACAAAGAAATAGGCCGG - Intronic
1126004626 15:44244385-44244407 CAGAAAAGTGACCTGTAGGCTGG - Intergenic
1126016112 15:44352614-44352636 CAGAAAAGTGAAGAGTAGCCAGG + Intronic
1126621489 15:50644852-50644874 CATAAAACTGAGTAGAAGACTGG + Intronic
1128131375 15:65229328-65229350 CAGAAAACAACAAAGTAGGCCGG + Intergenic
1128990543 15:72256091-72256113 TATACAAATGAGAAGTAGGCTGG - Intronic
1129344989 15:74911735-74911757 GAGATAAATGAGAAGCAGGCAGG + Intergenic
1130546247 15:84859074-84859096 CAGAAGCCTGAGATATAGGCAGG + Intronic
1132192492 15:99879235-99879257 CAAAAAACTGAAAAGAAGGGAGG + Intergenic
1133741107 16:8652160-8652182 GATAAAAGTGAGATGTAGGCCGG + Intergenic
1134196953 16:12166597-12166619 CAGCCACCTGAGAAGTAGGTGGG - Intronic
1135180508 16:20269750-20269772 CAGTAAACAGAGATGTAGGCAGG - Intergenic
1135479391 16:22809734-22809756 CACAAAATTAAGAAGAAGGCTGG - Intergenic
1135497386 16:22964356-22964378 CAGAAAACTGAGTCTTCGGCCGG - Intergenic
1136052516 16:27662228-27662250 CAGGAAATTGTGAATTAGGCTGG - Intronic
1137944564 16:52721439-52721461 GAGGAAGCTGAGAAGGAGGCAGG - Intergenic
1138796233 16:59972552-59972574 CAGAAAACTGAAAAGTAAAATGG + Intergenic
1138993209 16:62417446-62417468 CAGTTAGCTGGGAAGTAGGCAGG + Intergenic
1140286559 16:73607964-73607986 CAGGAAGCTGAGAGGTAGGTGGG + Intergenic
1140659515 16:77174406-77174428 CAGAAAACTGAGGAGAGAGCTGG + Intergenic
1140761568 16:78113562-78113584 CAGAAAAGTGAGAACTAGCCAGG - Intronic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1141776471 16:86126428-86126450 TTAAAAAATGAGAAGTAGGCTGG + Intergenic
1141937194 16:87248623-87248645 AAAAAAACTGACAAATAGGCTGG - Intronic
1143206347 17:5142892-5142914 TAGAATACAAAGAAGTAGGCTGG + Intronic
1143303506 17:5928292-5928314 CAGAAGCCTGAGCAGCAGGCTGG + Intronic
1143995238 17:11000978-11001000 CAGAAAACTATGAAGAAGGCAGG - Intergenic
1144998784 17:19289041-19289063 CAGAAATCTGGGCAGTAGCCAGG + Intronic
1145977962 17:28995167-28995189 AAGAAAAGTGACAAGTCGGCCGG - Intronic
1146187085 17:30731244-30731266 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146332120 17:31936604-31936626 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146342596 17:32033989-32034011 CAGGAGACTGACAAGTAGACAGG + Intronic
1147018337 17:37510490-37510512 CAAAAAGCTGAGATTTAGGCCGG + Intronic
1147288619 17:39423159-39423181 CAGAAATCTCAGAAATGGGCTGG - Intronic
1148149761 17:45389617-45389639 CAGGAAACAGAGACGTTGGCAGG - Intergenic
1148180129 17:45599376-45599398 CAGGAGACTGACAAGTAGACAGG - Intergenic
1148226663 17:45902944-45902966 CAGAAAACTGGGCCATAGGCTGG - Intronic
1148268768 17:46246519-46246541 CAGGAGACTGACAAGTAGACAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148905689 17:50910383-50910405 GAGAAAACTGAGGTTTAGGCTGG - Intergenic
1149347186 17:55750965-55750987 CAGGAAACTGAGGAGAAGGCGGG - Exonic
1149831199 17:59873566-59873588 TAAAAAACTGAGATATAGGCCGG + Intronic
1149873896 17:60210601-60210623 TAGAATACAAAGAAGTAGGCTGG - Intronic
1150087674 17:62287862-62287884 TAGAATACAAAGAAGTAGGCTGG - Intergenic
1150669764 17:67182453-67182475 CAGAAAGATGAGAAGTGAGCAGG + Intronic
1151266013 17:72955603-72955625 AAGAAAACTGAAAAGTCAGCTGG - Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1153579770 18:6561239-6561261 CTTAAAACTGATGAGTAGGCCGG + Intronic
1153678145 18:7474112-7474134 CAGAAACCTGAAAAGGAGCCAGG - Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1153882319 18:9432273-9432295 AAGAAAATTGAGAATTAGCCAGG - Intergenic
1155092535 18:22525661-22525683 CATAATCCTGAGAAGTAGGTAGG - Intergenic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155640434 18:28007223-28007245 TATAAAACTGAGAACTGGGCTGG - Intronic
1156001511 18:32390003-32390025 CAAAAAATTGACAAGTTGGCCGG + Intronic
1156222183 18:35063834-35063856 CAAAAAAATGAAAAGTAAGCTGG + Intronic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157286894 18:46383066-46383088 CAGCATGCTGAGAAGAAGGCAGG - Intronic
1157436605 18:47675534-47675556 CTGAAAATTGAGAAATAAGCAGG - Intergenic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1159233170 18:65635423-65635445 CCTAAAAATGAGAAGTAGGGTGG + Intergenic
1159367742 18:67491438-67491460 CAGAACACTCAGAAGTAAACAGG + Intergenic
1159478160 18:68951509-68951531 CATAAAACTGACAGGTTGGCTGG + Intronic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1163010936 19:14425659-14425681 TAGAAAACTGCAAGGTAGGCTGG - Intergenic
1163720071 19:18894619-18894641 CTGGAAACTGGGAAGAAGGCAGG + Intronic
1163878424 19:19896551-19896573 CAGATTACTGACCAGTAGGCAGG + Intergenic
1164571505 19:29378074-29378096 AGGAAAAGTGAAAAGTAGGCAGG + Intergenic
1167571860 19:50293408-50293430 CAGGAAACTGGGAGGTGGGCGGG + Intronic
924992112 2:321137-321159 CAGAAAAATGAGAAGTGAGATGG - Intergenic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
925701938 2:6647566-6647588 CAGAAAACTGAGACACAGGAAGG - Intergenic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
926260465 2:11255621-11255643 CAGAAAAATGGAAACTAGGCCGG + Intronic
926767672 2:16336515-16336537 GAGAAAACTGAGATGTACACTGG - Intergenic
927221042 2:20710026-20710048 CAGTTAACTCTGAAGTAGGCAGG + Intronic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
929281092 2:40079884-40079906 TACAAACCTGTGAAGTAGGCAGG + Intergenic
929495909 2:42443353-42443375 CAAAGAATTGAGAAGTATGCTGG + Exonic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
931062513 2:58547090-58547112 CAAAAAGCTGAGAAGAGGGCTGG - Intergenic
931817874 2:65922420-65922442 CACAGAACTGAGGAGAAGGCTGG + Intergenic
932584979 2:73022071-73022093 CAGAGAACAGAGAATTAGGCTGG + Intronic
933970273 2:87464337-87464359 CAGCAAACTGGGGAGTAGCCAGG - Intergenic
935480566 2:103583008-103583030 AGGAAAACTGAGAAGAAGGGAGG - Intergenic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
936323508 2:111486159-111486181 CAGCAAACTGGGGAGTAGCCAGG + Intergenic
937197539 2:120172966-120172988 TAGAAAACTGAGAAGTACTCGGG + Intronic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937352685 2:121176162-121176184 AAGAAAACTGAGTTGTTGGCCGG - Intergenic
937667877 2:124507295-124507317 CAAAAAACTGAAAATTAGCCGGG + Intronic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
939772630 2:146340979-146341001 AAGAAAACTAAGAAGTAGGCAGG - Intergenic
940641616 2:156350399-156350421 CAGAAAACTCAGGAACAGGCAGG + Intergenic
941491208 2:166144305-166144327 GTGAAAACAGAGAAGTTGGCTGG + Intergenic
942515227 2:176745658-176745680 CAGAAAACTGAAAAGGAAGAGGG + Intergenic
944437654 2:199707206-199707228 CAGAAAATTGAGGAGTGGGGAGG - Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
947478201 2:230471250-230471272 CAGAAAAATGAGAAGTGAGAAGG + Intronic
947919182 2:233854581-233854603 TAGAAAACCGAGAGGAAGGCAGG - Intergenic
947991213 2:234489084-234489106 AACAATACTGAGAGGTAGGCAGG + Intergenic
948028349 2:234796674-234796696 CAAAAATGTGAGATGTAGGCTGG + Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172469216 20:35178809-35178831 AAAAAAACTGAGACTTAGGCCGG - Intergenic
1175166113 20:57045927-57045949 GAGATAGCTGAGAAGAAGGCTGG - Intergenic
1175854822 20:62114994-62115016 CAGGAAACTGGGGAATAGGCAGG - Intergenic
1176973607 21:15292414-15292436 CAGAAAACTTAGAAGTAACTAGG + Intergenic
1177679532 21:24347888-24347910 CAGAAAACTGATAAGAAATCAGG - Intergenic
1177713595 21:24811399-24811421 CTAAAAACTTAGAAGTAGACAGG - Intergenic
1177856667 21:26407539-26407561 CACAAATCAGATAAGTAGGCTGG - Intergenic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1183158936 22:36097510-36097532 CAGAAAGCAGAGTAGTGGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184769645 22:46589752-46589774 TAGAAACCTGAGGAGTGGGCTGG - Intronic
1185333977 22:50263367-50263389 CTGAACACTGAGGGGTAGGCGGG + Intergenic
949894649 3:8760204-8760226 CAGAAACCTGAGTTGTGGGCAGG + Intronic
950109655 3:10410823-10410845 CAGAGAACAGAGAGGTTGGCTGG + Intronic
950116181 3:10451445-10451467 CAGTAAACTGGGAAGTAGTCAGG - Intronic
950331553 3:12159744-12159766 TAGAAAACAAAGAAGCAGGCTGG + Intronic
950415089 3:12864562-12864584 CAGAAAACTGGGAAGTGGCTGGG - Intronic
951278021 3:20713206-20713228 CAGAGATCTGAGAAGGAGGTTGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951948758 3:28174040-28174062 CAGAACACTGAGAAGTTGAATGG - Intergenic
952211869 3:31236110-31236132 CAGAAGGCAGAGAAGTTGGCAGG + Intergenic
953020963 3:39112758-39112780 AAGAAATCTGAGAAGTAGAGTGG - Intronic
953096425 3:39781154-39781176 CAGAAAACAGGTTAGTAGGCAGG - Intergenic
953278667 3:41530591-41530613 CAGAGAACTCAGCTGTAGGCTGG - Intronic
953419956 3:42746843-42746865 CAGATAGCAGAGAAGAAGGCAGG + Intronic
953956164 3:47233792-47233814 CAGAAAACTGAGGGGAAGCCAGG + Intronic
953997932 3:47535172-47535194 AAAGAAAGTGAGAAGTAGGCTGG - Intergenic
954843749 3:53535703-53535725 CATAAAACTGAGATGAAAGCTGG + Intronic
955105838 3:55897191-55897213 CAGATAACTGAGAGAGAGGCTGG - Intronic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956074314 3:65488635-65488657 AAGAAAAGTGATGAGTAGGCCGG - Intronic
956529323 3:70200359-70200381 CAGAAGTCAGAGAAATAGGCAGG - Intergenic
956821933 3:72961830-72961852 TAGAAAACTGAGATGTGGGTAGG + Intronic
957813333 3:85257072-85257094 AAGAAAATTGAGAAATAGGGAGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958479506 3:94628537-94628559 CAGAAAGCTGAGAAGGAAGTAGG + Intergenic
959630416 3:108501125-108501147 CAGAAAGCTGAGGAGCAAGCTGG + Intronic
959676247 3:109039210-109039232 TAGAAATCAGAGAAGCAGGCGGG - Intronic
959982488 3:112531122-112531144 CAGAAAGCTGAGGAGTATACAGG + Intergenic
960183620 3:114612074-114612096 GGGAAAACAGAGAAGTAGGGAGG - Intronic
961123825 3:124397967-124397989 CAGCAAACTGTGAAGTGAGCAGG + Intronic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
961949374 3:130732108-130732130 CTGAGAACTGAGAATTAGACCGG + Intronic
962580031 3:136789906-136789928 AAGACAACAGTGAAGTAGGCTGG - Intergenic
962925851 3:139992790-139992812 CAGAAAATTGAGGAGTAGAAGGG + Intronic
963441820 3:145349574-145349596 TAGAAAATTGAGAAGCAAGCAGG + Intergenic
963898210 3:150708294-150708316 CAGAAAACTAAAAATTAGCCAGG - Intergenic
964607818 3:158576631-158576653 TAGAAAGCTCAGAAGCAGGCTGG + Intronic
964724803 3:159803745-159803767 AAGAAAACAGAGAAGTAGCCAGG - Intronic
966929528 3:184666862-184666884 CGGAAACCAGAGAAGGAGGCTGG + Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
968352167 3:198066916-198066938 GAGAAAACCCAGAAGTATGCAGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969994722 4:11300049-11300071 CAGCATCCTGAGATGTAGGCTGG + Intergenic
971417197 4:26442644-26442666 AGGAAGACTGAGAAGTAGGAAGG - Intergenic
972068421 4:34982325-34982347 CCAAAATCTGAGCAGTAGGCTGG - Intergenic
973080820 4:45990796-45990818 GAGAAAACTGAGACGTAGACAGG - Intergenic
974813245 4:66972796-66972818 AAGAAAAGTGAGAGTTAGGCAGG - Intergenic
975127838 4:70802080-70802102 GAGAAAACTGAGAAGCAGAGAGG + Intronic
975641451 4:76504453-76504475 TAAAAAACTGATAAGTCGGCCGG - Intronic
976334059 4:83865235-83865257 CAGAAAACTTAAAAGAAGGCGGG - Intergenic
976358810 4:84153540-84153562 CAGAACACTGGAAACTAGGCGGG - Intergenic
976595231 4:86889605-86889627 TAGAAAACTGAAGAGTAGGCTGG + Intronic
978070323 4:104459621-104459643 CAGAAAACTGAGATCTTAGCTGG - Intergenic
978234779 4:106445847-106445869 CAGAAAACTGAAAACCATGCTGG + Intergenic
978326062 4:107557530-107557552 CAGAAAACAGAGAAATAGCAGGG - Intergenic
978934881 4:114362022-114362044 GAAAAAACTGAGAGGTAAGCTGG + Intergenic
979527669 4:121734566-121734588 AAGAAAACTGAAAAGTATTCAGG + Intergenic
980027612 4:127784221-127784243 GAAAAAACTGAGAGGTAGGGTGG + Intronic
981279936 4:142945913-142945935 CAGAACACTGAGAAGAATGTGGG + Intergenic
983226846 4:165093664-165093686 CACAAAACTGATAAGGAGGCTGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
985001716 4:185491616-185491638 CAGAAAACAGACAGGCAGGCTGG - Intergenic
985736215 5:1585016-1585038 CAGAAAACTTGGAACTAAGCTGG - Intergenic
986138323 5:5004802-5004824 CAGAAAACTGACAATTATGATGG - Intergenic
986393426 5:7305472-7305494 TAGAAAAGTAAGAAGTAGGCAGG + Intergenic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987498849 5:18680615-18680637 TAGAAAATTGAGAAGTGAGCCGG + Intergenic
990204813 5:53417203-53417225 CTAAAAACTGATATGTAGGCTGG - Intergenic
990240450 5:53811524-53811546 CAGAACAGTGAGAGTTAGGCAGG - Intergenic
991479707 5:67064245-67064267 CAGAAACCTGAGATGCAGGAGGG + Intronic
991515264 5:67428055-67428077 AAGAAAACTAAGAAATAGGCGGG - Intergenic
992270470 5:75057575-75057597 CAGAACACTGAGAAGTTGAGGGG + Intergenic
992634981 5:78718583-78718605 GAGAAAACTGAGGTGTGGGCAGG - Intronic
992892432 5:81215565-81215587 TAAAGAACTGACAAGTAGGCCGG - Intronic
994801262 5:104380196-104380218 AATAAAACTGAGCAGGAGGCAGG + Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996397386 5:123026896-123026918 TAGAAAACCCAGAAGTAGGCTGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
998050579 5:139029793-139029815 CAGAAAACTAAAAACTTGGCTGG - Intronic
998831882 5:146168399-146168421 CAGAAAACTGAAACGGAGGCTGG + Intronic
999530165 5:152454429-152454451 CAAAAAAATGAGAAGTAGCAAGG - Intergenic
999539177 5:152553324-152553346 TAAAAATCTGAGAGGTAGGCCGG + Intergenic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1001047278 5:168384198-168384220 GAGAAAACTGAGACGTAGAGAGG - Intronic
1001462156 5:171925385-171925407 CAGAAAATTGAACAGTAGCCTGG - Intronic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1002085881 5:176775037-176775059 CAGCAAACTGAGGAGGAGGGAGG - Intergenic
1002254403 5:177948689-177948711 GAGAAAACTGAGACTTAGGGAGG + Intergenic
1002320721 5:178373986-178374008 GAGAAAACTGAGAAGTTGAAGGG - Intronic
1002462038 5:179378755-179378777 CAGGGATCTGAGAAGCAGGCAGG - Intergenic
1002483590 5:179519123-179519145 GAGAAAACTGAGACTTAGGGAGG - Intergenic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003256055 6:4475836-4475858 CAGCAAACTGAGAAGATGGTGGG + Intergenic
1003574047 6:7276588-7276610 CAAAAAACATAGAAGTGGGCCGG + Intronic
1003839613 6:10106529-10106551 CACAAAACTGAGAAGTAGAGGGG + Intronic
1005884544 6:30086621-30086643 GAGAAAACTGAGAAGATGGGGGG - Intergenic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006309193 6:33245387-33245409 CAAAAAACTAAAAACTAGGCAGG + Intergenic
1006352064 6:33528175-33528197 AAGAAAACTGAAAACTCGGCTGG - Intergenic
1006498555 6:34441904-34441926 CAAAAGACTGAAGAGTAGGCTGG - Intergenic
1006697716 6:35945533-35945555 CACAAAGCTGAGCAGTAGTCAGG - Intronic
1007281430 6:40715138-40715160 CAGCAAACAGAGAAATAGGGAGG - Intergenic
1007943726 6:45806324-45806346 CAGAAAACAGACAAGTAAGGTGG + Intergenic
1008038639 6:46774018-46774040 CAGAAAACTAAAAGGGAGGCTGG + Intergenic
1008957594 6:57232889-57232911 CAGCAAACTGAGAAGTACTAAGG + Intergenic
1010322162 6:74524556-74524578 GAGAGAACTGAGGAGAAGGCAGG + Intergenic
1010518713 6:76806541-76806563 CAGAAAACTGAACTGTAAGCAGG - Intergenic
1010917174 6:81634401-81634423 CAGAATACTGAGTGGTAAGCAGG - Intronic
1010963405 6:82174139-82174161 GAGAAAACTGAGGACTAGACAGG + Intronic
1011644315 6:89443230-89443252 AAGAAACCTGAAAAATAGGCAGG - Intronic
1011725287 6:90204812-90204834 TAGAATACTGGAAAGTAGGCAGG - Intronic
1011771578 6:90679131-90679153 AAGAAAACTGAGAATTCTGCAGG - Intergenic
1012045756 6:94270995-94271017 TTCAAAACTGAGATGTAGGCAGG + Intergenic
1013999947 6:116353624-116353646 CAGAAAACTGAGATTTGGGGAGG + Intronic
1015147734 6:130006087-130006109 CAGAAAAGTGAGGAGTTGCCAGG - Intergenic
1015291947 6:131547458-131547480 CATAGAACTGAGAAGTATGAAGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1015955382 6:138592672-138592694 GTGAAAACTGACAAGTATGCAGG + Intronic
1018693562 6:166370555-166370577 AAGAAAACTAAAAAGAAGGCCGG + Intronic
1022163215 7:27732599-27732621 CTGAGAACTGAAAAGTAGGTTGG + Intergenic
1023585429 7:41725093-41725115 CAGAAAACTGAGTCTCAGGCTGG - Intergenic
1024099191 7:46011639-46011661 CAAAATACTGAGAAATAGTCAGG + Intergenic
1024171936 7:46797876-46797898 CAGAAAACTTAGAAGCATGGTGG + Intergenic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1026135251 7:67654662-67654684 CAGAAGACTGTGATGTTGGCTGG + Intergenic
1028191776 7:87862148-87862170 CAGAAAAAAGATAAGTAGGTTGG - Intronic
1028247243 7:88494966-88494988 AAGAAAACTGAGATGTAGAGAGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028328048 7:89550680-89550702 CAAAATGCTGAGAAGTTGGCTGG + Intergenic
1028716813 7:93980236-93980258 CAGAAAACTGAATAGGAGGAAGG + Intronic
1029746981 7:102521435-102521457 CAGAAAACTGGATAGGAGGCAGG + Intergenic
1029764934 7:102620524-102620546 CAGAAAACTGGATAGGAGGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031240075 7:119226853-119226875 TAGAAAACTGAGAATCAGACAGG + Intergenic
1031315766 7:120256100-120256122 CAGAAAACTTACAAGTGGCCAGG - Intergenic
1031659411 7:124402151-124402173 CAAAATACTGCTAAGTAGGCAGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032475597 7:132209513-132209535 CAGAAATCTGAGAAATAGCCTGG + Intronic
1033408127 7:141090351-141090373 TAAAAGACTTAGAAGTAGGCTGG - Intronic
1035066683 7:156110147-156110169 CAGAATACTGACAACTATGCTGG - Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1037512777 8:19600374-19600396 TACAAAATAGAGAAGTAGGCTGG - Intronic
1037801785 8:22039996-22040018 AAGGGAACTGAGAAGTAGCCTGG - Intergenic
1037937047 8:22921925-22921947 GGGAAAACTGAGAGGTAGGGAGG + Intronic
1038234522 8:25739033-25739055 CAGGAACCTGAGATTTAGGCAGG - Intergenic
1039379579 8:37072470-37072492 GAGAAAACTGAGTCGTAGGGAGG - Intergenic
1039616439 8:38958352-38958374 TAAAAAACTGACAAGTAAGCAGG + Intronic
1040330698 8:46384321-46384343 AAGAAAACGGAGAAGCAGGGTGG + Intergenic
1040485249 8:47865089-47865111 TATAAAACTCAGAAGTTGGCTGG + Intronic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1041237420 8:55818440-55818462 TAGAAAACTGGGAATCAGGCTGG - Intronic
1042145963 8:65730629-65730651 CTAAAAACAGAGAACTAGGCTGG + Intronic
1042961191 8:74305434-74305456 CAGAAAACATAGGAGTAGGGTGG + Intronic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1044654001 8:94528824-94528846 CAGAAAACTGAGATACAGTCAGG + Intronic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1046223544 8:111246662-111246684 AAAAAAATTGATAAGTAGGCAGG + Intergenic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1049442727 8:142616645-142616667 CAGCAAGCTGACAAGGAGGCAGG + Intergenic
1049462115 8:142735069-142735091 CAGAAACCCGTGAAGTTGGCAGG - Intronic
1049827725 8:144680380-144680402 CAGAAAACACAGAAATAAGCAGG + Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1051517739 9:17949596-17949618 CATAGCACTGAGAACTAGGCTGG - Intergenic
1052313870 9:27096532-27096554 CAGAGAACTCAGAAGAAGACAGG + Intergenic
1052569645 9:30203021-30203043 CAGAAGACTGAGAAGTACATGGG + Intergenic
1053216448 9:36274581-36274603 CAGAGAAGTTGGAAGTAGGCAGG - Intronic
1053247939 9:36550519-36550541 CAGAAAAATGAAAATTAGCCAGG + Intergenic
1053369737 9:37550766-37550788 TTGAGAACTGAGAAATAGGCTGG - Intronic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1055562056 9:77530881-77530903 CAGAAAACTGGTAATTAGTCAGG + Intronic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1057154118 9:92825379-92825401 GAGAAAACTCAGAAGCATGCAGG + Intergenic
1057574223 9:96228687-96228709 CAGAGAAGTGGCAAGTAGGCAGG + Intergenic
1058816161 9:108684588-108684610 ATGTAAACTGAGAATTAGGCAGG + Intergenic
1059405786 9:114097895-114097917 GAGAAAACTGAGAGCTAGGAAGG + Intronic
1060022726 9:120146233-120146255 GAGAAAACTGAGACCCAGGCAGG - Intergenic
1060189507 9:121583089-121583111 TAGAAAACGGAGAAGCTGGCCGG + Intronic
1061082147 9:128377946-128377968 CAGAAAACTGAGGATAGGGCTGG - Intronic
1061210682 9:129190784-129190806 AAGAAAACTGAGACTCAGGCTGG + Intergenic
1061269528 9:129530124-129530146 TAGAAAACTAAGAAGTCGGCCGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061648850 9:132029765-132029787 CAGAAATCTGGGAACAAGGCAGG + Intronic
1061690336 9:132322404-132322426 CAGAAAGATGAGTAGTAGTCAGG - Intronic
1189370852 X:40427890-40427912 CAAAAATCAGAGAAGTTGGCCGG - Intergenic
1189645560 X:43125782-43125804 CCAAAAACTGAGGAATAGGCTGG - Intergenic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1190059131 X:47199633-47199655 GAGAAAACTGGGCAGAAGGCTGG - Intronic
1190483854 X:50904670-50904692 AAGAAAACTGAGAAGCAGAGAGG + Intergenic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1193969012 X:88027317-88027339 AAGTATACTGAGAAGTAGACAGG + Intergenic
1194558888 X:95396433-95396455 CACATAACTAAGAAGAAGGCAGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1196707927 X:118731760-118731782 GAGAAAACTGAGAAATAGAGAGG + Intronic
1197798447 X:130322897-130322919 CAGCAAACGGAGAAGATGGCAGG - Intergenic
1197897813 X:131334336-131334358 CAGCAAGCTGACAATTAGGCAGG - Intronic
1198638440 X:138726845-138726867 GATAAAACTGAGAGGTAGGGAGG + Intronic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1201594338 Y:15651049-15651071 CAGAGAGTTGAGATGTAGGCAGG - Intergenic