ID: 1106186075

View in Genome Browser
Species Human (GRCh38)
Location 13:27411037-27411059
Sequence CAGGATAAGGGCTCTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106186067_1106186075 4 Left 1106186067 13:27411010-27411032 CCCATGGAAAATGAGGAAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 344
Right 1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 132
1106186069_1106186075 3 Left 1106186069 13:27411011-27411033 CCATGGAAAATGAGGAAAGGGGA 0: 1
1: 0
2: 3
3: 65
4: 480
Right 1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106186075 Original CRISPR CAGGATAAGGGCTCTGTAGC AGG Intergenic
900291100 1:1924024-1924046 CAGGACAGGGGCTCTGCAGGGGG - Intronic
900683486 1:3932024-3932046 CGAGATAAGGTCTCTGTATCAGG + Intergenic
901293850 1:8145689-8145711 CAGGATGAGGGCTCTCTTCCTGG - Intergenic
901476365 1:9492690-9492712 CAGGAAACTGGCTCTGTGGCAGG - Intergenic
901707024 1:11081682-11081704 CAGGGTAAGGGCTCCGTAACAGG + Intronic
902171403 1:14614482-14614504 AAGGATGAGAGCTCTGCAGCAGG + Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903757182 1:25670744-25670766 CAACATTTGGGCTCTGTAGCTGG - Intronic
903903337 1:26665028-26665050 CAGGATATGGGTTCTGATGCAGG + Intergenic
911581973 1:99644617-99644639 CAGAATGAGGGCTCTGTGGTTGG + Intergenic
912177111 1:107173068-107173090 CATCATAATGGCTCTGTAGTAGG + Intronic
913031904 1:114915825-114915847 TAGGATAAGTACTCTGTTGCCGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922235045 1:223716381-223716403 CTGGATAAGAGCTCTCTGGCAGG + Intronic
1064112893 10:12553645-12553667 AAGACTCAGGGCTCTGTAGCCGG - Intronic
1064274643 10:13894445-13894467 CTGGAAGAGGGTTCTGTAGCTGG - Intronic
1065428768 10:25632392-25632414 CTGGATAAGGACTGTGCAGCTGG - Intergenic
1066584389 10:36916199-36916221 CATTATAAGGGTTGTGTAGCTGG - Intergenic
1067844299 10:49707447-49707469 CTGTATATGGGCACTGTAGCTGG - Intronic
1070751178 10:78964955-78964977 CAGGTTAAGGGCTCTCAGGCTGG - Intergenic
1070832830 10:79430789-79430811 CAGGAGAAGGGCTTTGGAGAAGG - Intronic
1074307555 10:112292876-112292898 CAGGATAAAGGCCCTGGGGCAGG - Intronic
1076784482 10:132743055-132743077 CAGGATAAAAGCTCAGGAGCAGG + Intronic
1079274499 11:19021917-19021939 CAAGAAAAAGGCCCTGTAGCAGG - Intergenic
1080633826 11:34105871-34105893 CAGGATGAAGGCTCTGCATCCGG + Intronic
1082665551 11:55971409-55971431 GAGGACAACGGCTCTGCAGCAGG - Intergenic
1083350682 11:62026638-62026660 CAGAACAAGGGCTCTGTCACTGG - Intergenic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1087152038 11:94867954-94867976 CAGGATAAGGCCTGTCTCGCAGG + Intronic
1089228679 11:116949918-116949940 CAGAGTTAGGGCTCTGGAGCTGG + Intronic
1090914519 11:131151423-131151445 CAGGTTCAGGGCTCTGCAGAAGG + Intergenic
1091148890 11:133307319-133307341 CATGATAGGGGTTATGTAGCTGG + Intronic
1091852134 12:3708202-3708224 TTGGATAAGGGCTCTTTAGAGGG - Intronic
1092443793 12:8534265-8534287 CTGAATCCGGGCTCTGTAGCAGG - Exonic
1095162352 12:38933180-38933202 CAGCATAAAGGCTCTGTCTCGGG + Intergenic
1096188313 12:49598598-49598620 CAGGATAAAGCCTCTGCACCAGG - Intronic
1100506201 12:95223038-95223060 AAAGATATGGGCTCTGGAGCTGG + Intronic
1104044388 12:125151564-125151586 GAGGATAAGGGCTCTGAGGCTGG + Intergenic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1110375364 13:74787279-74787301 CAGGATGAGGTGACTGTAGCTGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113322938 13:109254542-109254564 CAGGAAAAGGGTTCAGAAGCAGG - Intergenic
1114840555 14:26257912-26257934 CAGGAGAAGGGCTGTGAACCAGG + Intergenic
1118258744 14:64227714-64227736 CAGGATAAGGGCCTTTAAGCTGG + Intronic
1119855494 14:77897360-77897382 CTGGATGATGGCTCTGTAGTGGG - Intronic
1122168622 14:99851961-99851983 CAGGGACAGAGCTCTGTAGCAGG - Intronic
1122859069 14:104574164-104574186 AAGGACAGGGGCTCTGTAGGGGG - Intronic
1126883564 15:53125219-53125241 CATGATAATAGCTCTGTACCAGG - Intergenic
1128154319 15:65383294-65383316 CAGGAGAAGGGCACTGGTGCTGG + Exonic
1129741633 15:77992371-77992393 CAGGATAGGTGCACTGGAGCAGG + Intronic
1130542376 15:84830284-84830306 CAGGATAACAGCTGTGTATCAGG - Intronic
1130939150 15:88493615-88493637 CAGGACAATGGGCCTGTAGCTGG - Intergenic
1131177187 15:90217484-90217506 CAGCAGAAGGGCTGTGTAGTTGG - Exonic
1132649995 16:1016304-1016326 CAGGAGGAGGGCTATGTAGATGG - Intergenic
1133882790 16:9798520-9798542 CAGGATCAGGCCTCAGGAGCTGG - Intronic
1134872112 16:17661462-17661484 CACCATAAGGGCTCAGTAGCTGG - Intergenic
1135853719 16:25987551-25987573 AAGGATATGGCCTCTGAAGCTGG + Intronic
1140028169 16:71311090-71311112 CTGGATCAGGGCTCGGTGGCCGG - Intergenic
1148197264 17:45723016-45723038 AAGGATAAGGGGTCTGTCACAGG - Intergenic
1153596159 18:6727413-6727435 GAGGAGGAGGGCTCCGTAGCTGG + Intergenic
1155451165 18:25964087-25964109 CGGGATGAGGGCTGTGTAGGAGG - Intergenic
1155568635 18:27165069-27165091 CAGGATAACAGCTGTGTAACAGG + Intronic
1159959803 18:74546589-74546611 CAGGACACAGGCTCTGAAGCAGG - Intronic
1161014496 19:1977033-1977055 CAGAATGAGGCCTCTGTGGCCGG - Intronic
1161432838 19:4243792-4243814 CAGGAAAAGGGGTCCCTAGCTGG + Intergenic
1163664207 19:18595362-18595384 CAGGATAGGGGCTGGGGAGCTGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
925477353 2:4232141-4232163 CAGGAAAAGGGGTGTGTTGCAGG + Intergenic
928874917 2:36026615-36026637 AAGGAGAAGGGCTCTGTGTCTGG + Intergenic
929969076 2:46558188-46558210 CAGGATAACAGCTGTGCAGCAGG - Intronic
930751805 2:54941790-54941812 CGAGAGAAGGGCTCTGGAGCAGG - Intronic
934129423 2:88933211-88933233 CAAAAAAAGGGCTCTGCAGCAGG + Intergenic
934819579 2:97360439-97360461 CTGGATAAGGGCTCTGGTTCAGG + Intergenic
936919065 2:117669394-117669416 CAGGCTAAGGGCTTGTTAGCTGG - Intergenic
938852782 2:135278512-135278534 CAGGATGAGAGCTCTGCAGCAGG + Intronic
939158801 2:138560528-138560550 CAGGATATGGGCTCTCCAGCTGG + Intronic
940913295 2:159227999-159228021 CTGGAGAAGGGCTCTGTTGCTGG - Intronic
948181011 2:235980313-235980335 CAGGATAAGTGCTTTTTAGTTGG + Intronic
1171467453 20:25339988-25340010 CAAGATAAGAACTCTGGAGCTGG - Intronic
1175347860 20:58295115-58295137 CAGGATAAGGGGGCTATAGATGG - Intergenic
1177902193 21:26930867-26930889 CAGGTTAATAGCTCTGTAGATGG + Intronic
1182206243 22:28630188-28630210 CAGGATTAGGCATCTGTATCTGG - Intronic
1183666169 22:39247231-39247253 CAGCATGTGGGCTCTGTAGCTGG - Intergenic
1184553473 22:45218656-45218678 AAGGATATGGGCTCTGTTGGAGG - Intronic
950449377 3:13057116-13057138 CAGGATAAGGCCTCTGTGTAAGG - Intronic
951076606 3:18401110-18401132 CAGGATGAGTGCTCTGCTGCAGG - Intronic
951266060 3:20568458-20568480 CAGGATAAGGGCTGGTTACCAGG - Intergenic
951341066 3:21487695-21487717 CAGGATCAGTCCTCTGAAGCTGG + Intronic
951863627 3:27281761-27281783 CATGATAATGGCTGTGCAGCAGG + Intronic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
953994803 3:47511743-47511765 CATGATCAGGCCTCTGAAGCAGG - Intronic
955074690 3:55602553-55602575 CAGGAGAAGCGCTCTGCCGCTGG + Intronic
955898587 3:63727143-63727165 CTGGAGAAGAGCTCTGGAGCTGG + Intergenic
956730391 3:72191005-72191027 TAGGATGAGGGGACTGTAGCCGG - Intergenic
961376799 3:126472591-126472613 CAGGATCAGTGCTCCGGAGCCGG - Intronic
962575650 3:136752638-136752660 CTGGATAAGGGCGCTGTGGACGG + Intergenic
963391646 3:144672601-144672623 CAGGACAAGTGCTTTGAAGCAGG - Intergenic
963735070 3:149009867-149009889 AAGAATAAGGGCTCTGGAGCTGG + Intronic
963798103 3:149651388-149651410 CAGGATGACAGCTCTGTAGTGGG + Intronic
966876155 3:184323048-184323070 CAGGAAAAGGTCTCAGAAGCAGG - Intronic
968105776 3:196000221-196000243 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
968303984 3:197637447-197637469 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
969197441 4:5574217-5574239 CAGCCTCAGGGCTCTGTATCAGG + Intronic
970073411 4:12189874-12189896 CAAGATCTGGGCACTGTAGCAGG - Intergenic
973921012 4:55685049-55685071 CAGGAGAAGGGCTTTAGAGCTGG - Intergenic
975992479 4:80271542-80271564 CAGGAGAAGGCCACAGTAGCAGG + Intronic
976115855 4:81725327-81725349 CAGGTTATGGGCTCTGTCCCTGG - Intronic
982271699 4:153596485-153596507 CAGGATGAAGGCTGTGTTGCGGG + Intronic
984657605 4:182335979-182336001 CAGGATAGGGGCTGTATAGTAGG - Intronic
985506596 5:285102-285124 CAGGTTAAGGGCTGTGCAGCTGG - Intronic
992477401 5:77117213-77117235 CAGGACAAGCGCTCTGTCTCTGG + Intergenic
995726095 5:115181616-115181638 CACAATTAGGGCTCTGTAGGAGG + Intergenic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
997599104 5:135127368-135127390 CAAGATAAGGGCTCAGTAACTGG - Intronic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
998578429 5:143343612-143343634 AGGGATATGGACTCTGTAGCTGG - Intronic
1001669848 5:173464401-173464423 CAGGAGCAGGGCTCTGAGGCAGG + Intergenic
1004610135 6:17232149-17232171 AAGGACAAGGGCCCTGAAGCTGG + Intergenic
1005468964 6:26143143-26143165 CAGGAGAAAGGCTCTGTGGTAGG - Intergenic
1006076946 6:31539609-31539631 CAGGAGAAGTGGTCTGTGGCAGG - Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1010766234 6:79779437-79779459 CAGCATAAAGGCTATGTAGCAGG + Intergenic
1013751660 6:113414303-113414325 AAGAATAAGGCCTCTGTGGCTGG + Intergenic
1018790320 6:167143333-167143355 CAGAATAGATGCTCTGTAGCTGG - Intergenic
1019137632 6:169921140-169921162 CAGGAGAAGGGGTCTTTAGCAGG - Intergenic
1020745431 7:12073182-12073204 CAGCATAAAAGCTCTGTATCGGG - Intergenic
1021895734 7:25233633-25233655 GAGGAGAAGGGCTCTGTAATGGG - Intergenic
1023629933 7:42154007-42154029 CAGGACAAGAGCTCTGTTCCTGG + Intronic
1026712714 7:72756742-72756764 CTGGCTAAGGGCTCTTTATCAGG - Intronic
1026791269 7:73333622-73333644 CAGGACAAGAGCTGTGTGGCGGG - Intronic
1030383191 7:108836792-108836814 CAGGAAAATGGCTCTGGAGGTGG + Intergenic
1032459716 7:132101683-132101705 AAGGAAAATGGCTCTGAAGCTGG - Intergenic
1032501588 7:132403980-132404002 CCGGATAACGGGTCTGTAGTTGG + Intronic
1039431219 8:37526567-37526589 CAGGATGAAGGCTCTGCAGCAGG + Intergenic
1042817554 8:72894268-72894290 CAGCAGGAGGGCTGTGTAGCTGG + Intronic
1043361633 8:79479280-79479302 CAGGAGAAGGTCACTGAAGCTGG + Intergenic
1046684392 8:117208622-117208644 CAGGATCAGTGCCCTGTAGTGGG - Intergenic
1046695114 8:117331334-117331356 CAGGTTAAGGGCCTTGTAGCTGG + Intergenic
1049759632 8:144326239-144326261 CTGGGTAGGGGCTCTGGAGCTGG - Intronic
1056364517 9:85890172-85890194 CTGGATAAGGAATCTGTACCAGG + Intergenic
1059455322 9:114396965-114396987 CAGTATGACGGCCCTGTAGCTGG + Intergenic
1060438148 9:123613941-123613963 AAGGAAAAGGGCTCTGTTGCTGG + Intronic
1060477482 9:123997355-123997377 GAGGCAAAGGGCTCTGTAGTGGG - Intergenic
1061309253 9:129751699-129751721 CAGGATGTGGGCTCTGAAGCTGG + Intronic
1189497944 X:41526441-41526463 CATGATAAGGACTGGGTAGCTGG - Intronic
1193797254 X:85891718-85891740 CAGAATAGGGGCTCTGTATGGGG - Intronic
1195004339 X:100671406-100671428 CAGGATGAGGGGTGGGTAGCAGG + Intergenic
1196311904 X:114178120-114178142 CAGGAAAAAGGCTCTTTTGCTGG + Intergenic
1201589292 Y:15596080-15596102 TAGGATTAGGGTTCAGTAGCAGG + Intergenic