ID: 1106189165

View in Genome Browser
Species Human (GRCh38)
Location 13:27435890-27435912
Sequence GGCTGTTTCCCTTTTTTAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106189165_1106189169 6 Left 1106189165 13:27435890-27435912 CCTCCTAAAAAAGGGAAACAGCC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1106189169 13:27435919-27435941 TAATTTAAAATCAGAGGCTTTGG 0: 1
1: 0
2: 5
3: 39
4: 386
1106189165_1106189168 0 Left 1106189165 13:27435890-27435912 CCTCCTAAAAAAGGGAAACAGCC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1106189168 13:27435913-27435935 AAAGATTAATTTAAAATCAGAGG 0: 1
1: 0
2: 1
3: 69
4: 780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106189165 Original CRISPR GGCTGTTTCCCTTTTTTAGG AGG (reversed) Exonic
901362900 1:8719050-8719072 GCCTGTTTCTTTTTTTTAGTGGG - Intronic
903741833 1:25562867-25562889 GGCTGTTCCCATTTTTCAGATGG - Intronic
904804612 1:33121932-33121954 GGGTGTCTCCCTTTTCCAGGTGG + Intergenic
907731612 1:57072124-57072146 GGCTGTTTATCTTTTCTAGATGG + Intronic
912212832 1:107573369-107573391 GGTTGCTTTTCTTTTTTAGGTGG - Exonic
912237300 1:107865958-107865980 GACTTTTTCCCTTTTTCTGGTGG - Intronic
912396821 1:109351740-109351762 GTCCGTTTCACTTTCTTAGGTGG + Intronic
914226492 1:145723571-145723593 ACCTGTTTCCTTTTTTTATGGGG + Intronic
915961243 1:160268822-160268844 GGCTGTTTTCCCTTTTTTGACGG + Intergenic
916946504 1:169734092-169734114 GGCTGAGGCCCTTTTATAGGAGG + Intronic
924380638 1:243460815-243460837 GGCTTGTTCCCTTTCTCAGGTGG + Intronic
1064199025 10:13269123-13269145 AGCTGTTTCTCTTCTTCAGGGGG + Intergenic
1064712925 10:18144804-18144826 TGCTGTTTACCTTTTTAATGTGG + Intronic
1065941159 10:30565025-30565047 GGCTGTTTCCATTAATTTGGGGG - Intergenic
1066193324 10:33076124-33076146 GGCTGTTTTTTTTTTTTAGATGG + Intergenic
1066958090 10:42191942-42191964 GGAAGTTTCCCTTTTTAACGTGG + Intergenic
1067118345 10:43452920-43452942 GGCTTTTTTTCTTTTTTTGGTGG + Intronic
1068298430 10:55106754-55106776 GGATGTTCCCCTTTTTTTGTTGG - Intronic
1069892538 10:71661305-71661327 GGCTTTGTTCCCTTTTTAGGTGG - Intronic
1072420845 10:95289985-95290007 GGGGGTTTCACTTTATTAGGGGG + Intronic
1072436258 10:95417024-95417046 GGCTGATTCCCTTTGTGTGGTGG - Intronic
1072632799 10:97158222-97158244 TGCTGTTTCCCTTTGTGAGTTGG + Intronic
1072930950 10:99661343-99661365 GGATTTTTGCCTTTATTAGGAGG + Intronic
1073039488 10:100592749-100592771 GGTTTTTTTCCTTTTTTTGGTGG - Intergenic
1073391552 10:103181403-103181425 AGCTGTTTTCCTTTCTTTGGGGG - Intronic
1075390002 10:122085051-122085073 GTCTCTTTCCCATTTTCAGGTGG - Exonic
1077619161 11:3704011-3704033 GCCTGTTTCCCAATTTTACGTGG + Intronic
1078246692 11:9579643-9579665 GGCTAATTCTCTTTTTTAGCAGG - Intronic
1079598504 11:22283933-22283955 GGCTTTCTTCCTTTTTCAGGTGG - Intergenic
1079745055 11:24116123-24116145 GCCTGCTTCCCTTCTTTGGGTGG - Intergenic
1079926551 11:26500792-26500814 GGGTGTTTTTCTTTTTTTGGTGG - Intronic
1080288354 11:30641888-30641910 GGCTGATTCCCTCTTTTTTGGGG + Intergenic
1080421801 11:32117432-32117454 AGCTGTTTCCCTATCTGAGGGGG - Intergenic
1081358975 11:42148570-42148592 GACTGTTTCTCTTTTTTTTGTGG + Intergenic
1082704554 11:56477836-56477858 GTCTGTTTCCAATTTTTAGATGG + Intergenic
1085572947 11:77575180-77575202 GGCTGTTTTTCATTTTTCGGAGG + Intronic
1087607987 11:100400514-100400536 TGCTGTTTTCATTTTTTGGGAGG + Intergenic
1089861056 11:121590255-121590277 GGCTGATTCCGTGTTTTGGGGGG + Intronic
1089890984 11:121880394-121880416 TCCTGTTTCTCTTTTTTGGGGGG + Intergenic
1091248732 11:134123385-134123407 ATCTTTTTCCCTTTTTTGGGGGG - Intronic
1091727549 12:2856366-2856388 GGATGTTTTCTTTTTTTAGATGG + Intronic
1092193542 12:6536010-6536032 GTCTCTGTCCCTTTTGTAGGAGG + Intronic
1092640003 12:10495160-10495182 CTCTGTTTCCCTTTTTTTGGGGG - Intergenic
1094562406 12:31567846-31567868 GGCTCTTTTCTATTTTTAGGGGG + Intronic
1094648343 12:32349703-32349725 GGAATTTTCCTTTTTTTAGGGGG - Intronic
1095432439 12:42148438-42148460 GGCTGTTTGCTTTTTTTGGGGGG - Intergenic
1096282598 12:50269363-50269385 AGCTCTTTTCATTTTTTAGGAGG + Intronic
1096713894 12:53479193-53479215 GGCTGTTTCCCTTGGTTCTGAGG + Intronic
1096999810 12:55867153-55867175 TGGTGTTTCCCTCTTTTGGGGGG - Intergenic
1097647149 12:62249919-62249941 GGTGGTTTCACTTTTTTGGGGGG + Intronic
1098822955 12:75256004-75256026 GGATATTTCTCTTTTTTAAGTGG - Intergenic
1100640138 12:96474647-96474669 TTCTTTTTACCTTTTTTAGGTGG - Intergenic
1101573754 12:105979118-105979140 GGCTGTTAGCCTTTTCTAGCAGG - Intergenic
1102019054 12:109669059-109669081 GGCTGTTTTCATTTTTAAAGAGG + Intergenic
1103082707 12:118038045-118038067 GGCTGTTTCCCTTTATAAAATGG - Intronic
1106189165 13:27435890-27435912 GGCTGTTTCCCTTTTTTAGGAGG - Exonic
1106619422 13:31359111-31359133 GGCTTTTGCCCTTTTTGAGGAGG - Intergenic
1108029496 13:46214539-46214561 GGATGGTTCCTTTTTTTTGGTGG + Intronic
1108923746 13:55711007-55711029 ATCTGTTTCCCTTTGTAAGGCGG + Intergenic
1112398197 13:99052576-99052598 GGCTATTGCCCTTTTTTTTGGGG + Intronic
1113040866 13:106102495-106102517 GACGGTTTCCCTTTTTTGCGTGG - Intergenic
1115355360 14:32440841-32440863 GGCTGTAATCCTTTTTTTGGTGG + Intronic
1116069875 14:40030407-40030429 GTCTGTTTCCCATTTTTAGGGGG - Intergenic
1116424942 14:44779543-44779565 TGATATTTCCCTTTTTTATGAGG - Intergenic
1116727598 14:48580647-48580669 GGCTTTCTTCCTTTTTCAGGTGG + Intergenic
1117811270 14:59549914-59549936 TGTTGTTTCTCTTTTTTAGAGGG + Intronic
1118874383 14:69770977-69770999 GGCTGTTTTCCATTTTAGGGTGG + Exonic
1119173900 14:72555154-72555176 TGATGTTTCCCTTTCTAAGGTGG - Intronic
1119503127 14:75147833-75147855 GGCTGTTTCCCTCTATTGAGAGG - Intronic
1120028280 14:79610705-79610727 GACTCATGCCCTTTTTTAGGAGG + Intronic
1122123184 14:99565423-99565445 GGTTGTCTCCCTTTTATGGGAGG - Intronic
1123141289 14:106081658-106081680 GGCAGTTTCTCTTTTTTATTTGG - Intergenic
1123166456 14:106329879-106329901 GGCAGTTTCTCTTTTTTATTTGG - Intergenic
1125573511 15:40739145-40739167 GGCTGGTTCCCTTTGGGAGGGGG - Intronic
1126754235 15:51909600-51909622 GGCTGTACGCCTTTTTTGGGGGG - Exonic
1130290668 15:82597683-82597705 AGCTCTTTCTCTTTTTCAGGGGG + Intronic
1136178080 16:28532306-28532328 GTCTGTTTCCCCATTTTGGGGGG - Intergenic
1138925733 16:61588974-61588996 TGCTGTTTCTCTTTTTTTGTTGG - Intergenic
1139704300 16:68730226-68730248 GGCTTTTTTTTTTTTTTAGGTGG - Intergenic
1139928973 16:70510018-70510040 GGGTTTTCTCCTTTTTTAGGTGG - Exonic
1141500499 16:84441016-84441038 GGCTGTTTCCCTTTTCAGAGAGG - Intronic
1142430638 16:90024649-90024671 AGCTCTTTCTCTTTTTCAGGGGG + Intronic
1143665212 17:8353990-8354012 GGCTGATTCCGTTTTTGGGGAGG - Intergenic
1144298470 17:13901335-13901357 GGCTGCATCCCATGTTTAGGAGG - Intergenic
1147313347 17:39607399-39607421 GTTTGCTTCCCTTTTTTCGGTGG + Intronic
1150994515 17:70300680-70300702 GGCTTTTTCCCCATTGTAGGAGG + Intergenic
1152125295 17:78443114-78443136 GGCTGTTTCCTTCTTTTAGGTGG + Intronic
1153195195 18:2587759-2587781 GTCTGTTTCACTTTTCTAGGTGG - Intronic
1155584925 18:27353887-27353909 GGCTGTTTCACTCTTTCAGAAGG - Intergenic
1158075001 18:53517709-53517731 GGCTGTTTCCCTTATTTTTGAGG + Intronic
1158728772 18:60000464-60000486 GGCTCTTTCTTTTTTTTAAGTGG + Intergenic
1161673547 19:5628246-5628268 AGCTGATTCTTTTTTTTAGGGGG - Intronic
1163573926 19:18099424-18099446 GGCGGTTTCTCTATTTTAAGAGG - Intronic
1165366376 19:35369519-35369541 GTCTTTTTCCATTTCTTAGGGGG - Intergenic
1167922507 19:52793484-52793506 GGCTGCTTTCCTTTGTTGGGAGG - Intronic
927962522 2:27249966-27249988 GGCTTTTTCCTTTTTTGAGATGG - Intergenic
928143943 2:28754321-28754343 ATCTGTTTTCCTTTTTTGGGGGG + Intronic
931702341 2:64919139-64919161 TGCTGTTTCCTATTTCTAGGGGG - Intergenic
932647328 2:73517052-73517074 GTCAATTTCCCTTTTTTTGGTGG - Intronic
934306207 2:91824333-91824355 GGAAGTTTCCCTTTTTAACGTGG + Intergenic
934327049 2:92028409-92028431 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
934465427 2:94258977-94258999 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
937312044 2:120908584-120908606 GGCAGTTTCCCCTTCCTAGGAGG + Intronic
938239152 2:129729584-129729606 GGCTGCTTCCGTTTTGTAGCTGG - Intergenic
938783129 2:134603236-134603258 GGCTTTTTCCCTTTATTACCAGG + Intronic
938802108 2:134773127-134773149 TTCTGTTTTCCTTTTTTAGTAGG + Intergenic
939543107 2:143517622-143517644 AGCTGTTTCCCTTGCTTAGAAGG - Intronic
944037439 2:195312388-195312410 AGTTGTTTCCAATTTTTAGGGGG - Intergenic
1170115043 20:12848791-12848813 AGATGTTTCCCATTTTTAAGAGG + Intergenic
1170587351 20:17744860-17744882 AGCTATTTTCCTTTTTTTGGGGG - Intergenic
1174749858 20:53100908-53100930 GGCTGTTTCCCAGTTTTTTGAGG + Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176014459 20:62922703-62922725 GGCTGTGTCACTTTCTTAGGTGG - Intronic
1176303055 21:5107961-5107983 GGCTGCTTCCGTGTTTTAGCTGG - Intergenic
1176986841 21:15446793-15446815 GGCTGATTCCGTTTTTTGTGAGG - Intergenic
1177408624 21:20701724-20701746 GGCTGTCTTCCTTTTTCTGGTGG - Intergenic
1177846655 21:26296688-26296710 GTCTGTTTCCCATTTTTAAATGG + Intergenic
1177933458 21:27315283-27315305 GACTTTTTCCCTTCTTGAGGAGG + Intergenic
1178532241 21:33385491-33385513 GGCTGTTGCCCTTTTTTGAGTGG - Intergenic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1179329693 21:40387362-40387384 GGCTGTTTTTTTTTTTTTGGAGG - Intronic
1179853970 21:44153963-44153985 GGCTGCTTCCATGTTTTAGCTGG + Intergenic
1180586572 22:16898161-16898183 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1182955730 22:34424325-34424347 GGCTTTTTCTTTTTTTTCGGGGG + Intergenic
949436003 3:4030019-4030041 TGTTTTTTTCCTTTTTTAGGAGG + Intronic
949926201 3:9043808-9043830 TGCTCCTTCCCTTTTATAGGTGG + Intronic
951393223 3:22132230-22132252 GTCTGTTTCCTTTTTTTATAGGG - Intronic
952402113 3:32972819-32972841 AGCTCTTTCTCTTTCTTAGGGGG - Intergenic
952866565 3:37859462-37859484 GGCTGGATCCCTTATTTGGGAGG - Intergenic
953356254 3:42258572-42258594 GGGTGTTTTCCTTTTGTAGATGG + Intronic
956175352 3:66467982-66468004 GGCTCTTTCCCTTGTTGAGATGG - Intronic
958471048 3:94520543-94520565 GGCTCTTTCCCTCTTGTAGCTGG - Intergenic
959516360 3:107271484-107271506 TGCTTTTCCCCTTTTCTAGGTGG - Intergenic
963268336 3:143261073-143261095 GGCTTTCTTCCTTTTTCAGGTGG - Intergenic
964044079 3:152300120-152300142 GGTTGTTGCTCTTTTTTGGGGGG + Exonic
964649888 3:158998870-158998892 GGCTTTTTCTCTTTTTTTGGTGG - Intronic
964939778 3:162143754-162143776 GGCTATTTCCCACTTTTAGAGGG + Intergenic
970032124 4:11687772-11687794 GCCTGTTCCCCATTTTTAAGTGG - Intergenic
971239357 4:24873679-24873701 ACCTGTTTCCTTTTTTCAGGAGG + Exonic
972583710 4:40417786-40417808 GACTGTTTCCCTTGTTGAGGTGG + Intergenic
973652571 4:53011090-53011112 TGATGTCTGCCTTTTTTAGGGGG - Intronic
977936219 4:102808183-102808205 AGCTGCCTCCCTTTTTTAGATGG - Intronic
978663584 4:111155511-111155533 TGTTGTTTCCATTTTTTAGTGGG + Intergenic
979339034 4:119498695-119498717 GACTGTTTCCCTTTGCTAGATGG - Exonic
979914272 4:126410819-126410841 GTCTAGTTCCATTTTTTAGGGGG - Intergenic
980353856 4:131720687-131720709 GGCTGGTTTCCTTTTATTGGTGG - Intergenic
981840215 4:149102987-149103009 AGCTGTTTCTCTTTAGTAGGAGG + Intergenic
983993991 4:174158999-174159021 GTTTGTTTCCCTTAATTAGGTGG + Intergenic
984147560 4:176081874-176081896 GGCTGTTTACCTATCCTAGGAGG - Intronic
984219820 4:176960190-176960212 AGCTGTTTGCCTTATTTGGGTGG - Intergenic
984895588 4:184536944-184536966 AGATGTTTTGCTTTTTTAGGGGG + Intergenic
986406329 5:7428333-7428355 GGCTGCTTATCTTTGTTAGGGGG + Intronic
986728316 5:10616777-10616799 CGCTGTTTTCCTTTGTTACGAGG + Intronic
986843093 5:11720879-11720901 GGCTGTTTCTGTATTTTATGAGG - Intronic
987120577 5:14762998-14763020 TTCTGTGTCCCTTGTTTAGGAGG - Intronic
990341100 5:54823758-54823780 GGCTTTTTTCCTTTTTGTGGTGG - Intergenic
990581179 5:57169061-57169083 GGTTGTTTCTCTTTTTTTTGTGG + Intergenic
993148078 5:84122181-84122203 TGTTGATTCCCTTGTTTAGGTGG + Intronic
994782695 5:104112857-104112879 GGCTGGTTACCTTCTCTAGGAGG - Intergenic
996417439 5:123225823-123225845 GATTGTTTCCATTTTATAGGTGG + Intergenic
996681863 5:126236557-126236579 GACTGTTTCCCATCTTTAGAGGG + Intergenic
996895041 5:128470723-128470745 GGCTGTTTCCCTTCTCAAGTAGG - Intronic
998916734 5:147021195-147021217 GTTTGTTTTCCTTTTCTAGGTGG - Intronic
1000296259 5:159916168-159916190 GGCTGCTTACCTTTAATAGGGGG - Intergenic
1001031436 5:168266173-168266195 GGCTGTTTCCCTTCAGGAGGAGG + Intergenic
1006928233 6:37671102-37671124 GGCTGTTTTCCTTTTCCATGGGG - Intronic
1007313709 6:40967250-40967272 TGCTGTTTCCATTATATAGGTGG + Intergenic
1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG + Intronic
1009040810 6:58174758-58174780 GGCTGATTCCCTTTTTTTTTAGG - Intergenic
1009168708 6:60372093-60372115 TCCTTTTTTCCTTTTTTAGGTGG - Intergenic
1009216664 6:60929291-60929313 GGCTGATTCCCTTTTTTTTAGGG - Intergenic
1011776206 6:90733389-90733411 GGTTATTTGCCTTTTTTGGGGGG + Intergenic
1013745027 6:113335195-113335217 GCCTATTTCCTTTTTTTGGGGGG + Intergenic
1015551881 6:134420389-134420411 GGCTGTGTCCCTCTATCAGGAGG - Intergenic
1023619716 7:42057546-42057568 GGTTGTTTCCAATTTTTAAGTGG - Intronic
1027363579 7:77434056-77434078 TTCTGTTTCCCTTTTTCGGGAGG + Intergenic
1029761553 7:102603861-102603883 GGCTGTTTTTTTTTTTTTGGTGG - Intronic
1030136979 7:106262577-106262599 TTCTGTTTCCCTTTCTTAAGGGG + Intronic
1030257699 7:107529502-107529524 GGCTTTCTTCCTTTTTCAGGTGG - Intronic
1030464195 7:109879191-109879213 TGTTGTTTCCGTTTGTTAGGAGG - Intergenic
1030508197 7:110450924-110450946 GGATGTTCCCATTTGTTAGGTGG - Intergenic
1031385000 7:121138578-121138600 GGCTGTTTCAGTTTCTAAGGAGG + Intronic
1032402577 7:131634078-131634100 GGCTGTGTCCCTCTCTTAGAAGG + Intergenic
1033035254 7:137869780-137869802 GGTTGCTTCCCTTGTTTAGCTGG - Intergenic
1036114642 8:5945596-5945618 GGCTGTTTTTGTTTTTGAGGTGG - Intergenic
1038817936 8:30925506-30925528 AGCTTTTTCTCTTTCTTAGGGGG - Intergenic
1040476052 8:47778657-47778679 AGCTGTGTCTCTTTTGTAGGCGG - Exonic
1040579106 8:48681390-48681412 ACCTGTTTCCATTTTTTAGGTGG + Intergenic
1040825870 8:51619922-51619944 GGCTGTTTCTCTATATTTGGAGG + Intronic
1040976146 8:53196310-53196332 GACAGATTCACTTTTTTAGGGGG - Intergenic
1042027497 8:64439538-64439560 GGCTGTTTATTTTTTTTAGTAGG - Intergenic
1042081837 8:65062344-65062366 GTCTATTTCTCTTTTTTAGATGG - Intergenic
1044439525 8:92207545-92207567 GGCTGATTCCCTCTTTTTGGGGG - Intergenic
1044667459 8:94644657-94644679 AGCTGTTTTCATTATTTAGGTGG + Intronic
1050018437 9:1260018-1260040 GGGTGTTCTCTTTTTTTAGGTGG - Intergenic
1050041540 9:1500072-1500094 GGCAGTTTCTCTTTTTTTGGTGG - Intergenic
1051384053 9:16487786-16487808 GGCTGCTTTCCTTGTTAAGGGGG - Intronic
1051659251 9:19410079-19410101 TCCTGTTTCCCTTGTTTGGGCGG - Intronic
1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG + Intergenic
1053695488 9:40635755-40635777 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1054306734 9:63434979-63435001 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1054405472 9:64758969-64758991 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1054439096 9:65244458-65244480 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1054491310 9:65777483-65777505 GGAAGTTTCCCTTTTTAACGTGG + Intergenic
1056243181 9:84669322-84669344 GGCTGTCTCCCTTTTTGAAATGG - Intronic
1056726985 9:89127821-89127843 GGCTGATTCCCTCTTTTTGGGGG + Intronic
1057795787 9:98157101-98157123 GTTTGTTTCCCTTTTTTTGGTGG + Intronic
1059143660 9:111877774-111877796 GAATGTTTACCTTTTTTAGTTGG + Intergenic
1059598029 9:115744272-115744294 GGCTTTTTTCCTTTTTCCGGTGG + Intergenic
1059843175 9:118242090-118242112 GGCTTTTGCCCCTTTTTTGGGGG - Intergenic
1060429354 9:123536016-123536038 GTCAGTTTGCCTTTTTTATGTGG - Intronic
1060695537 9:125706571-125706593 GGCTGTTAACCTCTTTAAGGGGG + Intronic
1061409700 9:130413318-130413340 GCCTGGTTCCCTGGTTTAGGTGG + Intronic
1062306470 9:135909695-135909717 GACAGTTTCCCTTTTTTAGCTGG - Intergenic
1202777932 9_KI270717v1_random:9371-9393 GGAAGTTTCCCTTTTTAACGTGG - Intergenic
1186904508 X:14097194-14097216 ATCTGGTTCCCTTTTTTTGGAGG + Intergenic
1190868880 X:54408191-54408213 ACCTGTTGCCCATTTTTAGGTGG - Intergenic
1193993983 X:88342871-88342893 AGCTGTTTCCCATTATCAGGAGG + Intergenic
1195274285 X:103265536-103265558 GTCTTTTTCCATATTTTAGGGGG + Intergenic
1195952339 X:110288242-110288264 GGCTTTTGGCATTTTTTAGGTGG + Intronic
1196868281 X:120088602-120088624 AGCTCTTTCTCTTTCTTAGGGGG + Intergenic
1197938068 X:131761121-131761143 GGCTTTTTTCCTTTTTCTGGTGG - Intergenic
1198445438 X:136709497-136709519 TGCTGTTTCCATTTTACAGGTGG + Intronic
1199709935 X:150461810-150461832 GGAAGCTTCCCTTTTTTGGGAGG - Intronic
1200009378 X:153109626-153109648 GGCTTTTTCCCTTTTTCCAGTGG - Intergenic
1200030222 X:153290296-153290318 GGCTTTTTCCCTTTTTCCAGTGG + Intergenic
1201530679 Y:14986999-14987021 GGTTGATTCCCTTTTCTAGTAGG - Intergenic