ID: 1106194408

View in Genome Browser
Species Human (GRCh38)
Location 13:27480972-27480994
Sequence CTCAACTGTGAAGATAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106194402_1106194408 -10 Left 1106194402 13:27480959-27480981 CCACACCTCCACCCTCAACTGTG 0: 1
1: 0
2: 8
3: 76
4: 734
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208
1106194401_1106194408 -9 Left 1106194401 13:27480958-27480980 CCCACACCTCCACCCTCAACTGT 0: 1
1: 0
2: 6
3: 30
4: 445
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208
1106194399_1106194408 -5 Left 1106194399 13:27480954-27480976 CCCACCCACACCTCCACCCTCAA 0: 1
1: 0
2: 10
3: 187
4: 1214
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208
1106194398_1106194408 -2 Left 1106194398 13:27480951-27480973 CCTCCCACCCACACCTCCACCCT 0: 1
1: 3
2: 43
3: 697
4: 3864
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208
1106194400_1106194408 -6 Left 1106194400 13:27480955-27480977 CCACCCACACCTCCACCCTCAAC 0: 1
1: 0
2: 14
3: 286
4: 1722
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208
1106194397_1106194408 1 Left 1106194397 13:27480948-27480970 CCTCCTCCCACCCACACCTCCAC 0: 1
1: 0
2: 37
3: 392
4: 3083
Right 1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG 0: 1
1: 0
2: 0
3: 10
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106194408 Original CRISPR CTCAACTGTGAAGATAACTT GGG Intergenic
903669868 1:25028952-25028974 CTCAGCTGTGAAGTTGGCTTTGG + Intergenic
903892159 1:26577050-26577072 CTGAACTGGAAAGATAAATTTGG + Intergenic
904962499 1:34345439-34345461 CTCAACTCTGACGATTATTTGGG - Intergenic
907325314 1:53634252-53634274 CTCAGGTCTGGAGATAACTTTGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
909961861 1:81855894-81855916 TTCTACTGTGAATATGACTTCGG - Intronic
910994451 1:93089649-93089671 CTGAAGTGTGAAGATATCCTGGG - Intronic
911017911 1:93354438-93354460 ATCAACTGTGTAGTTAAATTAGG + Intronic
911773923 1:101783779-101783801 CCTAACTGTGAAAATAAATTAGG + Intergenic
912154641 1:106902600-106902622 CCCAACTGTGCAGATTAGTTTGG - Intergenic
913777737 1:122343400-122343422 CTCCTCTGTGAAGATTTCTTTGG + Intergenic
916312092 1:163409013-163409035 ATCAGGTGTGAAGATAAATTGGG + Intergenic
917179209 1:172276155-172276177 CTCAAGAGTGATGATAAATTAGG - Intronic
917860307 1:179137565-179137587 CTCAACAGTAAAAAGAACTTTGG + Intronic
918255608 1:182743675-182743697 ATTAACTGTGCAGATAACTGGGG - Intergenic
918302636 1:183218079-183218101 CTCAACTGTTTAGTTTACTTTGG - Intronic
918638804 1:186813050-186813072 CTGAACTATGTAGATGACTTCGG - Intergenic
919860023 1:201733682-201733704 ATAAACTGTGCAGATAACTGGGG + Intronic
921093584 1:211866975-211866997 CTGAGGTGGGAAGATAACTTGGG - Intergenic
921533977 1:216322016-216322038 CTCAACTGTGAATATATTTAAGG + Intronic
921602236 1:217118644-217118666 ATTAACTGTGCAGATAACTGAGG - Intronic
1063041672 10:2346127-2346149 ATAAAATGTGAAGATAACATAGG - Intergenic
1063646527 10:7889282-7889304 CTCAGCTGTACAGATATCTTTGG + Intronic
1063761595 10:9084671-9084693 CTCAACCATGAAGATAATCTTGG + Intergenic
1067098472 10:43317756-43317778 CTCACCTTTGGAGATAACTTAGG - Intergenic
1068136186 10:52952998-52953020 CTCAAGTGGGAAGAGAGCTTTGG - Intergenic
1068803645 10:61170600-61170622 CTCAAGTGTTAAGATGACTGTGG + Intergenic
1068977660 10:63028230-63028252 CTATACAGTGAAGATAAATTTGG - Intergenic
1069028481 10:63570220-63570242 ATCAAGTGTGAAGATAATTTAGG + Intronic
1072002140 10:91206813-91206835 CTAAACTGTGCAGGTAACTGGGG - Intronic
1072590150 10:96821648-96821670 CTGAGGTGGGAAGATAACTTGGG - Intergenic
1073965373 10:108982822-108982844 ATCAACTGAGAAAATACCTTCGG + Intergenic
1075264975 10:120992322-120992344 TTCAACTGTGAAGGTACTTTTGG + Intergenic
1075628789 10:123986667-123986689 CTCTTCTCTGAAGTTAACTTGGG - Intergenic
1079951317 11:26808465-26808487 CTCAACTCTGAAGTTAAAATGGG + Intergenic
1080228701 11:29991029-29991051 ATAGACTGTGAAGAAAACTTTGG + Intergenic
1083906634 11:65676213-65676235 CTGAAGTGGGAAGATCACTTGGG + Intergenic
1084347247 11:68561855-68561877 CTAAAGTGGGAAGATCACTTAGG - Intronic
1086159336 11:83703668-83703690 TTCAAATGTAAAGAAAACTTTGG - Intronic
1087899515 11:103625166-103625188 CTCAACTGTGAACACAGCATGGG + Intergenic
1091164205 11:133456976-133456998 CACAAATGTGAAGATAAATACGG + Intronic
1092000717 12:5029851-5029873 CTCAACTCTGAATATAGCATGGG + Intergenic
1092883416 12:12905683-12905705 CACAAGTGGGAAGATAAATTGGG - Intronic
1097426380 12:59449577-59449599 GTAAACTGTTAAGATAACTTTGG - Intergenic
1098469739 12:70829446-70829468 AGCATCTGTGAATATAACTTGGG + Intronic
1099619755 12:84987640-84987662 GTCTACTGTGAAGAGAACTATGG + Intergenic
1099885113 12:88519719-88519741 CTGAAGTGGGAAGATCACTTGGG - Intronic
1100094814 12:91020672-91020694 CTCAACTGTGAATTTTACTCTGG + Intergenic
1100311847 12:93402982-93403004 CTCCAATGTGAAGACAACATTGG - Exonic
1101092044 12:101297312-101297334 CTCAAGTGAGAGGATAGCTTGGG - Intronic
1101559269 12:105840661-105840683 CTCATCTGTGCAGACAACTGAGG + Intergenic
1102507627 12:113393781-113393803 CAGAACTGTGAAGGAAACTTGGG + Intronic
1102623048 12:114212048-114212070 CTTAACTGATAAGATAACTCAGG + Intergenic
1102937864 12:116912421-116912443 CTCAATTGGGAGGATCACTTGGG - Intronic
1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG + Intergenic
1109971611 13:69777661-69777683 CTGAACTGTGAAGAATAGTTAGG - Intronic
1116551711 14:46248107-46248129 ATCAACAGTGAAGATAAATCAGG - Intergenic
1117007148 14:51432545-51432567 CTCAAATGTGAAGATACCCAGGG + Intergenic
1121391447 14:93579203-93579225 CATTACTGTGATGATAACTTTGG + Intronic
1121785975 14:96661388-96661410 ATCAACAGTGAGGATAACCTGGG + Intergenic
1122759625 14:104013159-104013181 CACAAGTGTGAACATAACTGGGG - Intronic
1124075129 15:26436999-26437021 CTCAACTGTGATGAGGACTGTGG + Intergenic
1129307291 15:74675069-74675091 ATCAATTGTGGAGATAGCTTGGG - Exonic
1130735406 15:86543138-86543160 TTCAAATGTGGAGATAAATTGGG - Intronic
1130970192 15:88726360-88726382 CTCCACTGTGAAGATCACAGAGG + Intergenic
1131657135 15:94473215-94473237 CTCACCTGTCAAAATAATTTTGG - Intronic
1138887732 16:61100333-61100355 CTCAAATGTGATGGTCACTTAGG + Intergenic
1139139036 16:64238911-64238933 CTCAACTGAGAAGAAACCTGAGG + Intergenic
1139163800 16:64541763-64541785 CTCAGCTGAGAAGATAAATCTGG + Intergenic
1140097224 16:71884753-71884775 CTCAACTGATAAAATAACATTGG + Intronic
1141210342 16:81973709-81973731 CTGATCTGTACAGATAACTTGGG + Intergenic
1141433835 16:83986609-83986631 CTAAAGTGGGAAGATCACTTGGG - Intronic
1144077836 17:11734807-11734829 CTCAAAGATGTAGATAACTTCGG - Intronic
1147004579 17:37392090-37392112 GTCAGCTGTGAAGATAACAGAGG - Exonic
1147013685 17:37473057-37473079 CTGAACTGGGAGGATCACTTAGG - Intronic
1150569812 17:66375922-66375944 CTGAGCTGTGAAGATAACTGAGG + Intronic
1150877942 17:68990617-68990639 CTGAAGTGGGAAGATCACTTAGG - Intronic
1151093457 17:71469139-71469161 CTCAAATGTGAATATAAATGTGG - Intergenic
1153403413 18:4706983-4707005 CTCAAAAGTGAAGATAACACAGG + Intergenic
1155442317 18:25875245-25875267 CTCCACTGAGAAAATATCTTGGG + Intergenic
1156083008 18:33362924-33362946 CTCAACTTTTAAAATCACTTAGG + Intronic
1156526943 18:37776611-37776633 CTCTAATGTAAAGAGAACTTAGG + Intergenic
1156967627 18:43114536-43114558 CTCCACTGGGAATATATCTTTGG - Intronic
1157950807 18:52034952-52034974 CAAAACTGTGAAAATACCTTAGG + Intergenic
1158383221 18:56959088-56959110 CTCCTTTGTCAAGATAACTTTGG + Intronic
1159248649 18:65843913-65843935 GACAACTGTGAAGATAATTGTGG + Exonic
1159465064 18:68771057-68771079 TTCAACTGAGAAGATAGATTTGG + Intronic
1162503826 19:11070445-11070467 CTGAGGTGAGAAGATAACTTAGG + Intergenic
1166774066 19:45302006-45302028 CTCAACTGTGAAGATGACAAGGG - Intronic
1168001099 19:53446740-53446762 CTGAGGTGTGAAGATCACTTGGG - Intronic
1168487457 19:56776333-56776355 CTCCACTGTCAAGTTAATTTGGG + Intronic
925152387 2:1624163-1624185 GTCATCTGTGAAGGTAACTGGGG - Intergenic
925657946 2:6169483-6169505 CTCGACTGTGAAAATGTCTTTGG - Intergenic
928248884 2:29657213-29657235 CTGGACTGTAAAGATAACATTGG + Intronic
929807719 2:45161892-45161914 TTAAAATGTAAAGATAACTTGGG - Intergenic
930925060 2:56807826-56807848 GTTAACTGTGAAGAATACTTGGG + Intergenic
931040635 2:58295147-58295169 CTCAACTGAGAAAATGAATTTGG + Intergenic
932048413 2:68373962-68373984 CTTAACTTTTAAAATAACTTGGG - Intronic
937648603 2:124295228-124295250 CATAACTGTGAAGATCAATTTGG + Intronic
937830434 2:126415502-126415524 ATCAAATCTGTAGATAACTTGGG - Intergenic
938958871 2:136323067-136323089 CTCCACTCTGAATATAACTCTGG + Intergenic
940087004 2:149871395-149871417 CTCAACTTTGAAAATAAGATTGG + Intergenic
940785036 2:157971924-157971946 CCCAGCTGTGAAAATAACTAGGG + Intronic
947117622 2:226789335-226789357 CTCAACAGTCAAGATAACACAGG + Intronic
948172524 2:235916485-235916507 CTTAAATGTGAAAATAACTGTGG - Intronic
1168989291 20:2080415-2080437 CTAAACTGAGAAGAGAAGTTGGG + Intergenic
1169328029 20:4692778-4692800 CTAAACTGTTAAAATAAGTTGGG + Intronic
1170570158 20:17628095-17628117 CTCGACTGTGAAGAGGTCTTGGG - Intronic
1174675228 20:52347374-52347396 CTGAACTGTGTAGAAAACTGTGG - Intergenic
1174812010 20:53654116-53654138 CTCAACTTTTAATTTAACTTTGG - Intergenic
1182137763 22:27921572-27921594 CTCAACTCTGAACATAGCATGGG + Intergenic
1182256977 22:29046245-29046267 CTCAACCCTCAAGAGAACTTTGG - Intronic
1183170852 22:36187022-36187044 CTCAAATGAGAGGATAGCTTGGG - Intergenic
1184519646 22:44985651-44985673 CTCCACTGTGGAGATAATATGGG + Intronic
1184696826 22:46144291-46144313 CTGAGGTGTGAAGATCACTTGGG - Intergenic
949915906 3:8964337-8964359 CTCAACTCTGAATACAACATGGG - Intergenic
950783868 3:15416347-15416369 CTGAAGTGGGAGGATAACTTGGG - Intronic
950806216 3:15605053-15605075 CGAAACTGTGGAAATAACTTTGG - Intronic
950889284 3:16388531-16388553 CTTAACAGTGAAGAAAACTGAGG + Intronic
951045790 3:18037077-18037099 CTCTACAGTGAAGACACCTTTGG + Intronic
951693835 3:25425583-25425605 CTCAACTGAGAAATGAACTTGGG - Intronic
952654153 3:35763778-35763800 CTCAAAGGTGATGAAAACTTCGG - Intronic
953675869 3:45001696-45001718 CTCATATGTGAAGATAACAGGGG + Intronic
956199079 3:66687543-66687565 CTGAACTGTCATTATAACTTTGG - Intergenic
956413706 3:69004961-69004983 CTCAAGTGGGAGGATCACTTGGG + Intronic
956492893 3:69793110-69793132 CTGAAGTGGGAAGATCACTTCGG - Intronic
957142434 3:76378250-76378272 CTCAACAATGGAGACAACTTAGG + Intronic
957763046 3:84584473-84584495 CTTAACTGAGAAGGTGACTTTGG - Intergenic
958262358 3:91396413-91396435 CTCAACTGCAAAGATGTCTTTGG - Intergenic
958873146 3:99584909-99584931 CACAACTGTTAGTATAACTTAGG - Intergenic
959842483 3:110994311-110994333 CTCAACTCTGAAAATAGCATGGG + Intergenic
963366932 3:144347079-144347101 CTCAGCTGTGAATATTACTTGGG - Intergenic
963390737 3:144660504-144660526 CAAAACTGTGAAGCTGACTTTGG + Intergenic
964639349 3:158892181-158892203 CTCCACTGTGAAGTTGCCTTAGG + Intergenic
970310077 4:14773134-14773156 TTGAACTCTGAAGATATCTTGGG - Intergenic
970488997 4:16553249-16553271 CTGAAGTGGGAAGATCACTTGGG - Intronic
970574015 4:17409857-17409879 AACAACTTTAAAGATAACTTTGG + Intergenic
970905921 4:21216089-21216111 TTGAACTGTGAAAATATCTTGGG - Intronic
971042112 4:22765233-22765255 CTGATCTATGAAGATATCTTTGG + Intergenic
972897010 4:43635213-43635235 ATGAACTGTGAACATAACTAAGG + Intergenic
974407056 4:61486599-61486621 TTCAACTTTGAAGATATATTTGG + Intronic
976626603 4:87191033-87191055 CTCAACTTTAAAGATGGCTTAGG + Intronic
976779329 4:88740663-88740685 TTCAACTTTGAAGATGACTCTGG + Intronic
976945994 4:90768515-90768537 CTAAAATATGAAGGTAACTTTGG + Intronic
977214727 4:94267521-94267543 CTCACCTTTGAAAATAATTTTGG + Intronic
977997299 4:103510219-103510241 AAAAACTCTGAAGATAACTTAGG - Intergenic
978003724 4:103590652-103590674 CCCAACTGAGAAGAGAGCTTAGG + Intronic
978246915 4:106583971-106583993 CTTGACTGTGAAAATATCTTAGG + Intergenic
979433025 4:120655278-120655300 CTCAAAAGTAAAGATAAATTAGG + Intergenic
981365796 4:143901689-143901711 ATAATCTGTAAAGATAACTTGGG + Intronic
982714156 4:158789239-158789261 CTCAGCTGTGAAAGTAGCTTGGG - Intronic
983109526 4:163731533-163731555 CTCAGCTGAGAAGATAATTCTGG + Intronic
984206945 4:176796750-176796772 ATCAGCTGTGAACATGACTTAGG + Intergenic
988243112 5:28639422-28639444 CTTAACTCTGAATACAACTTGGG + Intergenic
988353599 5:30143662-30143684 CTAAAATGTGGAGACAACTTTGG - Intergenic
988396817 5:30706251-30706273 CACAACTGTGAAGAACAATTTGG + Intergenic
989685260 5:44078162-44078184 CTCAACTGTGAGGATCAGATAGG + Intergenic
989799213 5:45515542-45515564 AACAACTATGAAGATAAATTTGG - Intronic
991699763 5:69306425-69306447 CTGAGGTGTGAAGATCACTTGGG - Intronic
992828843 5:80574383-80574405 CACAATTGTGAAGAGAACTGGGG - Intergenic
995058952 5:107793253-107793275 CTCATCTGTCAAGGTAACTAAGG + Intergenic
995717444 5:115093753-115093775 CTAAAATGGGAAGATAATTTTGG + Intergenic
996064996 5:119070490-119070512 ATCACGTGTTAAGATAACTTAGG + Intronic
996539369 5:124612994-124613016 TTCATCTGTGAAGCTAACTATGG - Intergenic
997839227 5:137223573-137223595 CACAAATGTGGAGATAACATTGG - Intronic
999037019 5:148363028-148363050 CTCAATTCTGAAGCTATCTTTGG - Intergenic
999515491 5:152297949-152297971 CTCAACTCTGAATACAACATGGG + Intergenic
999641200 5:153674870-153674892 CTCTCCTGTGAACAAAACTTAGG + Intronic
1000273368 5:159709186-159709208 CTCAACTGTGAATACAGCATGGG + Intergenic
1000652703 5:163836862-163836884 AACAAGGGTGAAGATAACTTAGG + Intergenic
1002891648 6:1337817-1337839 CTCACCTGTCAAGATAATTTTGG - Intergenic
1004560935 6:16749846-16749868 GTCAAGTCTGAAGATAAATTTGG - Intronic
1005798080 6:29389521-29389543 CTAAACAGTGGAGATAAATTTGG + Intronic
1008001702 6:46366800-46366822 CTCAACTTTGAATATACCATGGG - Intronic
1008779639 6:55087965-55087987 AGCAGCTGTGAAGATATCTTTGG + Intergenic
1008904807 6:56664732-56664754 CACAACTGGTAAGATATCTTGGG - Intronic
1008993059 6:57626464-57626486 CTCAACTGCAAAGATGTCTTTGG + Intronic
1012196908 6:96354522-96354544 CCCATCTGTGAAGATAACAGAGG + Intergenic
1012239664 6:96857798-96857820 CTCATCTGAGTAGCTAACTTCGG + Intergenic
1013862479 6:114652384-114652406 CTCAACTGTGGTAATAACTGGGG - Intergenic
1015628556 6:135207375-135207397 CTAAACTGTCTAAATAACTTAGG + Intronic
1016210095 6:141521302-141521324 CTTAAGTGTGTAGATAGCTTGGG - Intergenic
1018581753 6:165314033-165314055 TTCAACTGTGAAAATGATTTGGG + Intergenic
1021896434 7:25240323-25240345 CTCAAGTGTGACAATAATTTGGG - Intergenic
1023320280 7:38989219-38989241 CTTATTTGTGAAAATAACTTGGG - Intronic
1030109443 7:106014057-106014079 CTGAAATGTGAGGATCACTTGGG - Intronic
1030735740 7:113046145-113046167 ATTAACTGTACAGATAACTTAGG + Intergenic
1032865925 7:135924406-135924428 CTCCACTGTGCAGAGAAATTGGG + Intergenic
1034463595 7:151212326-151212348 TTCAACAGTGATGATAACTATGG + Intronic
1035295656 7:157865636-157865658 CTCCACTGTGAAGACAACACTGG - Intronic
1035638570 8:1164958-1164980 CTCTAATGGGAAGATAATTTGGG - Intergenic
1037442359 8:18929326-18929348 CTCTACTGTTAGGATAACTGTGG - Intronic
1038812775 8:30867624-30867646 CTACACTGTGATGATAAATTTGG + Intronic
1042280150 8:67047538-67047560 CTTAAATTTGAAAATAACTTAGG + Intronic
1042824677 8:72968129-72968151 TTCTACTTTGAATATAACTTGGG - Intergenic
1043363747 8:79506565-79506587 TTCAATTGTCAAAATAACTTCGG - Intergenic
1043812266 8:84755084-84755106 GTCAACTGTCAAGATGACTCAGG + Intronic
1044510357 8:93070227-93070249 CTCAACTCTGAATATAACATGGG - Intergenic
1045797892 8:106066967-106066989 GTCATTTGTGAAGATAATTTTGG - Intergenic
1047111338 8:121792654-121792676 CTCAACTGTGAAGAATACCTGGG - Intergenic
1048393336 8:133988833-133988855 CCCATCTGTCTAGATAACTTTGG - Intergenic
1048801295 8:138196604-138196626 CTCAACTGCTGAGATAACTGTGG - Intronic
1049442947 8:142617459-142617481 CTCAACCGTGAACAGAACCTGGG - Intergenic
1051134042 9:13897889-13897911 CTCAATTGTGTAGATATTTTCGG + Intergenic
1055331797 9:75191971-75191993 CTAAACTATGAAGACAAATTTGG + Intergenic
1055848175 9:80593196-80593218 CTCAACAGTGGAAATAACTTTGG - Intergenic
1058924142 9:109645012-109645034 CAAAACTGTGAAGCCAACTTTGG - Intronic
1060620363 9:125059937-125059959 TTCAACTATGAATATAAATTTGG - Intronic
1061765736 9:132880016-132880038 CCCAACTGTAAAGATAGCTGGGG + Intronic
1186244385 X:7605401-7605423 CTCAACTCTGAATATAGCATGGG - Intergenic
1187750447 X:22458105-22458127 TCCTACTTTGAAGATAACTTTGG + Intergenic
1189027489 X:37411919-37411941 TTAAAATATGAAGATAACTTAGG + Intronic
1193495320 X:82204026-82204048 CACAACTGTGAATATAAATCGGG + Intergenic
1194497366 X:94634540-94634562 CAAAACTGTGAAAACAACTTTGG + Intergenic
1194686953 X:96931975-96931997 ATTAACTGTGCAGTTAACTTAGG + Intronic
1198504972 X:137292542-137292564 CTCAACTCTGAATATAGCCTGGG + Intergenic
1199665846 X:150095828-150095850 CTGAGCTATGAAGTTAACTTAGG + Intergenic
1200383659 X:155866311-155866333 CTCATCTGTGATGTAAACTTTGG - Intergenic
1200836975 Y:7741420-7741442 CTTAACAGTGAAGAAAACTGAGG + Intergenic