ID: 1106197491

View in Genome Browser
Species Human (GRCh38)
Location 13:27506884-27506906
Sequence GTACTCCTGAGTGTGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106197487_1106197491 30 Left 1106197487 13:27506831-27506853 CCACTAATACAAACAGATTTTAA 0: 1
1: 0
2: 1
3: 35
4: 401
Right 1106197491 13:27506884-27506906 GTACTCCTGAGTGTGTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 105
1106197488_1106197491 1 Left 1106197488 13:27506860-27506882 CCTATTCAATAAAATCACCCAAA 0: 1
1: 0
2: 1
3: 26
4: 341
Right 1106197491 13:27506884-27506906 GTACTCCTGAGTGTGTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106197491 Original CRISPR GTACTCCTGAGTGTGTACCC AGG Intergenic
902089340 1:13891057-13891079 CTACTCCTGGTTGTGTAGCCAGG + Intergenic
904673699 1:32184447-32184469 GCACTCATGAGTGTGAGCCCAGG + Intronic
905336046 1:37245271-37245293 TTATTCCTGAGTGTGGTCCCAGG + Intergenic
907559844 1:55378417-55378439 GTTCTCCTAAGCGTGTCCCCAGG - Intergenic
916887158 1:169081179-169081201 GCACTCCTGAGTGTAGACCTTGG - Intergenic
916887272 1:169082006-169082028 GCACCCCTGAGTGTGGACCTTGG + Intergenic
924405549 1:243741767-243741789 GTAAGCCTGAGTTTGTACCAAGG - Intronic
1064871209 10:19938748-19938770 GTACTGCTGATTGCTTACCCAGG - Intronic
1068101283 10:52556700-52556722 TTACTTCTAAGTGTCTACCCTGG + Intergenic
1069513993 10:69063174-69063196 CCACTCCTGGGTGTTTACCCAGG + Intergenic
1069525662 10:69168340-69168362 GTACTACTGAGGATGAACCCTGG + Intronic
1069824856 10:71248729-71248751 GTACCCCTGAGCATGTACACAGG - Intronic
1074689387 10:115990760-115990782 GTTCTCCTGAATGCCTACCCAGG + Intergenic
1075747468 10:124737704-124737726 GTAATCCTGAGTATGTTCACAGG + Intronic
1076249272 10:128972481-128972503 GTTGTCCTGAGTATGTCCCCAGG - Intergenic
1076455908 10:130595173-130595195 GTACCCCCCAGTGTTTACCCTGG - Intergenic
1077289778 11:1783673-1783695 GGACTCCTGAGTCTGGACCTGGG - Intergenic
1080634686 11:34113402-34113424 GTACCCCTGTGTGTGTATCCTGG + Intronic
1080896882 11:36455034-36455056 GTGCTGCTGAGTGTGTGCTCGGG - Intronic
1084783406 11:71426404-71426426 CTACTCCTGGGAGTGTTCCCAGG - Intergenic
1089284099 11:117394663-117394685 CTAATCCTGAGTGTGTTCCCTGG - Intronic
1089303337 11:117511894-117511916 GCACTCGTGCGTGTGCACCCTGG - Intronic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091034023 11:132217141-132217163 GTACTCCTGTGTCTAAACCCCGG + Intronic
1092367753 12:7891075-7891097 GTACTCCTGGGTGTGAAACAAGG - Exonic
1092779813 12:11975385-11975407 TTTCTCCTGAGTATATACCCAGG - Intergenic
1100777004 12:97986066-97986088 GCAGTCCTGAGTTTGTACCCTGG - Intergenic
1101961473 12:109253990-109254012 GAACTCCTGAGTGTGCTTCCCGG - Intronic
1103931864 12:124454796-124454818 TTTCTCCTGGGTGTGTACCTAGG - Intronic
1104637490 12:130447330-130447352 GTGCTCCTGCGTGTGGGCCCTGG + Intronic
1105717588 13:23082551-23082573 GCTCTCCTGAGTGTCTTCCCGGG + Intergenic
1106197491 13:27506884-27506906 GTACTCCTGAGTGTGTACCCAGG + Intergenic
1107041310 13:35950944-35950966 GTCCTCCTGCTTGTGGACCCTGG + Intronic
1112569253 13:100579282-100579304 GTACTCCTGCCTCCGTACCCTGG - Intronic
1113042225 13:106116831-106116853 ATTCTCCTGATTGTGTACCTGGG - Intergenic
1113472932 13:110559541-110559563 GGCCGCCTGAGTGTGTACACAGG + Intronic
1113656489 13:112071163-112071185 GTGCTCCCCTGTGTGTACCCTGG + Intergenic
1118268600 14:64319920-64319942 GTACTCCTTGGTTTTTACCCAGG + Intronic
1121230799 14:92356480-92356502 GAACTCCTGAATTTGAACCCTGG + Intronic
1121609892 14:95270818-95270840 CTACTCCTAGGTGTATACCCAGG - Intronic
1123696074 15:22880101-22880123 GTGCTCCTGGCTGTGGACCCAGG - Intronic
1124602842 15:31149244-31149266 GGACCCCTGAGAGTTTACCCTGG + Intronic
1124804637 15:32869281-32869303 GTTCACCTGAGTGTGTAACCTGG - Intronic
1125484637 15:40103621-40103643 GGACTCCGGAGAGTGTACCTCGG - Intronic
1131316641 15:91344569-91344591 TTAGTCCTGAATTTGTACCCTGG + Intergenic
1131316905 15:91347255-91347277 TTAGTCCTGAATTTGTACCCTGG + Intergenic
1131519555 15:93103212-93103234 GTTCTCCTAAGAGAGTACCCAGG + Intergenic
1140508582 16:75490748-75490770 GTTCTCTAGGGTGTGTACCCAGG - Intronic
1142500319 17:328546-328568 GTACTCTTGGGTGTGTAACTAGG - Intronic
1143355841 17:6327837-6327859 ATACTCCTAAGTCTGTACTCTGG - Intergenic
1143860659 17:9888285-9888307 GAACTCCTGAGGGTGAACCAAGG - Intronic
1148834088 17:50456282-50456304 GTACTCCTCAGTTTCTACTCAGG + Intronic
1152024293 17:77798707-77798729 GTACTGATGAGTGAGTACCTGGG - Intergenic
1152511722 17:80794550-80794572 CTACTCCTGGATATGTACCCTGG + Intronic
1161705398 19:5818550-5818572 GTACCCCTGTGTGTGTGGCCAGG + Intergenic
1162014381 19:7836729-7836751 CTACTCCTGAGGCTGAACCCAGG - Intronic
1162861696 19:13510402-13510424 TTTCTCCTGGGTGTATACCCAGG - Intronic
1163688357 19:18725070-18725092 GGTCTCCTGGGTGTGTACTCAGG - Intronic
1163718022 19:18883756-18883778 GAACTCCTGGGTGTGTGACCTGG + Intronic
1164234022 19:23316496-23316518 GTATTCCTGGCTGAGTACCCAGG + Intronic
927263886 2:21123565-21123587 GGACTCCTGAGTTTCTATCCTGG + Intergenic
927688799 2:25192636-25192658 GCATTCCTGGGTGTGTACGCAGG + Intergenic
935754274 2:106264983-106265005 GCGCTCCTGAGAGTGTGCCCAGG + Intergenic
936114107 2:109688379-109688401 GCGCTCCTGAGAGTGTGCCCAGG - Intergenic
937960147 2:127452238-127452260 GTACTTCTGAGTGGCTATCCTGG + Intronic
943753658 2:191536283-191536305 GTGCCCCTGAGTGTTTTCCCTGG - Intergenic
944895305 2:204158010-204158032 ATTCTCTTGGGTGTGTACCCAGG + Intergenic
947944105 2:234084881-234084903 CTTCTTCTGAGTGTGTCCCCTGG - Intergenic
1168870100 20:1120238-1120260 GGGATCCTGAGTGTGTACCTGGG - Intronic
1174120488 20:48261266-48261288 CTACTCCTGAGTGGGGACCGTGG + Intergenic
1175262914 20:57686016-57686038 GTCACCCTGAGTGTGTCCCCGGG - Intronic
1180056968 21:45363979-45364001 GTGCTCCTGAGCGTGGACACTGG + Intergenic
1181102668 22:20551914-20551936 GACCTCCTGAGTCTGCACCCTGG + Intronic
1181484327 22:23220911-23220933 CAACTCCTGTGTGTGTCCCCGGG - Intronic
1182566823 22:31206356-31206378 GCACTCTTGAGTGGGTGCCCAGG - Exonic
1185192695 22:49448659-49448681 GTACTCCTGCCTGTGTAACAAGG - Intronic
950318228 3:12024782-12024804 TTCCTGCTGGGTGTGTACCCAGG + Intronic
952023136 3:29047290-29047312 GTACTCCTGCTTGACTACCCAGG + Intergenic
952550802 3:34474492-34474514 CTACTCCTAAGTATTTACCCAGG - Intergenic
954382290 3:50226178-50226200 CTAATCCTGTGTGTGTAGCCAGG - Intergenic
955942039 3:64155532-64155554 GTTCTCTTGAGTGTATACCCAGG - Intronic
956421475 3:69090717-69090739 GTACTCCTGACTGTATCCTCAGG - Intronic
961367499 3:126409462-126409484 CCACTCTTGGGTGTGTACCCAGG - Intronic
965416055 3:168394210-168394232 TTTCTCCTGGGTGTTTACCCAGG - Intergenic
968711508 4:2122814-2122836 TTTCTCCTGAGTGTATACCTAGG - Intronic
971609926 4:28710933-28710955 ATACTCATGAATGTGTATCCAGG - Intergenic
979763713 4:124438710-124438732 GTGTTCCTGAGTGAGAACCCAGG - Intergenic
986531086 5:8737846-8737868 GAACACCTGAGTGTGAACCCTGG + Intergenic
986744623 5:10732667-10732689 GTTCTCTTGAGTGTATACCTAGG + Intronic
986826337 5:11526748-11526770 GTTCTCCTGGGTGTGTACCTAGG - Intronic
987011874 5:13774523-13774545 GTACTCCAGAGTCTCTCCCCAGG - Intronic
990394318 5:55360449-55360471 TTTCTCCTGACTGTGTACCTAGG + Intronic
992519057 5:77530260-77530282 CTACTACTAAGTGTTTACCCAGG + Intronic
995158632 5:108947191-108947213 GTTCTCTTGGGTGTGTACCCAGG + Intronic
997688260 5:135805144-135805166 GCACACCTGTGTGTGCACCCTGG + Intergenic
998548881 5:143057333-143057355 CTACTCCTGAGTTTGTTCTCAGG + Intronic
999144197 5:149381787-149381809 GATGTCCTGAGTGTGAACCCAGG + Intronic
1006855696 6:37131631-37131653 GTACTGCTCTGTGTGTGCCCTGG - Intergenic
1007122586 6:39395675-39395697 GTACTCCTAAGAGTGTACCCTGG - Intronic
1010736293 6:79447436-79447458 GTTCTCTTGGGTGTATACCCAGG - Intergenic
1020247972 7:6445123-6445145 TTTCTCTTGAGTGTGTACCTAGG - Intronic
1032961090 7:137035497-137035519 GTACTCCTGAGTTTATCCCAGGG + Intergenic
1035231797 7:157469903-157469925 GGACTCCTGAGTGGGCGCCCAGG + Intergenic
1040298792 8:46177251-46177273 GTACTCCTGAGCAGGTACTCAGG + Intergenic
1042602959 8:70517085-70517107 GTTCTCCTGAGTGTACACCTAGG + Intergenic
1043157795 8:76806938-76806960 CTACTCCTGAGTGTTTAGGCTGG + Intronic
1043985058 8:86684485-86684507 GTACTCCTGGGTATTTATCCTGG + Intronic
1048900900 8:139036976-139036998 GAATTCCTGAGTGTCTACACTGG + Intergenic
1050776788 9:9273628-9273650 GTACTCTAGAGTGTCTACCCAGG + Intronic
1052401761 9:28009864-28009886 CTTCTCTTGAGTATGTACCCAGG - Intronic
1052692280 9:31830426-31830448 CTACTGCTGAGTATCTACCCAGG + Intergenic
1059937124 9:119322471-119322493 CTCCTCCTGAGTGTGTGCCTCGG - Intronic
1062387700 9:136319705-136319727 GTCATCCTGCGTGTGTATCCTGG - Intergenic
1189526931 X:41832506-41832528 GTTCTCTTGGGTGTATACCCAGG - Intronic
1191803691 X:65109693-65109715 GTTCTCATGAGTGTACACCCAGG + Intergenic
1193144081 X:78059371-78059393 GTACTCCTGGGTATTTACCCAGG - Intergenic
1197159175 X:123304557-123304579 GTATTCCTGAGACTGTTCCCTGG - Intronic