ID: 1106200186

View in Genome Browser
Species Human (GRCh38)
Location 13:27529559-27529581
Sequence TTCGCCCCAGGTTTTCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106200183_1106200186 8 Left 1106200183 13:27529528-27529550 CCACATCTCAGAAGGTTTTTAGA 0: 1
1: 0
2: 2
3: 25
4: 220
Right 1106200186 13:27529559-27529581 TTCGCCCCAGGTTTTCTAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106200186 Original CRISPR TTCGCCCCAGGTTTTCTAAA GGG Intergenic
911746171 1:101444115-101444137 TTAGCCCCAGTTTTGCTACATGG + Intergenic
911817578 1:102373015-102373037 TTCGACACAGGCTTTCTAAAGGG + Intergenic
916744382 1:167673276-167673298 TTTGCCCAAGGTTTTCAGAATGG + Intronic
917856013 1:179100603-179100625 TTGCCTCCAGCTTTTCTAAAAGG + Exonic
1074533713 10:114313806-114313828 TGGCCCCCAGCTTTTCTAAAGGG - Intronic
1081686220 11:45044929-45044951 TCTTCCCCTGGTTTTCTAAAAGG + Intergenic
1087294668 11:96357014-96357036 TGAGCCCCAGGCATTCTAAAGGG + Intronic
1088938746 11:114432258-114432280 AGAGCCGCAGGTTTTCTAAAAGG - Intronic
1089140617 11:116280939-116280961 ATCACCCCAGGTTTTTTAAGGGG + Intergenic
1092511438 12:9160998-9161020 TTTGGCCCAGGTTTACTAAATGG + Intronic
1099264134 12:80423161-80423183 TTCCTCCCAGGTTTTCTTTATGG + Intronic
1101207402 12:102502301-102502323 TCCTTCCCAGGTTTGCTAAAGGG - Intergenic
1102968140 12:117144517-117144539 GTCACCCCAGGGTTTCCAAAGGG + Intronic
1104048083 12:125177490-125177512 TTTGCCCCAGGTCATCCAAATGG - Intergenic
1106200186 13:27529559-27529581 TTCGCCCCAGGTTTTCTAAAGGG + Intergenic
1106469074 13:30038795-30038817 CTCGCCCCAGACTTTCCAAATGG + Intergenic
1106612687 13:31298825-31298847 TTAGCCCCAGCTTTGCTAAGCGG + Intronic
1108764365 13:53608591-53608613 TACGCCACAGGGTTCCTAAAGGG - Intergenic
1110213520 13:73001093-73001115 TTTGCCCCAGGTTATCTAGTCGG - Intronic
1112526672 13:100155067-100155089 TTGGGCCCTGGTTTTCTTAATGG - Exonic
1115562030 14:34591311-34591333 TTGGACCAATGTTTTCTAAACGG - Intronic
1116499277 14:45600934-45600956 TTCTCCCCAGGATTTCAAATTGG + Intergenic
1117567358 14:57008335-57008357 ATTGTCTCAGGTTTTCTAAAAGG - Intergenic
1120298793 14:82679494-82679516 TACCCCCAAGGTTTTCTATAAGG + Intergenic
1120455081 14:84719607-84719629 TTGGCCCCAGGTTCTCAACATGG - Intergenic
1121963744 14:98285474-98285496 AGCTCCCCAAGTTTTCTAAATGG - Intergenic
1124202730 15:27692325-27692347 GTTGCTCCAGGTTTTCGAAAGGG + Intergenic
1127942732 15:63716195-63716217 TTCTCCATAGTTTTTCTAAAAGG - Intronic
1140709388 16:77662803-77662825 TTCCCCCCAAGTTTTCTAATGGG - Intergenic
1141841650 16:86577689-86577711 TTTGCCCCCGGTTCTCTAAATGG + Intronic
1143965594 17:10754603-10754625 GTAGCCCCAGGTGTTCCAAAGGG - Intergenic
1144236367 17:13264397-13264419 TTTACCCCAGGCTTTCTCAATGG + Intergenic
1151121013 17:71793023-71793045 TTGTCCCGAGGCTTTCTAAATGG + Intergenic
1155783565 18:29871970-29871992 TTCCACCTAGGTTTACTAAATGG - Intergenic
1159341569 18:67140836-67140858 TTCTCCCCTGCTTTTCCAAATGG + Intergenic
1159653905 18:71009124-71009146 TTAGTCTCAGGCTTTCTAAATGG - Intergenic
1163482680 19:17567335-17567357 TTTGCCCCAGCTGTTCTGAATGG + Intronic
1164369780 19:27634556-27634578 CTGACCCCAGGTATTCTAAAGGG - Intergenic
1167995735 19:53400677-53400699 TTTTCCCCAGATTTTCAAAATGG - Intronic
928030875 2:27777886-27777908 TTCCCCCATGGTTTTCTACAGGG - Intronic
931991125 2:67791492-67791514 TTGGCTCCTGGGTTTCTAAAAGG - Intergenic
932419876 2:71595442-71595464 ATCACCCCAGTTTTCCTAAAAGG - Intronic
936670342 2:114649190-114649212 TTCCTCCTAGGTTTTCTAACAGG - Intronic
937428811 2:121821204-121821226 GTCGCCCATGGTTTTATAAATGG + Intergenic
941755230 2:169178372-169178394 TTCACCCCAGGATATCAAAAGGG - Intronic
943726478 2:191256551-191256573 TTCTCCCCATATTTTCCAAAGGG - Intronic
945522099 2:210841051-210841073 TTCTCCCTAGGTTTCCAAAAAGG - Intergenic
947127481 2:226885703-226885725 TTCCCCCCAAATTTTCTACAGGG + Intronic
948167627 2:235875246-235875268 TTAGTCCCAGGAATTCTAAAAGG - Intronic
948672094 2:239575192-239575214 TTCGCCAGAGGCTTTCGAAAGGG - Intergenic
1169923085 20:10756056-10756078 TTTGCCCGAGGTTTTCTTAATGG + Intergenic
950815644 3:15699288-15699310 TATGCCCTAGGTTTTCTAATAGG - Intronic
962911505 3:139855563-139855585 TTGGCCCCAAGTTCTCTGAATGG + Intergenic
964945785 3:162221997-162222019 CTTGACCCAGGTTTCCTAAATGG + Intergenic
965680686 3:171248184-171248206 ATGGCTCCAGTTTTTCTAAAAGG + Intronic
966702162 3:182866197-182866219 TTTGCCTCTGGTTTCCTAAATGG + Intronic
969610671 4:8226183-8226205 TTCGTCCCAGGTTTTCCAACAGG + Intronic
971115503 4:23641439-23641461 TTCTTCCCAGGTTTTCTTCATGG + Intergenic
972133974 4:35868658-35868680 TCCTCTCAAGGTTTTCTAAACGG + Intergenic
976522462 4:86044741-86044763 TGCGTCACAGGTTTTCTGAAAGG + Intronic
984748970 4:183253352-183253374 TTCACCTCAGTTTTTTTAAAGGG + Intronic
988173690 5:27692971-27692993 TTCGTCTAATGTTTTCTAAAAGG + Intergenic
990741473 5:58916641-58916663 TTCCCCCCAGACTCTCTAAAAGG + Intergenic
991615518 5:68493335-68493357 GCAGCCCCAGGTATTCTAAATGG + Intergenic
1006136335 6:31898197-31898219 TTAGCCACAGGTTTTCAGAAGGG - Intronic
1013684361 6:112562056-112562078 TTCTCCCCAGGATTTCTCAGGGG + Intergenic
1015121915 6:129709452-129709474 TTTCCCCCAGGCTTTCAAAAAGG - Intronic
1018758404 6:166869386-166869408 TTCACACCGGGTTTTTTAAAAGG - Intronic
1018880299 6:167871898-167871920 TTCTCCCCCAGTTTTCTAACTGG + Intronic
1020808018 7:12814727-12814749 TTGGACCAAGGTGTTCTAAAAGG + Intergenic
1032420730 7:131777063-131777085 TCTTCCCCAGGTTTTCTTAATGG + Intergenic
1034251653 7:149696547-149696569 TTCTACCCAGGTTCTCTATAAGG - Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1039891421 8:41688218-41688240 TTCTCCCCAGGTTCTCTCAGTGG - Exonic
1045009640 8:97946491-97946513 TTCCCCCCATTTTTTTTAAATGG - Intronic
1051061146 9:13046591-13046613 TTTGCCCCAGGTTACCTAATAGG + Intergenic
1051527989 9:18068585-18068607 TTCAACCCAGGGTTCCTAAAGGG + Intergenic
1059550110 9:115220619-115220641 TTCTTCCCTGGTTGTCTAAATGG + Intronic
1188269403 X:28120144-28120166 TTCCCCCCAGGTTGGCAAAAGGG + Intergenic
1191232057 X:58103791-58103813 CTCACCCCAGGCATTCTAAACGG + Intergenic
1191240968 X:58189812-58189834 CTGACCCCAGGTATTCTAAAGGG + Intergenic
1191245503 X:58225232-58225254 TTTGCCCCAGGCATTCTAATGGG + Intergenic
1191245630 X:58226100-58226122 CTGACCCCAGGTATTCTAAAGGG + Intergenic
1191245656 X:58226274-58226296 TTGACCCCAGGCATTCTAAAGGG + Intergenic
1193769997 X:85577002-85577024 TTAGCCCCAATTTTTCTAGATGG - Intergenic
1197415811 X:126171280-126171302 TTATCCCCAGATTTTTTAAATGG + Intergenic
1198884521 X:141319806-141319828 TTTGCCACAGTTTTTCAAAAAGG + Intergenic
1199322424 X:146455982-146456004 TTGCCCCCAAGTTTTCTATATGG - Intergenic