ID: 1106208908

View in Genome Browser
Species Human (GRCh38)
Location 13:27622646-27622668
Sequence CCATCCACACTGGCCACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106208908_1106208915 -8 Left 1106208908 13:27622646-27622668 CCCCTTGTGGCCAGTGTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1106208908_1106208914 -9 Left 1106208908 13:27622646-27622668 CCCCTTGTGGCCAGTGTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1106208914 13:27622660-27622682 TGTGGATGGTCAAATGGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 157
1106208908_1106208916 1 Left 1106208908 13:27622646-27622668 CCCCTTGTGGCCAGTGTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1106208916 13:27622670-27622692 CAAATGGAGCAGGGAAAAACTGG 0: 1
1: 1
2: 5
3: 60
4: 405
1106208908_1106208917 4 Left 1106208908 13:27622646-27622668 CCCCTTGTGGCCAGTGTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1106208917 13:27622673-27622695 ATGGAGCAGGGAAAAACTGGAGG 0: 1
1: 0
2: 0
3: 24
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106208908 Original CRISPR CCATCCACACTGGCCACAAG GGG (reversed) Intronic