ID: 1106208915

View in Genome Browser
Species Human (GRCh38)
Location 13:27622661-27622683
Sequence GTGGATGGTCAAATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106208910_1106208915 -9 Left 1106208910 13:27622647-27622669 CCCTTGTGGCCAGTGTGGATGGT 0: 1
1: 0
2: 1
3: 21
4: 207
Right 1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1106208908_1106208915 -8 Left 1106208908 13:27622646-27622668 CCCCTTGTGGCCAGTGTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1106208911_1106208915 -10 Left 1106208911 13:27622648-27622670 CCTTGTGGCCAGTGTGGATGGTC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106208915 Original CRISPR GTGGATGGTCAAATGGAGCA GGG Intronic
900900907 1:5515229-5515251 GTGGAAGGTAAAATGGAGCCAGG + Intergenic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901667047 1:10831936-10831958 GTGGAGGGTCAGATGGCTCAGGG - Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906662831 1:47594647-47594669 CTGCATGGTCAAGTGAAGCAAGG - Intergenic
907070048 1:51526310-51526332 ATGTCTGGTTAAATGGAGCATGG + Intergenic
908176072 1:61556297-61556319 GTGGATGGTAAAATGGAAACAGG - Intergenic
910735774 1:90455315-90455337 GTGGATACTCAAATGCACCAGGG - Intergenic
911854401 1:102858780-102858802 GTGGCTGGTGAGGTGGAGCAGGG - Intergenic
912529251 1:110308180-110308202 GTGGATGGTCATAATGAGGAAGG - Intergenic
916255517 1:162783502-162783524 GGGGAAGGTCAAGTCGAGCAAGG + Exonic
916575786 1:166065153-166065175 GTGGCTGGACAAGTGGAGGAGGG + Intronic
922712176 1:227842538-227842560 GTGGAAGGCCAGATGGGGCAGGG - Intronic
1063345873 10:5312057-5312079 GTGGCTTGTCAAATGCAGCCTGG - Intergenic
1064034233 10:11902267-11902289 GTGGGAGGTGACATGGAGCAGGG - Intergenic
1064458768 10:15512884-15512906 GGGGATGGTTAAATGAACCATGG + Intergenic
1068067710 10:52152606-52152628 TTCTATGGTCAAATGTAGCATGG + Intronic
1068528579 10:58159055-58159077 ATGGATGGTCAAATGAATCATGG - Intergenic
1068654086 10:59556487-59556509 GTGGAAGGTGAAGGGGAGCAGGG - Intergenic
1073654841 10:105402619-105402641 GGAGATGGTCAAATGGTACAAGG + Intergenic
1074008491 10:109453199-109453221 CTGGATGGTGAAATTGAGGAGGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1078917616 11:15794860-15794882 GTGAAAGGTCAAATGAAGTAAGG + Intergenic
1082980585 11:59116939-59116961 GGGGCTTGTCAAATGGAGAAAGG - Intronic
1084461879 11:69300777-69300799 GTGGATGGTCTAAGGGAAGATGG + Intronic
1084785656 11:71440394-71440416 GTGGATGGACAAATAGATGACGG + Intronic
1087550083 11:99638273-99638295 GTGGGAGGTCAAATGAATCATGG - Intronic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1093342020 12:17988689-17988711 GTGGCTGGTCATATTTAGCAGGG - Intergenic
1097525891 12:60735429-60735451 GTGGAATGTTATATGGAGCATGG - Intergenic
1100029936 12:90174283-90174305 GCAGATTGTCAAATGGTGCATGG - Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1104415226 12:128592434-128592456 GTGGATGGACAAATGATGGAAGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104926017 12:132314173-132314195 GTGGATGGATAAATGGATGATGG - Intronic
1106085303 13:26536340-26536362 GTGGATAGTTGAATGGAGAAGGG + Intergenic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1110932613 13:81241176-81241198 CAGGAAGGTCAAATGGAGAATGG + Intergenic
1112240758 13:97679083-97679105 GTGGAAGGTGAAATGGGGGAAGG - Intergenic
1112533290 13:100225076-100225098 GTGGAAAGTAAATTGGAGCATGG + Intronic
1112585059 13:100711758-100711780 GTGGATGTTAGAATGGAGGAAGG - Intergenic
1112728381 13:102331011-102331033 GTTGCTGTTCAAATGGAGGACGG - Intronic
1116500812 14:45618659-45618681 GCGGATGGTAAAATAAAGCATGG + Intergenic
1116840020 14:49810499-49810521 GAGGATGGACAAATAGATCAAGG - Intronic
1122320713 14:100853958-100853980 GTGGATGGAAGAATGGAGGAAGG + Intergenic
1122915298 14:104855535-104855557 GTGGAGGGGTGAATGGAGCAGGG + Intergenic
1125024305 15:35015447-35015469 GTGGGTGTTCCATTGGAGCAGGG - Intergenic
1125426584 15:39555279-39555301 GTTGGTGGTCAAAGGGAGAAAGG + Intergenic
1130914796 15:88296598-88296620 GTGGGTGGTCCAAGGCAGCAGGG + Intergenic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1140759410 16:78097716-78097738 TTGGTTGGTCAAATGTAGAAAGG + Intergenic
1141126547 16:81404624-81404646 GTGGATGGTGGAAGGGAGCAGGG - Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1145290932 17:21545260-21545282 GTGGAAGGGGAAGTGGAGCAAGG - Intronic
1146702157 17:34970670-34970692 GCGGATGGTCACATGGAGGAAGG - Intronic
1146892192 17:36513456-36513478 GTCAATGCCCAAATGGAGCATGG + Exonic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1149006920 17:51815600-51815622 GCAGATGGTAAAAAGGAGCATGG - Intronic
1150360564 17:64529867-64529889 GTGGATTTTGAAATGTAGCATGG + Intronic
1150848128 17:68679939-68679961 GTGGATGGACAAATGGGTAATGG - Intergenic
1156678514 18:39560918-39560940 GGGGATGGTTAAATGCATCAAGG + Intergenic
1157618747 18:49003264-49003286 GTGGAAGGGAAAATGGAGGAGGG - Intergenic
1157966065 18:52209733-52209755 GGCCATGGTCAAATGGATCAAGG - Intergenic
1158408820 18:57186536-57186558 GTGGGTGGTCCAGTGCAGCAGGG - Intergenic
1161618573 19:5286303-5286325 AGGGAGGGTCACATGGAGCAGGG + Intronic
1162115908 19:8429226-8429248 GTGAACGGTCACATGGGGCAAGG - Intronic
1162932786 19:13965693-13965715 GTGCTTGGTCCATTGGAGCACGG + Exonic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163747004 19:19054670-19054692 GTGGATGGGCACATGGAGAAGGG - Intronic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1202682359 1_KI270712v1_random:18719-18741 GAGAATGGTCAAAGGGAGGAAGG + Intergenic
925711962 2:6750007-6750029 GAGGACGGACAGATGGAGCATGG - Intergenic
926265381 2:11312977-11312999 GAGGATGATGAAGTGGAGCACGG + Intronic
926315555 2:11707237-11707259 GGGGATGATCAGATGGACCAAGG + Intronic
926483532 2:13428087-13428109 ATGGATGGTGAAAGGAAGCAGGG - Intergenic
927358791 2:22207659-22207681 GTGTATGGTCATATGGAGGTGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929905616 2:46043636-46043658 GTGGAAGGGGAGATGGAGCAGGG + Intronic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
934706973 2:96488387-96488409 TTGGATGGTGAAATGGTGAAAGG - Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
935895235 2:107729947-107729969 GTGAATGGTCAAACGGTTCATGG + Intergenic
938967781 2:136403973-136403995 GTGGATGGCAAAATGTAGAAAGG - Intergenic
940037675 2:149328413-149328435 GAGGAAGTTCAAATGGAGCCTGG - Intergenic
940156359 2:150660967-150660989 GTGGAAGGTGAAAGGGAGCTGGG - Intergenic
941169445 2:162118942-162118964 GTGAATGTTCAACTGGGGCAAGG + Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
942887356 2:180942528-180942550 GTGGATTGTCAAATGATACATGG - Intergenic
1172182856 20:33014181-33014203 GTGTATTGTCAAGTGGTGCAGGG - Intronic
1173905791 20:46627837-46627859 GGGGATTTTAAAATGGAGCAGGG - Intronic
1174205952 20:48839219-48839241 GTTGACGGTCAAATGGCCCAAGG - Intergenic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1179384235 21:40927278-40927300 GGGAGTGTTCAAATGGAGCAGGG - Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1181778730 22:25178170-25178192 GAGGATGGTCAGCTGGAGGACGG - Intronic
1182349494 22:29691242-29691264 CTGGATTGCCAAAGGGAGCATGG + Intronic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
952117079 3:30195627-30195649 TTGGATGGTCATATAGAGAAAGG + Intergenic
955392148 3:58529761-58529783 GTGGAGGGTGAAATGCAGTAAGG - Intronic
955562773 3:60210238-60210260 GTGGATAGTCACATGAAGAAAGG + Intronic
959003396 3:100991058-100991080 GAGGATGCTCAAAGGGAACAGGG - Intronic
959317552 3:104826944-104826966 GTGGAATGTCAAATGGAGAATGG + Intergenic
959740803 3:109717247-109717269 CTGGATGGTTCAATGGATCATGG - Intergenic
961082983 3:124042412-124042434 GTGGAGGGTCCATTGGAGTAGGG + Intergenic
967912599 3:194554787-194554809 GAGGCTGGTCAAATAGAGGACGG + Intergenic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969510318 4:7614034-7614056 GTGGATGGATAAATGGATTATGG - Intronic
974459099 4:62164636-62164658 GTGGAAGGGCAAATAGATCAAGG - Intergenic
975356854 4:73416647-73416669 GTTAATGGGCAAATAGAGCATGG + Intronic
975733491 4:77359614-77359636 GTGGGTGGTCAAGTGGAATAAGG - Intronic
975735219 4:77373901-77373923 GTGAGAGGTCAAATGGAACAAGG - Intronic
976604209 4:86967513-86967535 GTCGCTTGTCAAATGGAGAATGG + Intronic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
977297344 4:95225447-95225469 ATGGATTGTCAAATGGAGCAAGG + Intronic
978230474 4:106391842-106391864 GTGGGAGGCCAAATGGAGGAGGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988879286 5:35482964-35482986 GTGGTTGGTCCCATGGAGCAAGG + Intergenic
994243879 5:97456373-97456395 GTGTATTGTCATATGGAGCTGGG + Intergenic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1002866569 6:1127218-1127240 CTGGATGGGCAAAGTGAGCAAGG - Intergenic
1002955519 6:1859363-1859385 GTAGAAAGTCAAATGGAGCTAGG + Intronic
1004488325 6:16089312-16089334 GTGGAAGGTAAAGGGGAGCAGGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1012652476 6:101773054-101773076 GTGTATGTTCATATGGGGCAGGG + Intronic
1013662254 6:112309486-112309508 GTGGCTTGCCAAATGCAGCAGGG - Intergenic
1014178332 6:118354468-118354490 TTGGATGTTCTAATGGAACATGG - Intergenic
1017308500 6:152949394-152949416 GTAGATGGTGAATTGGAGAAGGG - Intergenic
1018580251 6:165301977-165301999 GTGGATGGTGAAGTGGGCCAGGG + Exonic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1020966201 7:14871473-14871495 GTGGATAGTAAATTGGAGTAGGG - Intronic
1025836529 7:65099259-65099281 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1025906298 7:65788693-65788715 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1026903437 7:74049455-74049477 GTGGATGGATGAATGGAGCGAGG - Intronic
1028603666 7:92630822-92630844 CTGGAAGGTCATTTGGAGCAAGG + Intronic
1031922623 7:127612918-127612940 ATGGATGGACGAATGGAGGATGG + Intronic
1035486738 7:159231925-159231947 GTGGATGGACACATGTAACAGGG - Intergenic
1036287233 8:7453886-7453908 GTGGAGGGTCAAAAGCAGCTTGG - Intronic
1041234289 8:55783637-55783659 GTGGAAGGACAAATGCAGTAGGG - Intronic
1042299918 8:67266912-67266934 GTGTATGGTTGAATGGAGTAAGG - Exonic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1044723079 8:95169220-95169242 GTGGATGGTGAAAAGGTCCAGGG + Intergenic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1048642268 8:136377042-136377064 GTGGATGGTCAGATAGAAGAAGG + Intergenic
1049128179 8:140810992-140811014 GTGAATGCTCAAATGGAGACAGG + Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1050212940 9:3284636-3284658 GTGGAGGGGCAAATGGACCTAGG - Intronic
1053944437 9:43291986-43292008 GAGAATGGTAAAATGGAGGAAGG - Intergenic
1054874308 9:70079175-70079197 GTGGAGGGTCAGGTAGAGCATGG - Intronic
1055645234 9:78356702-78356724 GTGGATGATCAATTGGGGGATGG + Intergenic
1056875856 9:90329860-90329882 GTGGATGTTCTCATGGATCATGG - Intergenic
1203587573 Un_KI270747v1:20564-20586 GAGAATGGTAAAATGGAGGAAGG - Intergenic
1189525464 X:41815177-41815199 GAGGCTGGTCAAAAAGAGCAGGG + Intronic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1197199834 X:123738710-123738732 GTGGTTTGGCAAGTGGAGCATGG - Intergenic
1199141942 X:144323753-144323775 GTGGATTGCCCAATAGAGCATGG - Intergenic
1200129498 X:153833221-153833243 GTGGAATGTCTAATGGAGCGGGG - Intergenic