ID: 1106210691

View in Genome Browser
Species Human (GRCh38)
Location 13:27641720-27641742
Sequence CTATTGATGTGGAGCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106210684_1106210691 13 Left 1106210684 13:27641684-27641706 CCCCTCAGTGGGCCTATAAGAAA 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1106210685_1106210691 12 Left 1106210685 13:27641685-27641707 CCCTCAGTGGGCCTATAAGAAAG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1106210686_1106210691 11 Left 1106210686 13:27641686-27641708 CCTCAGTGGGCCTATAAGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1106210688_1106210691 1 Left 1106210688 13:27641696-27641718 CCTATAAGAAAGGAGCAGTTACA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106210691 Original CRISPR CTATTGATGTGGAGCAAACA GGG Intronic
903681573 1:25100927-25100949 CCTTTGATGTGGAGCCAACTGGG - Intergenic
905512799 1:38536035-38536057 CTCTTGCTGTGGGTCAAACATGG + Intergenic
906498900 1:46325721-46325743 TGATTGATTTGGAGCAAGCAAGG + Intergenic
907052363 1:51338319-51338341 CTATTAAAGTGGAGAAAGCAAGG + Intronic
913660683 1:121003882-121003904 CTTTGGATGTGAAGGAAACATGG + Intergenic
914012047 1:143787038-143787060 CTTTGGATGTGAAGGAAACATGG + Intergenic
914165785 1:145174096-145174118 CTTTGGATGTGAAGGAAACATGG - Intergenic
914650677 1:149695698-149695720 CTTTGGATGTGAAGGAAACATGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
920381533 1:205537191-205537213 CTGGTGATGTGACGCAAACATGG + Intergenic
923568350 1:235093251-235093273 GAATTGATGAGGAGGAAACAAGG - Intergenic
1065105416 10:22378886-22378908 CCATTGATCTGGAGTTAACAGGG - Intronic
1067189535 10:44057726-44057748 CTCCTGATGGGTAGCAAACAAGG - Intergenic
1067764302 10:49073561-49073583 CCATTGAATTGGAGGAAACAAGG - Intronic
1072095380 10:92173223-92173245 CTATACAAGTGGAGAAAACAGGG + Intronic
1072582247 10:96749801-96749823 CTATTGATGTACACAAAACATGG + Intergenic
1073150006 10:101305097-101305119 GTACTCATGTGGAGCAAATATGG - Intergenic
1073636154 10:105200847-105200869 CTATGGAGGTGGAGCAGAAACGG + Intronic
1077370310 11:2178783-2178805 CCATTGATATGGAACAAACAGGG + Intergenic
1079312212 11:19377129-19377151 ATATTGCTGTTGAGAAAACAAGG - Intronic
1080217010 11:29855414-29855436 CAATTGATATGGAGCCAAAAAGG + Intergenic
1086617980 11:88846487-88846509 CTATTGATGTGCAGCACAGATGG + Intronic
1087686984 11:101276059-101276081 GGATTGAAGTGGAGCAAGCAGGG + Intergenic
1087981884 11:104624520-104624542 CTATTGATGTGTAACAAAAAGGG - Intergenic
1093587106 12:20851879-20851901 CAATTGATGTTGAGAAAACTGGG - Intronic
1100661813 12:96707818-96707840 CTAGTGAAGTGGAGGAAGCAAGG + Intronic
1102181981 12:110919726-110919748 CTATTGATGTGGTGCAAGGACGG - Intronic
1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG + Intronic
1107833171 13:44392370-44392392 CTTTTGATGTGCAGTAAACACGG + Intronic
1109728571 13:66379208-66379230 CTTGTGATGTGCAGCACACATGG - Intronic
1109795435 13:67306192-67306214 CTATTTTTGTGAAGCAAATAGGG + Intergenic
1110575567 13:77051146-77051168 CTATAGATGTGTCCCAAACATGG - Exonic
1111108017 13:83671296-83671318 CTATTGATTTGGGGCCATCATGG + Intergenic
1112705278 13:102061079-102061101 CGATGGATGTGGAGCCAGCATGG - Intronic
1117551838 14:56844518-56844540 CTATTTATGTGGAGCAAGGCAGG - Intergenic
1118636747 14:67755008-67755030 CTATTGGTGTGGGGCAGAAAGGG - Intronic
1120683446 14:87508887-87508909 TTATTTATGTGAAGGAAACATGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1125038543 15:35155943-35155965 TTAGTGATATGGAGCAAACCAGG + Intergenic
1126662473 15:51046495-51046517 CTATTGATTTGGCGAACACATGG + Intergenic
1133490454 16:6262953-6262975 CTTTAGATGTGGAGTAGACAGGG + Intronic
1134348978 16:13418638-13418660 CTGATGATGTGGGGCAAACTGGG + Intergenic
1142247092 16:88975165-88975187 CTAAAGATGTGGAGCAGAGAGGG - Intronic
1151443896 17:74150867-74150889 GCATTGAAGTGGAGCAGACAGGG - Intergenic
1159706471 18:71695652-71695674 CTGTTCAAGTGGAGCACACAGGG - Intergenic
1161248006 19:3265285-3265307 CTATTGATGCAAAGCAGACAAGG + Intronic
1161498594 19:4600705-4600727 CTGTTTATGTGCAGAAAACAGGG - Intergenic
1162066771 19:8130803-8130825 CGAGTGATGTGGTGCAATCACGG - Intronic
1162605623 19:11705321-11705343 CGTTTCATGTGGAGCAACCATGG - Intergenic
1162699555 19:12503693-12503715 CTAGTGATGTGGAGTAAATTAGG - Intronic
1166386746 19:42386703-42386725 CCATAGATATGGAGCAAGCAAGG + Intergenic
926893796 2:17661895-17661917 AGATTAAAGTGGAGCAAACATGG - Intergenic
927867756 2:26602591-26602613 ATATTGATGTGTAGTATACATGG + Intronic
928681138 2:33703335-33703357 CTAAGAATGTGGAGCAAAAAGGG - Intergenic
933235279 2:79857811-79857833 CAAGTGCTGTGGACCAAACAAGG - Intronic
939438082 2:142204672-142204694 ATATCCATGTGTAGCAAACAGGG - Intergenic
941715368 2:168757744-168757766 CTATTAATCTGTAGCAAACATGG - Intronic
946027934 2:216683309-216683331 CTATCAAAGTGGAGCAATCATGG - Intronic
947287578 2:228533512-228533534 CTAAGAATGTGGAGAAAACAAGG + Intergenic
1175041612 20:56057424-56057446 CTATTGTCATGGAGCAGACATGG - Intergenic
1177684857 21:24422799-24422821 CTGTGCATGTGGAGTAAACACGG + Intergenic
952181145 3:30917849-30917871 CTATTGATGTAATCCAAACAGGG - Intergenic
955934829 3:64092537-64092559 CTAATGTTGTGGATCAGACACGG + Intergenic
957956948 3:87199507-87199529 CTATTTATGTGCAGAAAATAAGG - Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
966663184 3:182438500-182438522 CTCTTGATGTGGAGAATACAAGG + Intergenic
969313664 4:6368876-6368898 CTATTGATGTACTGTAAACAGGG - Intronic
969892537 4:10273075-10273097 CTGCTGATGTGTAGCACACATGG - Intergenic
973680308 4:53311150-53311172 CTAGTGATATGAAGCAAAAATGG + Intronic
973977603 4:56278883-56278905 CTAATGATGTTGAGCAAGTATGG - Intronic
974602819 4:64107803-64107825 CTATTGATTTGCATCAAAGAAGG + Intergenic
976738787 4:88337183-88337205 CAATTGAAATGGAGCAAACTAGG - Intergenic
977135084 4:93294193-93294215 GTTTTTTTGTGGAGCAAACAAGG - Intronic
977968058 4:103178495-103178517 CTCTTGAATTGGAGCAAACATGG - Intronic
981478443 4:145211340-145211362 CTATGAGTGTTGAGCAAACAAGG - Intergenic
990144482 5:52743615-52743637 CTATAAATGTGGAGGAAATAGGG + Intergenic
991645786 5:68799295-68799317 CTATGAATTGGGAGCAAACATGG + Intergenic
993126278 5:83839701-83839723 CATCTGAGGTGGAGCAAACAAGG - Intergenic
994214410 5:97121606-97121628 CTATTAAAATGGAGCAAGCAGGG - Intronic
995404367 5:111777755-111777777 TTATAGGTGTGGAGAAAACAAGG + Intronic
997838828 5:137219545-137219567 CTATTCATTTGGAGAAAAAAAGG - Intronic
998184295 5:139966984-139967006 CTATTGATGTGGAGCCACTGGGG - Intronic
998904994 5:146895155-146895177 CTTTTCAGGTGGAGCATACATGG - Intronic
1000426836 5:161101234-161101256 TTATTGATTGGGAGGAAACAAGG - Intergenic
1000706457 5:164519149-164519171 CTTTTGCTGTGTAGCAAACCAGG - Intergenic
1009192194 6:60642577-60642599 CTACTGTTGTGGAGAAGACAAGG - Intergenic
1009496226 6:64351300-64351322 CTATTTAAATGTAGCAAACATGG + Intronic
1009596743 6:65745860-65745882 CAACTGATGTGGAGCCCACAGGG + Intergenic
1011445329 6:87433027-87433049 CCACTGAAGTGGAGCAAACGAGG - Intronic
1012386058 6:98684553-98684575 CTATTGATGTTTTGCAACCATGG - Intergenic
1014578021 6:123098355-123098377 ATATTAATGTGAAGCAAGCAAGG + Intergenic
1014920560 6:127210657-127210679 CTATTGAGATGGGGCTAACAGGG - Intergenic
1016101335 6:140104751-140104773 CTATTGATTTGGTAGAAACAGGG + Intergenic
1022496463 7:30855999-30856021 CTATTGATTTTGGGCAAAGATGG - Intronic
1023319753 7:38981450-38981472 CTATAGACGTGAAGCCAACAGGG - Intronic
1024492881 7:50006135-50006157 CTAAAGATATGGAGCAAATATGG + Intronic
1025201228 7:56963043-56963065 CCATTGATGTGGCTCATACAGGG - Intergenic
1025670716 7:63613890-63613912 CCATTGATGTGGCTCATACAGGG + Intergenic
1031188438 7:118513579-118513601 ATATTGATGGAGAGGAAACAAGG - Intergenic
1037422378 8:18716741-18716763 CTATTGATGTAAATCAAGCATGG - Intronic
1047019633 8:120761148-120761170 CTATTGATATGGCGCTAAAATGG - Intronic
1051176060 9:14361638-14361660 CTACTGTTGTGTAGCAAAGAGGG - Intronic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1053552137 9:39093586-39093608 CTATTGATATCTAGTAAACATGG + Intronic
1055268983 9:74534334-74534356 CTATTCATGTGGATTAAAAAGGG - Intronic
1055360857 9:75488801-75488823 CTATTGATGAGCAGGGAACAGGG - Intergenic
1186721645 X:12310617-12310639 GTATTCATATGGAGCAAAAAAGG + Intronic
1188133161 X:26462880-26462902 CTATTTATGTGTAGTAAACATGG - Intergenic
1192307407 X:69976673-69976695 GTAATGATTTGGAGAAAACAAGG + Intronic
1194552577 X:95319956-95319978 CTATTGATGAGGAGACAAAAGGG + Intergenic
1194800242 X:98264128-98264150 CTATTGCTGGGGACAAAACAGGG + Intergenic
1198951881 X:142081092-142081114 CTATGAATGAGGAGAAAACAAGG + Intergenic
1199208515 X:145177972-145177994 CTATTGATGTGGAGAAGAAGTGG - Intergenic
1199570404 X:149261786-149261808 CTTTAGATGTGGAGCAGCCATGG - Intergenic
1199710262 X:150464049-150464071 CTAATGCTGTGAAGCACACATGG + Intronic
1201448453 Y:14083604-14083626 CTATTGCTGTTAAGTAAACATGG + Intergenic