ID: 1106211796

View in Genome Browser
Species Human (GRCh38)
Location 13:27655653-27655675
Sequence ACCAGATCTCTCCATTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 15, 3: 39, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106211795_1106211796 -3 Left 1106211795 13:27655633-27655655 CCTTGATAAAGCTGGTGACTACC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1106211796 13:27655653-27655675 ACCAGATCTCTCCATTATAAAGG 0: 1
1: 2
2: 15
3: 39
4: 196
1106211794_1106211796 -2 Left 1106211794 13:27655632-27655654 CCCTTGATAAAGCTGGTGACTAC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1106211796 13:27655653-27655675 ACCAGATCTCTCCATTATAAAGG 0: 1
1: 2
2: 15
3: 39
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106211796 Original CRISPR ACCAGATCTCTCCATTATAA AGG Intronic