ID: 1106211851

View in Genome Browser
Species Human (GRCh38)
Location 13:27656505-27656527
Sequence ATTTATAATCTAATGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106211845_1106211851 -9 Left 1106211845 13:27656491-27656513 CCTGCTCTCTTGGAATTTATAAT 0: 1
1: 0
2: 15
3: 100
4: 651
Right 1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG 0: 1
1: 0
2: 0
3: 30
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106211851 Original CRISPR ATTTATAATCTAATGGGGGT GGG Intronic
904232097 1:29083415-29083437 ATTTACAAGCTTTTGGGGGTGGG + Intronic
905678048 1:39843763-39843785 GTTTATAATTCAGTGGGGGTGGG - Intronic
905767167 1:40610671-40610693 ATTTATAAGGTAATGGGGTTTGG + Intergenic
905826844 1:41032267-41032289 GTTTATATTCTAATGGGAGTAGG - Intronic
907281489 1:53349975-53349997 ATTTGTAAAGAAATGGGGGTGGG - Intergenic
908061021 1:60349102-60349124 AGTTATAATCTGATGAGGGATGG - Intergenic
908470452 1:64438871-64438893 ATTTTTAATATTTTGGGGGTTGG - Intergenic
909413348 1:75378808-75378830 ATTGATAAGCTACTGGCGGTTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909537652 1:76756148-76756170 CTTTATAATGTAATGGAGGGTGG + Intergenic
909732854 1:78916437-78916459 TTTTATATTCTTATGTGGGTTGG + Intronic
911471389 1:98323228-98323250 ATGTATAATCTAGTGGGGGAAGG + Intergenic
912756876 1:112331624-112331646 CTCTGCAATCTAATGGGGGTAGG - Intergenic
917063704 1:171068498-171068520 ATTTATAATTCATTGGGTGTAGG + Intergenic
917652356 1:177090578-177090600 ATTTATTATCAAATGGGTATTGG - Intronic
919437840 1:197585094-197585116 ATTTATAATCTATCGGAGGAAGG + Intronic
920019908 1:202947677-202947699 ACTTAGAATCTAATTGGGGGAGG - Intronic
922772377 1:228193026-228193048 ATTTTTAATCTACTTGGGGTTGG + Intergenic
923812983 1:237341541-237341563 ATTTACACTCTAATGGGGATAGG - Intronic
1063969893 10:11374283-11374305 ATTTATATTCAAGTGGGGGAAGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065582987 10:27190312-27190334 GTTTAACATTTAATGGGGGTGGG - Intergenic
1065781765 10:29175434-29175456 ATGTCTAACCTAATGGGTGTGGG - Intergenic
1068351280 10:55848673-55848695 ATATATAAGCTGATGGGGCTAGG - Intergenic
1068952938 10:62795489-62795511 ATTAATAATCTAATAGGGTTTGG - Intergenic
1069153859 10:65000394-65000416 ATTTATTCTCTAAGAGGGGTAGG + Intergenic
1069223979 10:65918388-65918410 ATTTATAATTTAGTGGGGAGAGG - Exonic
1069678895 10:70269769-70269791 ATTTAAAATGCAATGAGGGTTGG - Intronic
1069806353 10:71127379-71127401 ATTTTTATTCTAGTGGGGGAGGG + Intergenic
1070327491 10:75398280-75398302 ATTTATAATCTACAAGGGATGGG + Exonic
1071238768 10:83680567-83680589 ATTTACAATCTAGTGGGGTCTGG + Intergenic
1071591038 10:86873422-86873444 TTTTTTAATTTAATAGGGGTGGG - Intronic
1072301383 10:94065577-94065599 TTTCATAATTTTATGGGGGTAGG - Intronic
1072947935 10:99827182-99827204 ATTGATAAGCTACTGGCGGTTGG + Intronic
1074118000 10:110472068-110472090 ATTGTTGATCTAATGGGGTTTGG - Intergenic
1075010747 10:118867947-118867969 ATCTGTAATCCAATGTGGGTGGG + Intergenic
1076929814 10:133524121-133524143 ATTAATAAATTAATGGGGGAGGG - Intronic
1077772990 11:5241529-5241551 ATTTATAATGAAGTGGGGATGGG - Intergenic
1078139922 11:8684625-8684647 ATTTACACTCTAATAGGGGGTGG + Intronic
1079978308 11:27120927-27120949 GCTTATACTCTAATGGGGGAAGG + Intronic
1081147597 11:39582448-39582470 ATATCTAAACTAATGGGTGTGGG - Intergenic
1081292483 11:41343841-41343863 ATTTATTATCTAATTGGTTTTGG - Intronic
1081528153 11:43941308-43941330 AGTTACATTCTAATGGGAGTGGG - Intronic
1087723889 11:101696785-101696807 ATTGATAAGCTACTGGCGGTTGG - Intronic
1087945397 11:104154188-104154210 TTTTAGAATGTAATGGGGGATGG - Intronic
1087984246 11:104657868-104657890 TTTTATAAGCCAATTGGGGTGGG - Intergenic
1088612720 11:111593477-111593499 ATTCATGATCTAATAGAGGTGGG + Intergenic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1090523019 11:127499041-127499063 TTTTATAATCTAATTGGAGAAGG - Intergenic
1090625339 11:128603431-128603453 ATTTATAATATTAAGGGGGTGGG + Intergenic
1091270397 11:134307388-134307410 ACTTATACTCTGTTGGGGGTGGG - Intronic
1092759896 12:11800245-11800267 ATTTAAAATGTGATGGGGATGGG - Intronic
1093274622 12:17108913-17108935 ATATATAAACTAATATGGGTAGG + Intergenic
1093387592 12:18577517-18577539 AATTAAAATCTAATGGGAGAAGG + Intronic
1095577977 12:43760835-43760857 GTTTATATTCTAATGGAGGAAGG - Intronic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097482262 12:60143540-60143562 AATTATAATCTCATGGAAGTAGG - Intergenic
1098549718 12:71749892-71749914 AATTCTGATTTAATGGGGGTGGG + Intergenic
1098737294 12:74121505-74121527 ATTTATAATCTAATCTGTTTAGG + Intergenic
1099020855 12:77402453-77402475 ATTTATATTATATTGGGGGATGG - Intergenic
1099472278 12:83066086-83066108 ATGTACAATCTAATGTGGGGAGG + Intronic
1099699867 12:86069834-86069856 ATTTAGAATATATTGGGGGTGGG - Intronic
1100225977 12:92555878-92555900 ATTTATAAAATAAAGGGGGCAGG - Intergenic
1100424555 12:94471954-94471976 ATTTAAGATTTCATGGGGGTGGG - Intergenic
1100991263 12:100254141-100254163 ATTTCTTATCTTATTGGGGTGGG - Intronic
1101844287 12:108349923-108349945 ATTTATCATCTGATAGGGCTTGG - Intergenic
1104353957 12:128068742-128068764 ATTTCTAATGTGATGGTGGTAGG - Intergenic
1105736412 13:23276307-23276329 ATTTTTAATAAAATGGAGGTGGG + Intronic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1106297983 13:28435518-28435540 CTTTATAATCTGTTGGGGGAAGG - Intronic
1107751513 13:43572213-43572235 TCTTATAATCTAATGAGGGAAGG - Intronic
1109423324 13:62142167-62142189 ACTGATAATCTAATCCGGGTAGG + Intergenic
1109884987 13:68530316-68530338 ATTTATAATATAATTATGGTTGG - Intergenic
1110724780 13:78808356-78808378 ATTTATAATTTAATCTTGGTAGG + Intergenic
1111384282 13:87503431-87503453 ATGTATATTCTAATGGAGGTAGG + Intergenic
1111547081 13:89753075-89753097 AATTAAAATATAATGGGGCTTGG - Intergenic
1112711625 13:102135950-102135972 ATTTAAAATTTAACGGGGGCCGG - Intronic
1113219656 13:108085281-108085303 ATATATAAGCTGATGGGGCTGGG - Intergenic
1114854739 14:26424616-26424638 ATTTATAATTTTAAGGGGGCAGG + Intergenic
1116406850 14:44577252-44577274 ATTTTTTATTTAATGGGAGTTGG + Intergenic
1116759839 14:48998511-48998533 ACTTATATTCTATTGGGGATGGG + Intergenic
1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG + Intergenic
1117186836 14:53248060-53248082 ATTTATAATCTATTTGGGTGAGG + Intergenic
1118712607 14:68534745-68534767 ATTTACAATCTAGGGGGGGTGGG - Intronic
1120466375 14:84863127-84863149 ATTTTTTGTCTAATTGGGGTAGG + Intergenic
1121256081 14:92531421-92531443 CTTTAAAATCTGATGGGGGCAGG + Intronic
1125068652 15:35525076-35525098 GTTTATAACCTCATGAGGGTAGG - Intronic
1125166670 15:36714310-36714332 ATGTATAATCTTATGTTGGTCGG + Intronic
1125454567 15:39844272-39844294 ATTCATAATCTAAGGGGGTTTGG + Intronic
1125480782 15:40078460-40078482 AATTTTCAACTAATGGGGGTGGG + Intergenic
1126796250 15:52262421-52262443 ATTTTTAATCTATGGGGGTTTGG + Intronic
1128227947 15:66015545-66015567 AGTTATAGTATCATGGGGGTAGG + Intronic
1128283492 15:66416814-66416836 ACTTAAAATCTAATGGTGTTAGG + Intronic
1128318937 15:66679319-66679341 ATTTATAAGAAACTGGGGGTTGG + Intronic
1129232501 15:74204522-74204544 ATTTAAAATCAGATGGGAGTTGG - Intronic
1131796693 15:96024921-96024943 AATTATAATTCAATAGGGGTGGG - Intergenic
1132318264 15:100906218-100906240 ATTTACACTCTTATGGGAGTGGG - Intronic
1133013342 16:2927017-2927039 ATTGATAAGCTAATGGCGGTTGG - Intronic
1133497826 16:6336542-6336564 ATTTATAATCTAGAGAGGGCTGG + Intronic
1134287126 16:12871539-12871561 ATTTATAGTCCAATGGTGGAGGG - Intergenic
1140285143 16:73595873-73595895 AGTTATAATCTACTGGGATTTGG - Intergenic
1141275428 16:82583461-82583483 AATTATATTCAAAGGGGGGTGGG - Intergenic
1142598827 17:1043052-1043074 AGTTATGATTTAATGGGGATGGG + Intronic
1145837440 17:27965273-27965295 ATTTTTATCCTAATGGAGGTGGG - Intergenic
1148845705 17:50528681-50528703 ATTTTTGATCTAAGGGAGGTGGG - Exonic
1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG + Intergenic
1153458575 18:5306629-5306651 ATATAAAATATAATGGGGCTAGG - Intergenic
1156563448 18:38156377-38156399 GTTTATGATCTAATGAGGGTGGG - Intergenic
1157162354 18:45325520-45325542 ATTTCTAATCTAAGAGGGTTTGG + Intronic
1158834804 18:61319794-61319816 ATTTATTAGCTAATTGAGGTTGG - Intergenic
1164153843 19:22576652-22576674 ATTGATAAGCTACTGGCGGTTGG - Intergenic
1165929567 19:39347913-39347935 ATTTATATTCTGATGGGGGGAGG + Intronic
925654196 2:6127623-6127645 ATATATAGTCCAATGTGGGTTGG + Intergenic
926182647 2:10659328-10659350 ACTTCAAATCTAATGGGGGGGGG + Intronic
926265288 2:11311536-11311558 ATTTTTAATCTTTTGAGGGTTGG - Intronic
926593678 2:14766548-14766570 TGTTATAATATAATTGGGGTTGG + Intergenic
928225916 2:29447873-29447895 ATTTATTGCTTAATGGGGGTGGG + Intronic
928505841 2:31951824-31951846 TTTTAAAATCAAATGGGGCTGGG - Intronic
933113773 2:78439749-78439771 ATTTTTAATCTATTGGGGATAGG + Intergenic
933518759 2:83343635-83343657 ATGTATACTTTAGTGGGGGTTGG + Intergenic
935549049 2:104432256-104432278 TTTTATTATTTACTGGGGGTTGG - Intergenic
936495647 2:113018456-113018478 GTTTATAAGGTAATGGGGGAAGG + Intergenic
936696318 2:114953594-114953616 CTTTATAAGTTAATGGGAGTAGG - Intronic
937080661 2:119137424-119137446 ATCTATAAGCAAATGGGGGGAGG - Intergenic
939628486 2:144507952-144507974 ATTCATGATCTAATTGAGGTTGG - Intronic
940768497 2:157815931-157815953 GTTCATAATTTAAAGGGGGTAGG - Intronic
941064666 2:160888437-160888459 GTTTATATTCTAGTGGGGCTGGG + Intergenic
943173125 2:184430843-184430865 ATTTATAGTCTAGTGGGGAAAGG + Intergenic
945896103 2:215483322-215483344 ATTTATAATCTAGTTGGGAAAGG - Intergenic
946656402 2:221952755-221952777 ATGCATAATCTTGTGGGGGTGGG - Intergenic
946916226 2:224524961-224524983 AATAATAAGCTAATGGGGGTGGG + Intronic
947072900 2:226310818-226310840 ATTTATAATCTCATGGTTATAGG - Intergenic
1168928202 20:1599826-1599848 TTTTATAAGGTAATGGGGATGGG - Intronic
1169627520 20:7588850-7588872 GTTTATATTATAATGGGAGTGGG + Intergenic
1173114894 20:40231744-40231766 CTTTAAATTCTAATGGAGGTGGG + Intergenic
1173375863 20:42482559-42482581 GTATATATTCTAGTGGGGGTAGG + Intronic
1174671589 20:52313020-52313042 TTTTTTAATCTTCTGGGGGTGGG - Intergenic
1174937986 20:54893331-54893353 ATCTACATTCTAATGGGGGGAGG - Intergenic
1176947796 21:15004890-15004912 ATTTATAATGTGTTGGAGGTGGG - Intronic
1177248978 21:18568064-18568086 ATTGATAAGCTACTGGCGGTTGG + Intergenic
1178778804 21:35579485-35579507 ATTCAGAATCAAATGTGGGTGGG - Intronic
1179287290 21:39988676-39988698 ATTTACACTGTAATGGGGGGAGG + Intergenic
1182706906 22:32288486-32288508 ATGCAAAATCTAATGTGGGTTGG - Intergenic
1184617518 22:45648166-45648188 ATTTGTAATAGACTGGGGGTGGG + Intergenic
949434854 3:4018027-4018049 ATTTATAATCTTTTGGGTATGGG - Intronic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
951144176 3:19206587-19206609 ATTTGTCATCTTATGGGGGCTGG + Intronic
952957068 3:38563994-38564016 ATTTAGAATGAAATGGGGGTAGG - Intronic
954981901 3:54753550-54753572 ATTTATAATCCAGTGTGGGTTGG - Intronic
955663812 3:61329203-61329225 AATAATAATCTAGTGGGGGGAGG + Intergenic
956714416 3:72065764-72065786 GTTTATATTCTAGTGGTGGTGGG + Intergenic
957278544 3:78120130-78120152 ATTTATAATATTATGGGGAGTGG - Intergenic
957839143 3:85643865-85643887 ATTAAGAATATAATGAGGGTAGG - Intronic
958854612 3:99369638-99369660 ATACACAATCTAATGGGGGTAGG - Intergenic
958926648 3:100165088-100165110 AATTAGAATCTCTTGGGGGTGGG - Intronic
959070033 3:101693616-101693638 ATTGATAAGCTACTGGCGGTTGG - Intergenic
959422299 3:106143777-106143799 ACTTATAGTCTAGTGAGGGTTGG - Intergenic
960496170 3:118377729-118377751 ATTAATAATGTGATGTGGGTTGG + Intergenic
962083862 3:132169957-132169979 ATGCAGAATCTAATGGGGGTGGG + Intronic
963493003 3:146024663-146024685 ATTTATAATCTCATGAAGGATGG - Intergenic
963696045 3:148566833-148566855 ATTGATAAGCTACTGGCGGTTGG + Intergenic
964546816 3:157843411-157843433 ATTAATTATATAATGGGGCTAGG - Intergenic
965660615 3:171038154-171038176 ACTTATATTGTACTGGGGGTGGG - Intergenic
965939297 3:174158382-174158404 ATTTATAAACTTTTGGGGTTTGG - Intronic
966559298 3:181301673-181301695 ACTTACAAACTATTGGGGGTTGG + Intergenic
967123128 3:186401469-186401491 ATGTATAATCTAGTGAGGGGAGG + Intergenic
969154473 4:5198354-5198376 ATTTGTAATCTGATGGGGCATGG + Intronic
970280953 4:14454723-14454745 CTTTATAGTCTAGTGGGTGTGGG - Intergenic
971262290 4:25068303-25068325 GTTTATAATTTATTGGGGGGAGG + Intergenic
975172090 4:71244049-71244071 TTTAATAATCAATTGGGGGTTGG - Intronic
977113242 4:92987428-92987450 ATTTATAATGTTGTGGGGGTGGG + Intronic
978770678 4:112453173-112453195 GCTCATAATCTAATGGGGGGAGG - Intergenic
980868629 4:138584482-138584504 AGGTATAATCTAATTGGGTTAGG - Intergenic
982876743 4:160660341-160660363 ATTGATAAGCTACTGGCGGTTGG - Intergenic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
983895106 4:173072867-173072889 ATTAATAAGCTATTGTGGGTGGG + Intergenic
984031859 4:174613740-174613762 ATTTATAAACCAATGGAGGGTGG - Intergenic
986074562 5:4321936-4321958 ATTTATAATTTAATCTTGGTAGG - Intergenic
986119164 5:4814720-4814742 ATTTCTAATCTAATGCCAGTTGG + Intergenic
987218576 5:15765838-15765860 ATATAAGATCTATTGGGGGTGGG - Intronic
988140722 5:27235902-27235924 AGTTATATTTTAATGGGAGTTGG + Intergenic
989584509 5:43064146-43064168 ATTTAAAAGCTGATGGGGCTAGG - Intergenic
990086854 5:51989062-51989084 CTTTATAGATTAATGGGGGTAGG - Intergenic
990663717 5:58048424-58048446 ATTGAGAATCTAATTGGGCTGGG - Intergenic
991298697 5:65106666-65106688 ATTTATAGACTAGTGGGGATAGG - Intergenic
991449669 5:66738533-66738555 ACTTATGTTCTAATGGGGGAGGG + Intronic
991454028 5:66783241-66783263 CTTTATAATTTAATGTGTGTTGG + Intronic
992044813 5:72876256-72876278 ATGTATCATGTAATAGGGGTTGG + Intronic
992528512 5:77633608-77633630 AGTGAGAATCTAATGGAGGTTGG + Intronic
993870760 5:93251604-93251626 ATTTACACTCTGATGGGGATGGG - Intergenic
995633971 5:114163987-114164009 TTTCATTATTTAATGGGGGTGGG + Intergenic
995992347 5:118256030-118256052 ATTTATAAAGTAATAGGGATAGG + Intergenic
998834757 5:146192731-146192753 ATTTATATTCTAGATGGGGTGGG + Intergenic
999661873 5:153873122-153873144 ATTTCTAATATAAAGGTGGTAGG + Intergenic
999692801 5:154163268-154163290 GTTTATAGTCTAATGAGGGGAGG + Intronic
1001153114 5:169249282-169249304 ATTAATAGTCTACTGGGGGATGG + Intronic
1002974388 6:2059793-2059815 ATTTATTATATATTTGGGGTTGG - Intronic
1004453475 6:15769481-15769503 ATTTATACTCTAATGCAAGTGGG - Intergenic
1005197724 6:23308920-23308942 ATTCATAATCCAATGGGGATTGG - Intergenic
1005367510 6:25094043-25094065 ACTTATATTCTAATTGGGGTGGG - Intergenic
1005871286 6:29975843-29975865 GTTCATTGTCTAATGGGGGTTGG - Intergenic
1006200729 6:32287484-32287506 ATTTTTACGCTGATGGGGGTTGG + Intergenic
1006972003 6:38055285-38055307 ATTTATAGTCAGATGGGGTTTGG + Intronic
1010158478 6:72823138-72823160 ATTTACAATTAAGTGGGGGTTGG - Intronic
1011648964 6:89488239-89488261 GTTTATAATCAAATGCAGGTGGG - Intronic
1012046752 6:94285751-94285773 TTGTGTAATGTAATGGGGGTTGG - Intergenic
1013647445 6:112159635-112159657 GTTTACAATCAGATGGGGGTGGG - Intronic
1014488097 6:122025876-122025898 ATACATATTATAATGGGGGTAGG - Intergenic
1014719795 6:124902520-124902542 ATTTATAATCATTTGGGGGTTGG - Intergenic
1015393390 6:132709259-132709281 ATTTATATTCTAGTGTGGGGAGG - Intronic
1015491516 6:133831951-133831973 ATTTAAAGTCTAAAGCGGGTGGG - Intergenic
1017267116 6:152460290-152460312 ATTTATAATTTAAAGGTTGTGGG - Intronic
1017354101 6:153481920-153481942 ATTTATTATGTAAAGGGGGAAGG - Intergenic
1017410067 6:154158560-154158582 ATTTAAGAGCTCATGGGGGTTGG + Exonic
1019970958 7:4540334-4540356 ATCTATAAACTGATGGGGTTTGG + Intergenic
1020606449 7:10343940-10343962 ATTAATAATCTACTGGTGTTGGG - Intergenic
1020848691 7:13321062-13321084 ATATATATTCTTATGGGGCTAGG + Intergenic
1021488891 7:21197006-21197028 ATTTAAAATAGAATGGGGCTAGG - Intergenic
1022057597 7:26755597-26755619 ACTTATATTCTAATGGAGGTGGG - Intronic
1022060968 7:26794669-26794691 TTTTACAATCTAATGGTGGTGGG - Intronic
1025043877 7:55674027-55674049 ATTTTCAATCTAATGGGAGGTGG - Intergenic
1025136805 7:56422553-56422575 ATTTTCAATCTAATGGGAGGTGG - Intergenic
1026205231 7:68251594-68251616 ATTAATAAGCTCATGGGGCTGGG - Intergenic
1026742549 7:72988226-72988248 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1026802401 7:73408622-73408644 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1027101186 7:75376852-75376874 ATTTTTCAACGAATGGGGGTGGG + Intergenic
1027562454 7:79748983-79749005 ATGTATAAACAAATAGGGGTTGG - Intergenic
1029137204 7:98381899-98381921 ATTTTTACCCTAATGTGGGTGGG - Intronic
1029877776 7:103771934-103771956 AAAGAAAATCTAATGGGGGTTGG - Intronic
1030571638 7:111233020-111233042 GTTTATAGTCTAGTAGGGGTAGG - Intronic
1030773421 7:113503313-113503335 ATTTATAATCTAATTCAGTTTGG + Intergenic
1030945017 7:115707678-115707700 ATTTATTATCTTATGGGGGAAGG - Intergenic
1031069989 7:117151636-117151658 ATTTATTTTGTAATGGAGGTGGG - Intronic
1031569487 7:123341358-123341380 TTTTATATTCTCTTGGGGGTAGG + Intergenic
1033382264 7:140833390-140833412 ATTTAAGATCTACTGGGGATGGG + Intronic
1035908495 8:3539410-3539432 ATGTATAATCTAATGGGTGAAGG - Intronic
1037280511 8:17236725-17236747 GTTTATATTCTCATGGGGGTGGG - Intronic
1037603211 8:20416328-20416350 ATTTATAATATGTTTGGGGTGGG - Intergenic
1039076041 8:33691191-33691213 ATTTATAATATATTAGGGGAAGG + Intergenic
1041465194 8:58151378-58151400 AAATATAATCTAATGGGGAAAGG - Intronic
1041756729 8:61322041-61322063 ATTTATATTCTAGTGGAGCTAGG - Intronic
1042903545 8:73750529-73750551 ATTTTTAATTAAATGGAGGTGGG - Intronic
1042942994 8:74126268-74126290 ACTTCTAAACCAATGGGGGTAGG - Intergenic
1043063681 8:75538954-75538976 ATTTATAATGTAAATGGGGCTGG + Intronic
1043350314 8:79352763-79352785 ATTAATATTCCAATGGGGGAGGG + Intergenic
1044195105 8:89366955-89366977 CTTTATAATCTCATGGGGCATGG - Intergenic
1045633910 8:104160201-104160223 ATTTATAGTCTGATGGGATTTGG - Intronic
1045906086 8:107346756-107346778 TTTTTTGATCTAATGAGGGTTGG - Intronic
1046482398 8:114839395-114839417 AATTATATTCTATTGGGGATGGG - Intergenic
1046545020 8:115638926-115638948 GTTTATAGTCTAATGGGGGAAGG - Intronic
1047316961 8:123743578-123743600 ATTTATTAACTAATGGGGCGAGG - Intergenic
1050939816 9:11444293-11444315 ATTTATAATCTCATGGACTTTGG + Intergenic
1051376858 9:16410707-16410729 ATTTATTTTTTAAGGGGGGTTGG + Exonic
1053021878 9:34700929-34700951 TTAGATAATCCAATGGGGGTGGG + Intergenic
1053524860 9:38818082-38818104 ACTTATAAGCTAATATGGGTAGG - Intergenic
1054197094 9:62042498-62042520 ACTTATAAGCTAATATGGGTAGG - Intergenic
1054641314 9:67546196-67546218 ACTTATAAGCTAATATGGGTAGG + Intergenic
1054830120 9:69615581-69615603 ATTTAAAATCTATTGAGGCTAGG - Intronic
1055034833 9:71807257-71807279 AATTATAATCAAATGGCTGTTGG + Intronic
1057362819 9:94390526-94390548 ATTTTTAATCTTATTGGGGGAGG + Intronic
1057660519 9:96997567-96997589 ATTTTTAATCTTATTGGGGGAGG - Intronic
1188415780 X:29932245-29932267 CTTTATAATCTAAAGGGGAAAGG + Intronic
1189131658 X:38504651-38504673 ATTTACAGTATAAAGGGGGTAGG + Intronic
1190096404 X:47484285-47484307 CTTTATAATCTTTTGGGGGAAGG - Exonic
1192989415 X:76432605-76432627 ATTGAAAAACTAAAGGGGGTGGG + Intergenic
1194631200 X:96286487-96286509 ATTTATAATGTAATTAGGGAAGG - Intergenic
1194835674 X:98679532-98679554 ATTTATAATATAATGTTGGGGGG + Intergenic
1194912102 X:99658184-99658206 ATATATCATATTATGGGGGTAGG + Intergenic
1195047139 X:101064342-101064364 ATTGATAATGCAATGGGGATGGG - Intergenic
1197563932 X:128057698-128057720 ATTAATAATCTAGTGTTGGTTGG - Intergenic
1198646622 X:138814334-138814356 ATCTATAATTTAAAGGGTGTTGG + Intronic
1201673568 Y:16553363-16553385 ATTAATAATCTATTGTGTGTTGG + Intergenic