ID: 1106214266

View in Genome Browser
Species Human (GRCh38)
Location 13:27680443-27680465
Sequence AAATGAGACCAGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 448}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106214260_1106214266 7 Left 1106214260 13:27680413-27680435 CCATCCCTACAACCAGCAGAAGA 0: 1
1: 0
2: 1
3: 23
4: 331
Right 1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG 0: 1
1: 1
2: 2
3: 51
4: 448
1106214262_1106214266 2 Left 1106214262 13:27680418-27680440 CCTACAACCAGCAGAAGAAAGCT 0: 1
1: 0
2: 2
3: 41
4: 636
Right 1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG 0: 1
1: 1
2: 2
3: 51
4: 448
1106214263_1106214266 -5 Left 1106214263 13:27680425-27680447 CCAGCAGAAGAAAGCTGTAAATG 0: 1
1: 0
2: 3
3: 21
4: 283
Right 1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG 0: 1
1: 1
2: 2
3: 51
4: 448
1106214261_1106214266 3 Left 1106214261 13:27680417-27680439 CCCTACAACCAGCAGAAGAAAGC 0: 1
1: 0
2: 2
3: 32
4: 316
Right 1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG 0: 1
1: 1
2: 2
3: 51
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106214266 Original CRISPR AAATGAGACCAGAGGGATGA AGG Intergenic
901677170 1:10892309-10892331 AAGTGAGATCAGAGAGATAATGG - Intergenic
902124746 1:14199384-14199406 AACTGAGACCTGAGGAGTGATGG - Intergenic
902419963 1:16271165-16271187 CAATGAGGTCAGAGAGATGAGGG + Intronic
903596515 1:24499662-24499684 AAATGAGACCCGAGGGTTGGAGG - Intergenic
903733418 1:25514750-25514772 AAATGAGACGAGGAGGATGAGGG - Intergenic
905244222 1:36601694-36601716 GATTGAGAACATAGGGATGAGGG + Intergenic
905266165 1:36755666-36755688 CAAGGAGACAAAAGGGATGAGGG - Intergenic
905268266 1:36769935-36769957 AAATGAAGCCAGAGAGGTGATGG - Intergenic
906096389 1:43227090-43227112 GAATGAGATCAGGGTGATGAAGG + Intronic
906836244 1:49086020-49086042 AAATGAGACCACGGGGCTGGAGG - Intronic
907833827 1:58090618-58090640 AAATAAGGCCTAAGGGATGAAGG - Intronic
909160504 1:72142611-72142633 AAATGAGACAAGATATATGAGGG - Intronic
909433253 1:75614659-75614681 AGATGAGAACTGAGGGGTGAAGG - Intergenic
909819339 1:80041150-80041172 AAATGAGAAGAGAGGAAGGATGG - Intergenic
910530046 1:88225524-88225546 AAATGGTACTAGAGGGATAAAGG - Intergenic
910633215 1:89378675-89378697 AAATGAAACCCCAGAGATGATGG - Intronic
911317644 1:96374867-96374889 AAAAGAGATCAGAAGCATGAGGG - Intergenic
911347638 1:96716429-96716451 ATATGAGACCAGAAGGCTCAAGG - Intergenic
911377588 1:97069857-97069879 AAAGAAGAACAGAGAGATGAAGG + Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915580836 1:156812351-156812373 AGATGAGATCAGAGGGGTGAGGG - Intronic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
915928334 1:160041355-160041377 AAAAGAGACCAGAGGAATGGGGG + Exonic
916836493 1:168551094-168551116 AAATGAAGTCAGAGAGATGACGG - Intergenic
919664307 1:200277656-200277678 AAAGGAGATCACAGGAATGAGGG + Intergenic
919968701 1:202556201-202556223 AAATGAAAGCAGAGGAATGGTGG + Intronic
920086909 1:203424046-203424068 AACTGAGCACAGAGGGAGGAAGG + Intergenic
920775352 1:208931332-208931354 TAATGAGCACAGAGGGATTAAGG + Intergenic
922160972 1:223078987-223079009 AGAAGAGGCCAGAGGGAGGAGGG + Intergenic
922167284 1:223126882-223126904 TAATGAGGCCAGAGGGAGAAGGG + Intronic
922556145 1:226533796-226533818 AAGTCAGAAGAGAGGGATGAAGG - Intergenic
1063450606 10:6147711-6147733 CCATGAGATCAGAGGGAGGAAGG - Intronic
1064622162 10:17228175-17228197 AGAGGAGACCAGAGGGACGGGGG + Intergenic
1064689166 10:17896107-17896129 AGATTAGACAAGAGGGTTGAAGG + Intronic
1065038729 10:21668291-21668313 AAAGGAGACCAGAAGGAGGTGGG - Intronic
1065595094 10:27302778-27302800 AAATTCTACCAGAGGTATGAGGG + Intergenic
1065806505 10:29398115-29398137 AATTGCAACAAGAGGGATGAGGG + Intergenic
1066450463 10:35523508-35523530 AAGTGAGACCACCAGGATGAGGG - Intronic
1068798198 10:61107814-61107836 AAAGGAGACAAGAGGGAAAAGGG + Intergenic
1068918238 10:62456430-62456452 AAATGAGAAGAGAGGGGTGGGGG - Intronic
1069231850 10:66020382-66020404 AACAGAGACCAGAGGGGTGATGG + Intronic
1069634055 10:69914584-69914606 AAAGTAGAAGAGAGGGATGACGG + Intronic
1069914752 10:71780588-71780610 AAATGAGACCAGAGAGGTAATGG + Intronic
1070168468 10:73914970-73914992 AAATGAGCCCAGCGTGATCAAGG + Intronic
1070652561 10:78248350-78248372 AACTGAGGCCAGAGGGTTTATGG + Intergenic
1070666475 10:78348638-78348660 AGAAGAGCCCAGAGGGCTGAAGG - Intergenic
1070732707 10:78842336-78842358 ACATGAGACCACAGGGATGAGGG + Intergenic
1070799562 10:79237218-79237240 AAATGAGGTCAGAGAGATGACGG + Intronic
1070860814 10:79659488-79659510 AAACTAGAACAGAGGCATGAGGG - Intergenic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1072429724 10:95360139-95360161 AAATGCAACCAAAGGGAAGAGGG - Intronic
1074840295 10:117344725-117344747 AAATGAGAGCTGTGGGATGAGGG - Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076177856 10:128382458-128382480 AAAGGAGTCAAGAGAGATGAAGG - Intergenic
1076330662 10:129662746-129662768 AAATGAAACCATAGGGAAGCAGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1077999610 11:7483162-7483184 AATGGAGCCAAGAGGGATGAAGG + Intergenic
1078361306 11:10669951-10669973 AAAAGAGAGCAGAGGAAAGAGGG + Intronic
1078396698 11:10987762-10987784 AAATGAGGCCAGAGGGATGAAGG - Intergenic
1078793395 11:14568039-14568061 AAATGTGACCAGAGGCTTGCAGG + Intronic
1079031781 11:16991643-16991665 AAATGAGGCCAGAGAGGTAATGG + Intronic
1079083887 11:17431834-17431856 AAATGTTACCAGTGGGATTATGG + Intronic
1079279626 11:19075648-19075670 AAATGAGAACAGAGGCAGAATGG - Intergenic
1079473101 11:20799015-20799037 AAAATAAAACAGAGGGATGAGGG + Intronic
1079517423 11:21285508-21285530 AAATAAGACCATAGGAAAGATGG - Intronic
1080108746 11:28541498-28541520 AGATGAGACTAGAGGGGTGGTGG + Intergenic
1080208725 11:29760173-29760195 AACTGAGAGAAGAGAGATGAGGG + Intergenic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1082183092 11:49144226-49144248 AGCTGAGACCTGAAGGATGAGGG + Intergenic
1084417717 11:69043057-69043079 AACTGAGCCCAGAGGCAAGAAGG - Intergenic
1084650821 11:70488248-70488270 AAATGAGAGCAAAGGGTTGCAGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085020323 11:73202590-73202612 ACATGAGACCAGAGGAACAAGGG + Intergenic
1086190784 11:84076228-84076250 AAAGGAGGCCATAGGCATGAGGG + Intronic
1087313756 11:96581526-96581548 AAAGGATAGCAGAGGGATGAGGG - Intergenic
1087505001 11:99009548-99009570 AAAGGTGACAAGATGGATGATGG + Intergenic
1088297260 11:108313315-108313337 AAAAGAGAACATAGGGAAGAGGG - Intronic
1088469050 11:110174966-110174988 ACATGAAAGCAGAGTGATGAAGG - Intronic
1090941217 11:131389900-131389922 AAAGGAGACCAGAAGGGTGAGGG + Intronic
1091222599 11:133937966-133937988 AAAGGAGACCACAAAGATGAAGG + Intronic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1096770511 12:53933374-53933396 AAATTAGACAAGAGAGCTGAGGG - Intergenic
1096918012 12:55054258-55054280 AAATGAGAACAGAAGAATGCAGG + Intergenic
1097826249 12:64177372-64177394 AGATGAGGCCTGAGGGATGCAGG + Intergenic
1099177777 12:79441613-79441635 AAAAGAGAACAGAGGGTTGGGGG - Intronic
1099197407 12:79633935-79633957 AAATAAGACAAGAGGTAAGACGG + Intronic
1099279716 12:80628814-80628836 AAAGTAGAACAGAGGGAAGAAGG + Intronic
1099528938 12:83751529-83751551 ATATTAGACCAGAGAAATGAAGG - Intergenic
1101158010 12:101945946-101945968 AAAAGAGGGCAGAGGAATGAGGG - Intronic
1101727215 12:107398059-107398081 AAAACAGAGCAGAGGAATGAAGG - Intronic
1101822906 12:108197570-108197592 CAATGAGACAAGGGTGATGAAGG + Intronic
1101958351 12:109229995-109230017 AACTAAAACCAGAGGGGTGAGGG - Intronic
1102924860 12:116819041-116819063 AAACGGGATCAGAGGGATAAAGG - Intronic
1103217414 12:119212679-119212701 AAAGGAGACCAGTGGGAGGTGGG + Intronic
1103874864 12:124119263-124119285 AACTGAGGCCAGAGAGAGGACGG + Intronic
1104379319 12:128293165-128293187 AAATGAGACCAGAGGGAGTTTGG - Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105841812 13:24260204-24260226 AAATGAGGCTTTAGGGATGAAGG + Intronic
1106041700 13:26099804-26099826 AAATGACACCAGGGAGGTGATGG + Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106477243 13:30109133-30109155 AGATGAAACCTGAGGGAGGAAGG - Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1109100145 13:58173472-58173494 AAATCAGATCAGAGGGGTTATGG + Intergenic
1109226228 13:59699409-59699431 AAATGAGGTCAGAGAGATGATGG + Intronic
1110561018 13:76910781-76910803 AACAGAGACCAGATGGATGATGG + Intergenic
1111271180 13:85888236-85888258 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1112711919 13:102139070-102139092 AAAAAAGACCACAGGGATGTTGG - Intronic
1112718174 13:102211043-102211065 AAATGAGAATAAAGGGAGGAGGG - Intronic
1113101482 13:106724447-106724469 AAATGAAACTAGTGAGATGATGG + Intergenic
1115700994 14:35952855-35952877 AAAGGAGACCACAGGGAGGAGGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116255788 14:42553278-42553300 AAATGAGACTAGAGGCAGAAAGG - Intergenic
1117583826 14:57179752-57179774 AAGAGAGACCTGAGGGATCATGG + Intergenic
1117678974 14:58184035-58184057 AACTGAGTCCTGAAGGATGAAGG + Intronic
1118002289 14:61534713-61534735 AAACGGGCCCAGAGAGATGAAGG + Intronic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1119852194 14:77874142-77874164 AAATGGGACAAGAGGGTTGGAGG + Intronic
1119918672 14:78426181-78426203 AAATGAGAGCAGAGGCTGGAGGG + Intronic
1120294818 14:82626427-82626449 AAATAAGACAAAAGGGAGGAGGG + Intergenic
1121296730 14:92832445-92832467 AGATAAGACCAGATGGAAGATGG + Intronic
1121786598 14:96666184-96666206 AAAGGAGAGCAAAGGGAAGACGG - Intergenic
1124089164 15:26581575-26581597 GAATGAGAAAGGAGGGATGAAGG - Intronic
1124702784 15:31931271-31931293 GAATGAGATCAAAGGGAGGAAGG + Intergenic
1124877107 15:33605358-33605380 AGAGGAGACAGGAGGGATGAGGG - Intronic
1125145183 15:36458970-36458992 AAATACCACCAGAAGGATGAGGG - Intergenic
1125382459 15:39101907-39101929 AAATGGGACCAGTGGTATGAAGG + Intergenic
1125431593 15:39600447-39600469 ACATGAGACAAGTGGGAAGAAGG + Exonic
1127320604 15:57841470-57841492 AAATTAGGCCAGAGGGAAGGAGG - Intergenic
1127582777 15:60352803-60352825 AAATGTGCCCAAAGGGAGGAGGG - Intronic
1127863856 15:63015686-63015708 AAACAAGTCCACAGGGATGAAGG + Intergenic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128109215 15:65066145-65066167 AAAGAAGAAGAGAGGGATGAAGG + Intronic
1128185198 15:65638790-65638812 AGTTCAGATCAGAGGGATGAGGG + Intronic
1128498297 15:68210592-68210614 AACTGAGGCCAGAGGGAGGAGGG - Intronic
1128836720 15:70814755-70814777 AAAAGAGCTCAGAGGGATGGAGG + Intergenic
1129119935 15:73390038-73390060 AAAGGAGACCAGAAAGATGAGGG - Intergenic
1129394860 15:75238192-75238214 GCATGTGACCAGAGGGATGGGGG - Intergenic
1129940640 15:79494158-79494180 CAATGAGACCAGAGGCATGGAGG + Intergenic
1130125361 15:81089434-81089456 AGATGAGATGAGAGGGTTGAGGG + Intronic
1130143382 15:81252126-81252148 AATTGATTCCAGAAGGATGAAGG + Intronic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1131055298 15:89371323-89371345 AAATGGGACCAGAGCGCGGAGGG + Intergenic
1131954080 15:97712670-97712692 GAATGAGACCACATGAATGACGG - Intergenic
1131962880 15:97807880-97807902 AACTGAGGCCGGAGGGGTGAAGG - Intergenic
1133304521 16:4801145-4801167 AACTGAGGCCAGAGAGATCAAGG + Intronic
1133518532 16:6533341-6533363 AAAATAGACAAAAGGGATGAAGG + Intronic
1133589541 16:7229517-7229539 AAAGGAGAGGAGAGGGAGGAAGG + Intronic
1134016946 16:10895434-10895456 GGAAGAGACCAGAGGGAGGAGGG - Intronic
1134219591 16:12343486-12343508 AAATGGGAGCAGATGAATGATGG + Intronic
1134516314 16:14889939-14889961 AAATGACTCCACAGGGATGCAGG + Intronic
1134624256 16:15712743-15712765 GAATTAGGCCAGAGGCATGATGG + Intronic
1134703988 16:16288591-16288613 AAATGACTCCACAGGGATGCAGG + Intronic
1134884582 16:17778265-17778287 ATATGAGAAAAGAAGGATGAGGG + Intergenic
1134963555 16:18423523-18423545 AAATGACTCCACAGGGATGCAGG - Intronic
1134967850 16:18506122-18506144 AAATGACTCCACAGGGATGCAGG - Intronic
1135120384 16:19761319-19761341 GCAGGAGACCAGAGAGATGAAGG - Intronic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135300685 16:21324258-21324280 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1136176554 16:28521131-28521153 AAATGAGAACAGAGTGACGGGGG - Intergenic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1137756065 16:50903365-50903387 AAAATAGAGCAGAGAGATGAAGG - Intergenic
1137829538 16:51530512-51530534 AAGGGAGACAAGAGGGATGTAGG + Intergenic
1137933336 16:52609364-52609386 AAATGAGTCCAGTGGAAGGAAGG + Intergenic
1138113511 16:54342564-54342586 GAATGTGACCAGATGGCTGAGGG - Intergenic
1138199358 16:55077614-55077636 AAATGGGACAAGGAGGATGAAGG + Intergenic
1138643286 16:58403594-58403616 AAATGAGAAAAGGGTGATGATGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139152639 16:64402005-64402027 AACTGAGATCAGAGGGGTTACGG + Intergenic
1140888345 16:79263903-79263925 TCAGGAGACCAGAGGGATTAAGG - Intergenic
1141195431 16:81857191-81857213 AAACCAGAAGAGAGGGATGACGG - Intronic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1143226155 17:5305602-5305624 AAATAAGAACAGAGGGATTTTGG + Intronic
1143537992 17:7552870-7552892 AAATGAGAACAGAGAAATGATGG + Intronic
1144055908 17:11540320-11540342 AAAAGAGAGCAGAGAGATGGAGG + Intronic
1144336521 17:14275953-14275975 TAATGAGAACAGAGAGATAAAGG - Intergenic
1145786226 17:27595630-27595652 AAATGAGAAAAGGGGGGTGAAGG - Intronic
1146646929 17:34581960-34581982 AAATCAGACCAGAGGGAAGGAGG + Intronic
1146793738 17:35766964-35766986 AAAGGAGAGCAGAGGTATGGGGG - Intronic
1150125574 17:62632523-62632545 ACAAGAGACCAGAGGCATGGGGG - Intronic
1150559600 17:66283087-66283109 AGATGACACCAGTGGGCTGAGGG + Intergenic
1152395356 17:80029687-80029709 AAAGGAGACAAGAGGGGAGACGG - Intronic
1153877152 18:9384177-9384199 AAATGGGAACTGAGGGGTGATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156674779 18:39514424-39514446 AAAAAAGACAAGAGGGAGGAAGG + Intergenic
1157005324 18:43576342-43576364 ACATGATACCAGAGGGAAAAAGG - Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157433051 18:47645635-47645657 AGATGAGCCCAGAGGGATAGAGG - Intergenic
1158725254 18:59965532-59965554 GGATGAGAAGAGAGGGATGAAGG - Intergenic
1159580115 18:70225788-70225810 AAATAAGACCACAGAGTTGAGGG + Intergenic
1161457870 19:4378782-4378804 AACTGAGTCCCGAGGAATGATGG + Intronic
1162084427 19:8239977-8239999 AACTGGGACAAGAGGGTTGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165335345 19:35165977-35165999 AAATGAGATTAGAGGAATAATGG + Intronic
1165408466 19:35644221-35644243 GAATGGGACCTGCGGGATGAAGG - Exonic
1165460520 19:35941458-35941480 AAATCAGACCAGAGGTTAGAAGG + Intronic
1165703641 19:37958340-37958362 ACCTGAGCCCAGAGGGATCAAGG + Intronic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166299450 19:41905826-41905848 TGGTGAGACCAGAGGGATGCTGG + Exonic
1167277765 19:48549235-48549257 GGACGAGACCAGAAGGATGAAGG - Intergenic
1167459244 19:49615614-49615636 AACAGAGACCAGAGAGAGGAGGG + Intronic
1168685034 19:58344004-58344026 AAATGATACCAGAGGGAAAGCGG + Intergenic
925179498 2:1807776-1807798 AAATGGGACCAGAGGGTGGCAGG - Intronic
925305769 2:2847117-2847139 AAATGAGGCCAGAGGGCACAGGG - Intergenic
926503876 2:13686714-13686736 AAATTAGACAAGAAAGATGAAGG + Intergenic
928207370 2:29295739-29295761 AAATGAGGACAGAGGGCTCAAGG - Intronic
928270646 2:29851807-29851829 AAAAGAGACCACAGGTGTGAAGG - Intronic
928436183 2:31255987-31256009 ATCTGAGACCAGAGGTGTGAGGG - Intronic
928868020 2:35941639-35941661 AAATGAAAACAGAGGGGTTATGG + Intergenic
928997754 2:37312817-37312839 AAATGTGACCAGAGGCTTGCAGG + Intronic
929053620 2:37857772-37857794 AAAGGAGAACAGGGGGATGGCGG + Intergenic
929554917 2:42920213-42920235 AAATGAAACCTTAGGGGTGATGG + Intergenic
930237999 2:48906108-48906130 ATATGTGGTCAGAGGGATGATGG + Intergenic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930579628 2:53194774-53194796 AAATGAGGTCATAAGGATGAGGG + Intergenic
932081873 2:68722984-68723006 AAAAGAGAGCAGAGAGGTGATGG - Intronic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
933226213 2:79752169-79752191 AGAGGAGAACAGAGGGATGAAGG + Intronic
933812732 2:86043235-86043257 ACATGAGATCAAAGAGATGAGGG + Intronic
933859605 2:86452425-86452447 AAATGTGACCAGAGGCTTGAAGG + Intronic
934702621 2:96454248-96454270 AAATGTGACCAGAGGCTTGCAGG - Intergenic
935680449 2:105631638-105631660 AAATGTGACCAGAAGCTTGAAGG + Intergenic
936090290 2:109497736-109497758 TAATGAGCCCAGATGGATGTGGG - Intronic
936243672 2:110808587-110808609 AAATGAGGCCAGAGGGACAGAGG - Intronic
936492248 2:112982346-112982368 GAATGAGTCCAGAGAGATAAAGG + Intronic
937271130 2:120653766-120653788 AAATGAGACCATGGAGGTGAAGG + Intergenic
938721379 2:134070088-134070110 AAATGAGACCATAAGGGTGGGGG + Intergenic
938837011 2:135114581-135114603 AAATGTGACCAGAGGCTCGAAGG - Intronic
940672052 2:156682570-156682592 AATTGAGACCAGAGTGATGCAGG + Intergenic
941275276 2:163483170-163483192 AAGTGAGAGCAAAGTGATGAAGG + Intergenic
941450691 2:165656809-165656831 AAATAAGATCCGAGGTATGAGGG + Intronic
941885814 2:170525980-170526002 ACATGAAACCAGAGGGAAAATGG + Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
941980529 2:171451172-171451194 AAAGTAGACAAGAGAGATGAGGG - Intronic
942511327 2:176705453-176705475 GAATGAGACCAGAGAGATGGTGG + Intergenic
943040922 2:182803952-182803974 AAATGTGACCAGAGGCTTGCAGG - Intergenic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
944357225 2:198805534-198805556 AAATGAGAAAAGAGGAATGAAGG - Intergenic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
945372860 2:209041868-209041890 AAATGTGACCAGAGGTTTGAAGG + Intergenic
945654564 2:212607415-212607437 AAATTAGGCCAGAGAGATAATGG - Intergenic
946128517 2:217585940-217585962 AAATGAGAACTGGGGGAAGATGG + Intronic
946464859 2:219902837-219902859 AAATCAGACCAGATGGAGGAAGG - Intergenic
947202162 2:227623551-227623573 AAATGAGACCAGACAGGTAAAGG + Intronic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948872341 2:240809295-240809317 AAAAAAGACCAGAGGGCAGAGGG + Intronic
949061272 2:241959182-241959204 AAATAGGACCAGAAGGAAGATGG + Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169021499 20:2334462-2334484 AGACCAGACCAGAGGAATGAAGG + Intronic
1169796588 20:9469450-9469472 AAATGAGACAAATGGGATGGGGG - Intronic
1170479008 20:16746551-16746573 AAAGGTTACCAGAGGGATCATGG - Intergenic
1170582408 20:17709376-17709398 ATGTGAGAGCAGAGGAATGAAGG + Intronic
1170733242 20:18991817-18991839 AAATGAGGTCAGAGAGAGGATGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1172195897 20:33091217-33091239 AAATGTGGCCAGAGGTATGCTGG + Intronic
1172880735 20:38198423-38198445 AAACAGGATCAGAGGGATGAGGG - Intergenic
1173178924 20:40786923-40786945 AAATGACACCAGAGAGATATTGG + Intergenic
1173662929 20:44746344-44746366 AAAGGAGACCAGGGAGACGAGGG - Intronic
1174122957 20:48280776-48280798 AAGTGAGACCAGAGGGCTAGGGG - Intergenic
1174201195 20:48807879-48807901 AAATGAGGCTAGAGGGGTGTGGG + Intronic
1174292374 20:49518123-49518145 AAGGGAGACCTGAGGGATGGGGG + Intronic
1174294353 20:49534368-49534390 AATTGGGACCAGAGGCATGTGGG - Intronic
1174313944 20:49682397-49682419 AGATGAGGTCAGAGGGATAAGGG - Intronic
1174421255 20:50400481-50400503 AAGTGAGTTCAGAGGGGTGAAGG + Intergenic
1174532469 20:51225011-51225033 AAATGAGACCAGGGAGATTTAGG - Intergenic
1174904306 20:54534268-54534290 ACCTGAGCCCAGAGGGATCAAGG - Intronic
1174911309 20:54610881-54610903 AAATGAAAGAAGAGGGCTGAGGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175343505 20:58251280-58251302 AACAGAGACCAGAGGGGTGATGG + Intergenic
1175837840 20:62007697-62007719 ATACGAGACCAGAGTGATGCGGG - Intronic
1176012412 20:62906031-62906053 AAAAGAGACCACAGTGAAGAAGG - Exonic
1176728594 21:10466056-10466078 AAGTGGGACCTGAGGGCTGAAGG + Intergenic
1178350164 21:31867157-31867179 AAGTGAGATCAGAGACATGATGG + Intergenic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1182311309 22:29409858-29409880 AACTGAGGCCAGTTGGATGATGG + Intronic
1182542039 22:31048859-31048881 AAATGAGAAGAAAGGGGTGATGG + Intergenic
1183100101 22:35578645-35578667 AACTGAAGCCAGAGGGATGATGG + Intergenic
1183719308 22:39553078-39553100 GAATGAGACCCTAGGGAGGATGG - Intergenic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
949797992 3:7871941-7871963 ATATGAGAACAGAGGGGTGGTGG - Intergenic
949851907 3:8428503-8428525 CAATAAGACCTGAGGGGTGAGGG - Intergenic
950629830 3:14275032-14275054 AAAAGAGACCAGGGGCAGGAGGG - Intergenic
951844932 3:27075386-27075408 AAATGAGTCCGGAGGATTGATGG + Intergenic
953324442 3:42001100-42001122 AAATGAAGTCAGTGGGATGAGGG + Intergenic
954472434 3:50708970-50708992 AAAACAGAACAGAGAGATGATGG - Intronic
954526318 3:51274856-51274878 AAATGAGAACAAAGGAAAGATGG + Intronic
954780086 3:53052279-53052301 AACTGAGCCCAGAGTGGTGAAGG - Intronic
954827523 3:53387236-53387258 AGATGAGATCAGAGGGCTGGAGG - Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955092742 3:55768602-55768624 AACTGAGCCCTGAGGGATGGAGG + Intronic
955407729 3:58636019-58636041 AAAGGAGAAAAGAAGGATGATGG - Intronic
955535071 3:59914830-59914852 AAATGAGAGTATAGGGATTAAGG - Intronic
955762107 3:62297694-62297716 AACTTAGACCAGAGGGTTGGTGG - Intergenic
955793663 3:62613098-62613120 AGCTGAGACCAGATGGAGGAGGG + Intronic
956637305 3:71379071-71379093 TAATGAGGGCAGAGGGAAGAAGG - Intronic
957331735 3:78773740-78773762 ATATGAGACTAGAGGGAGGAAGG - Intronic
959156664 3:102674728-102674750 AAATGAGAGAAGAAAGATGAGGG - Intergenic
959521149 3:107324301-107324323 AGATGAGATCAGAGAGGTGAGGG - Intergenic
959593391 3:108103235-108103257 AGATGAGATCAGAGAGATCAAGG + Intergenic
960084316 3:113574250-113574272 TACTTAGACCAGAGGAATGAAGG + Intronic
960450352 3:117799243-117799265 AAATGGGGACACAGGGATGAGGG - Intergenic
961156129 3:124681165-124681187 AAATGGGCACAGAGGGATGTGGG + Intronic
961492791 3:127266804-127266826 AACTGAGGCCAGTGGGTTGAAGG - Intergenic
961916296 3:130378594-130378616 AGATGAGGCCAGAGGGAAGCAGG - Intronic
962954318 3:140250186-140250208 AAATGTGTCCTGAGGGATTATGG + Intronic
962954533 3:140252233-140252255 ATATGAGACCAGAAGGGTCAGGG + Intronic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963000863 3:140680337-140680359 GAATGAGACCAGAGTGAGGCAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
964592484 3:158379838-158379860 AAATGGGACAAGAGGGAGGGAGG - Intronic
964726209 3:159816719-159816741 AAATGAGACCAGAGGTCAGCAGG - Intronic
965084927 3:164083284-164083306 AAATGAGAACTGAGTGATAAGGG - Intergenic
967817387 3:193810932-193810954 ATATGAGACTGGAGGGATGCAGG - Intergenic
968761797 4:2446129-2446151 TAATGAGACCTGAAGGATGGTGG - Intronic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
969880685 4:10171135-10171157 ATTTGAGACCAGAGGCATTAAGG + Intergenic
969910532 4:10441089-10441111 AAATGAAAGCACAGGAATGATGG - Exonic
970306274 4:14735443-14735465 AGATGAGGTCAGAGAGATGAGGG + Intergenic
970326906 4:14935415-14935437 AAATGAGGCCAGTGTGAAGAAGG + Intergenic
970494958 4:16615930-16615952 ACCTGAGACCAGAGTGATTAAGG - Intronic
971705815 4:30041390-30041412 AAATGAGGTCATAGGGATAAGGG - Intergenic
972896956 4:43634270-43634292 AATTGAGAAAAAAGGGATGAGGG + Intergenic
974396846 4:61347550-61347572 ATATGAGGCCAGAGGGAAGGGGG - Intronic
974438082 4:61882613-61882635 AAATGAGGACAGAGAGGTGATGG - Intronic
974506556 4:62781569-62781591 AAATGTGATCAGAAGTATGAGGG + Intergenic
975615000 4:76237277-76237299 AAATTAAACCTGAGGCATGATGG - Intronic
976008215 4:80456209-80456231 AAATGAGGCCAGAGAAATAAAGG + Intronic
976044468 4:80929310-80929332 AGTAGAGACCAGAGGGATAATGG - Intronic
977171391 4:93767125-93767147 AAATGAGAGAAGGGGAATGAAGG + Intronic
977286904 4:95118943-95118965 CAATGAGACCAGAAGGATCAAGG - Intronic
977431145 4:96931367-96931389 GAATGAGAACAGAGGATTGAAGG + Intergenic
979190814 4:117856092-117856114 AAATGGCACCAGAGGAATCAGGG - Intergenic
979629891 4:122888527-122888549 AAATGAGATCAGAGAGGTAATGG - Intronic
979664565 4:123296262-123296284 AAATAACACCAGAGGGATGCAGG + Intronic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982454641 4:155594328-155594350 AGAAGAGATCAGAGGGATGGAGG - Intergenic
983429709 4:167633079-167633101 CAATGAGAACACAGGGATGCAGG + Intergenic
984785020 4:183559899-183559921 TAATCAGAGCAGAGGGATAATGG - Intergenic
985374523 4:189321228-189321250 AAATAAAACCAGAGGGAAAAAGG - Intergenic
986164641 5:5263395-5263417 AATGAAGACCAGAGGGATGAAGG - Intronic
986223851 5:5794754-5794776 AAATGAGGAAAGAGGGGTGATGG + Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987167555 5:15216837-15216859 AAATGAGATCAGAGATATGTAGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
989401134 5:41008843-41008865 AAATCAGCCCAGAGAGAAGATGG - Intronic
989814170 5:45715562-45715584 AAAAGAGACTGGAAGGATGAGGG + Intergenic
991212718 5:64124628-64124650 AAATGAGTACTGAAGGATGAAGG - Intergenic
991239485 5:64441260-64441282 GAATGTGACCAGATAGATGAGGG - Intergenic
991392475 5:66161738-66161760 AAATGTGACCAGAGGCTTGTAGG + Intronic
992494156 5:77275414-77275436 TAATGAGACCAAAGGGATAATGG - Intronic
993074144 5:83206032-83206054 AAATGAGATGAGAGAGATGATGG + Intronic
993823957 5:92657890-92657912 AAATGAGACCAGAGAGACAATGG + Intergenic
994292048 5:98039375-98039397 AAATGAAACAAAAGAGATGAAGG + Intergenic
996407048 5:123115849-123115871 AAATGAGGAGAGAGGGATCAGGG - Intronic
996842023 5:127857391-127857413 TGATGAGACCAGAGTAATGATGG - Intergenic
997091206 5:130860851-130860873 AAAGGAGACAAGAGGGAGGGAGG - Intergenic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
998394718 5:141811439-141811461 GAATGAGGCCAGGGGGAGGAAGG - Intergenic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
999076855 5:148804509-148804531 AAATGACAGCAGGGGGAGGAGGG + Intergenic
999863436 5:155674367-155674389 AAAGGAGACCAGAGCTTTGAAGG - Intergenic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
1000786790 5:165554836-165554858 AAATGAAACCCAAGGGAGGAAGG - Intergenic
1001194579 5:169660357-169660379 AAATAAAATCAGAGGAATGAGGG + Intronic
1001586442 5:172836125-172836147 AAATGAGGCTCCAGGGATGAGGG + Intronic
1002923565 6:1591371-1591393 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1003379775 6:5613917-5613939 AGCTGAGAACAGAAGGATGATGG + Intronic
1004112857 6:12737431-12737453 ATATGTGTCCAGAGAGATGAGGG + Intronic
1004154387 6:13154696-13154718 AAATGAGAACCGAGGTGTGAGGG - Intronic
1004203586 6:13572241-13572263 AATTGAGACTGGAAGGATGAGGG + Intergenic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1004463501 6:15861821-15861843 AAAAGATACCATAGGGCTGAGGG + Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1006435474 6:34023811-34023833 AACTGAGGCCAGAGGGGTGAGGG + Intronic
1007046191 6:38776736-38776758 AAGAGACACCAGATGGATGAAGG + Intronic
1007307261 6:40916913-40916935 AGATGAGACCAGAGTCAAGAAGG + Intergenic
1008540122 6:52538919-52538941 AAATGGGACCAGAGGCTTGCAGG - Intronic
1009973123 6:70645621-70645643 AAATGAGAACAGAGAGAGGGTGG + Intergenic
1010222312 6:73458499-73458521 AGATGATACCTTAGGGATGAGGG - Intergenic
1010763535 6:79751796-79751818 AAGAAAGCCCAGAGGGATGAGGG + Intergenic
1012946786 6:105474745-105474767 AAATGATACCTGAGACATGATGG + Intergenic
1013179371 6:107705515-107705537 AAATGACTCCAGGGAGATGATGG - Intronic
1015231593 6:130921184-130921206 GACTGAGACCAGAGGCAGGAAGG - Intronic
1015308113 6:131733316-131733338 AATTGAGAGCAGAGGAATAATGG - Intronic
1015947065 6:138513690-138513712 ATCTGAGACCCGAAGGATGATGG - Intronic
1016584646 6:145670219-145670241 AAAAGAGATCAGAGCAATGAGGG - Intronic
1017136815 6:151154329-151154351 AAATGGGGCAAGAGGGATGAGGG + Intergenic
1017551426 6:155512604-155512626 AAATGAGATCTTGGGGATGATGG - Intergenic
1017575159 6:155794112-155794134 ACAAGAGACCAGAGGGACTATGG + Intergenic
1017722624 6:157254506-157254528 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1017823120 6:158063110-158063132 AAATGTGACCAGAGGTTTGCAGG + Intronic
1018394686 6:163369226-163369248 AAATGACCCCAGAGTGAAGAAGG - Intergenic
1018406928 6:163495277-163495299 AAATGTGACCAGAGGTTTGTGGG + Intronic
1021218182 7:17942372-17942394 AAATGAGGTCAGAGGGGTGGAGG - Intergenic
1021853865 7:24834379-24834401 AAATGAAACCGGAGGGAACAGGG + Intronic
1022285242 7:28950452-28950474 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1022674649 7:32487733-32487755 AAATCACACCAGAAGGAAGAAGG - Exonic
1023748352 7:43344606-43344628 AAAGGACAGCAGAGAGATGATGG - Intronic
1024085063 7:45885681-45885703 AAGTGAGACCTCAGGGAGGATGG + Intergenic
1024252183 7:47514530-47514552 AAAGGAGACCAGAGGGAAAGTGG - Intronic
1024730357 7:52246871-52246893 ACCTGAGACCAGAGAGATGATGG - Intergenic
1024976799 7:55120868-55120890 AAATGAGTCCAAAGGCATTACGG + Intronic
1026987985 7:74566896-74566918 GGATGAGACCAGAGGGGTGGTGG - Intronic
1027596768 7:80184064-80184086 AAAGGAGACCAGTGGGCGGAGGG + Intronic
1028113844 7:86975080-86975102 AAAAGAGAACAAAGAGATGATGG + Intronic
1028160621 7:87480617-87480639 AAATGAGATCAGAGAGGTCACGG - Intergenic
1028372113 7:90104102-90104124 AAATGAGAATAGAGGGAGAAAGG + Intergenic
1028630399 7:92927452-92927474 AAAAGGGTCTAGAGGGATGATGG + Intergenic
1028769802 7:94605515-94605537 CAATGATACAAGAGAGATGAGGG + Intronic
1028774399 7:94660873-94660895 AAAAGAGACCAGAGTTAAGATGG - Intronic
1029049630 7:97671001-97671023 AAATGAGGCTAGAAAGATGAAGG + Intergenic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1030388881 7:108900759-108900781 GAATGAGAGGGGAGGGATGAAGG - Intergenic
1031715029 7:125098231-125098253 AAATCAGACATGAGAGATGAAGG - Intergenic
1031734957 7:125347473-125347495 GAATGAGGCCGGAAGGATGAAGG - Intergenic
1031929624 7:127671425-127671447 AAATGTGACCAGAAGTTTGAAGG - Intronic
1032196262 7:129790509-129790531 AACTGAGGCCAGATGGATCATGG + Intergenic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1032620078 7:133520725-133520747 AATTAAGACAAGAGGAATGAAGG - Intronic
1032797389 7:135288832-135288854 AACTGAGAACAGAGGGGTCATGG - Intergenic
1033022325 7:137738913-137738935 CAACGAGACCTGAGGGATGAGGG - Intronic
1033408142 7:141090526-141090548 TAATGAGAACAGACTGATGAAGG + Intronic
1035010773 7:155713506-155713528 AAAGGAGCCGAGAGGGAGGAAGG + Intronic
1035232087 7:157471343-157471365 AAATTAGACCAGGTGGTTGAAGG + Intergenic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1036010094 8:4712402-4712424 AAATAAAACCAGAAGGATGCAGG + Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037946621 8:22993577-22993599 AAGGGAGACCAGAGAGATTAAGG + Intronic
1038139825 8:24832219-24832241 AAATCAAACCAGAGAGAAGAAGG + Intergenic
1038269561 8:26064261-26064283 AGGTGACACCAGATGGATGATGG + Intergenic
1038482235 8:27909707-27909729 AAAGGTGATCAGGGGGATGAAGG - Exonic
1038834700 8:31106442-31106464 GAATGAGATCAGAGGGAAAATGG - Intronic
1039081366 8:33737212-33737234 AAATGAGGGCGGAGGGAGGAGGG + Intergenic
1039182694 8:34883870-34883892 AAATGAGAAGAAAGGAATGAAGG + Intergenic
1039259706 8:35757958-35757980 AAATGTGGCTAGAGTGATGAAGG - Intronic
1039818045 8:41112005-41112027 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1044827029 8:96208519-96208541 AGATGAGGCCAGAGAGGTGAAGG - Intergenic
1044876269 8:96669910-96669932 AAATGTGACCAGAGGCTTGCAGG - Intronic
1045512538 8:102823504-102823526 AAAGGGGACCAAAGTGATGAAGG + Intergenic
1046651067 8:116837209-116837231 AAATGCGATCAGAGAGATAATGG + Intronic
1047118242 8:121869710-121869732 AAATGAGATAACAGAGATGAAGG - Intergenic
1047177648 8:122556622-122556644 AAATGAGAGAAGAGAGAGGATGG + Intergenic
1047992322 8:130298727-130298749 AACTGAGATCAGAGGGATAGAGG - Intronic
1048976032 8:139673714-139673736 AAATGCCACCAAAGAGATGATGG + Intronic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1049917875 9:336104-336126 TAATGAGAGCAGAGGAATGCTGG + Intronic
1050463391 9:5895949-5895971 AAATGAGAGCACAGGCATGTTGG + Intronic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051213630 9:14772982-14773004 TAATGTGACCAGAGACATGACGG - Intronic
1051383817 9:16485554-16485576 AAATGAGCCCAGTGGGGTGGAGG - Intronic
1052477862 9:28984076-28984098 AAATGAGAAGAGAGTGAAGAAGG - Intergenic
1054710307 9:68504432-68504454 AAATGAGGTCAGAGGGAGAAGGG - Intronic
1054852178 9:69858676-69858698 AAATGTGACCAGAGGCTTGCAGG + Intronic
1055145014 9:72922727-72922749 AAATCATACCAGAGGAATAAAGG - Intronic
1055197557 9:73614940-73614962 CAATGAGACGAGAGAGATGATGG - Intergenic
1056599218 9:88033025-88033047 AAATCAGACAAGAAGGATGGAGG - Intergenic
1057596012 9:96417272-96417294 AGAGGAAACGAGAGGGATGAGGG - Intronic
1057716076 9:97497429-97497451 AAATGAGAACAGAAAGAGGAAGG + Intergenic
1058149650 9:101450044-101450066 AAATGAGATCAGAGTGACTATGG - Intergenic
1058553054 9:106136328-106136350 AGATGAGAGCAGAGGGACCACGG + Intergenic
1059914030 9:119078401-119078423 AAATGAGACAAAATGGATAAGGG + Intergenic
1060015678 9:120084403-120084425 AGATGAGACAAGGGGGATTATGG - Intergenic
1060856471 9:126917645-126917667 AAATGAGACGGGAGGGGAGAAGG + Intronic
1061190577 9:129080570-129080592 AACTGAGACCAGAGAGCAGAGGG - Intergenic
1061941772 9:133887710-133887732 GACACAGACCAGAGGGATGACGG + Intronic
1187164870 X:16795729-16795751 AAATGAAGCCAGAGAAATGATGG - Intronic
1187572538 X:20519437-20519459 AAAGGAGATCAGAGAGATAACGG - Intergenic
1187765468 X:22636952-22636974 AGATAAGACCATAGGGTTGAGGG + Intergenic
1187962799 X:24582746-24582768 AAATGAAACCAGAGATATCAAGG - Intronic
1190066499 X:47245089-47245111 AAATGAGATCCCAGGGATGGGGG + Intronic
1190626595 X:52343564-52343586 AAATGAGGCCTGAGGGGAGATGG - Intergenic
1190689400 X:52900988-52901010 AAATGAAACAAGAAGGATGTGGG - Intronic
1190696583 X:52954804-52954826 AAATGAAACAAGAAGGATGTGGG + Intronic
1190701416 X:52992265-52992287 AAATGAGGCCTGAGGGGAGATGG + Intronic
1190947539 X:55110402-55110424 AGAAGAAACAAGAGGGATGATGG + Intronic
1191870613 X:65742007-65742029 AAATGAGACCAAAGATAAGAAGG - Intergenic
1192025509 X:67446298-67446320 AAATAATACCAGAGAGATAATGG - Intergenic
1192227157 X:69237223-69237245 AAATGAGAACACAAGGAGGAAGG - Intergenic
1194792909 X:98173286-98173308 AACTGAGACAGGAAGGATGAAGG - Intergenic
1195401681 X:104467711-104467733 AGATGAGACGGGAGGGATGGTGG - Intergenic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1198054984 X:132984988-132985010 AAAGCAGGCCAGAAGGATGAGGG - Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198709515 X:139485901-139485923 AAATGAGAACAAAGAGAAGATGG + Intergenic
1198784675 X:140274053-140274075 AACTGAGACCAGAGAGGTGGTGG - Intergenic
1199442294 X:147882480-147882502 ACATGAGACTAAAGTGATGAAGG + Intergenic
1199599885 X:149535568-149535590 AAAGGAGAGGAGAGGGATGAGGG - Intergenic
1199650755 X:149944683-149944705 AAAGGAGAGGAGAGGGATGAGGG + Intergenic
1201623357 Y:15985200-15985222 ACATGAGACCAGGAGGTTGAAGG - Intergenic
1202304507 Y:23454156-23454178 AAATGAAAGCAGAGGAATGGTGG + Intergenic
1202566303 Y:26216435-26216457 AAATGAAAGCAGAGGAATGGTGG - Intergenic