ID: 1106216887

View in Genome Browser
Species Human (GRCh38)
Location 13:27709933-27709955
Sequence CATTAAGCAAACAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106216887_1106216891 24 Left 1106216887 13:27709933-27709955 CCCAGCTCCTTGTTTGCTTAATG 0: 1
1: 0
2: 1
3: 13
4: 199
Right 1106216891 13:27709980-27710002 TCTCAAACATAATCTTCAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 156
1106216887_1106216892 25 Left 1106216887 13:27709933-27709955 CCCAGCTCCTTGTTTGCTTAATG 0: 1
1: 0
2: 1
3: 13
4: 199
Right 1106216892 13:27709981-27710003 CTCAAACATAATCTTCAGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106216887 Original CRISPR CATTAAGCAAACAAGGAGCT GGG (reversed) Intergenic
902045413 1:13520273-13520295 CATTAAGCAAACTGGGAACATGG - Intergenic
902325292 1:15696169-15696191 TATTAAGCTCACAAGGAGCAGGG + Intronic
902422327 1:16290754-16290776 CAGTCTGCAAACCAGGAGCTGGG + Intronic
903310747 1:22453151-22453173 CATTAACCATACAAAGATCTGGG - Intronic
903555510 1:24190309-24190331 CCTTAAGCAAGCAAGAGGCTGGG - Intergenic
904655218 1:32040490-32040512 CTTCAAGCCAACAAGGAGCTTGG - Intronic
904752826 1:32751620-32751642 CATTAAGGAAGCACTGAGCTGGG + Intronic
905886085 1:41492941-41492963 CATCTAGCAAGAAAGGAGCTGGG + Intergenic
907428165 1:54394497-54394519 CAGTAAGCATAGTAGGAGCTTGG + Intronic
909198479 1:72657989-72658011 CATTAAGCATAGAAGAAGATAGG - Intergenic
909870110 1:80728622-80728644 TATTGAGCAAGCAAGGGGCTAGG + Intergenic
910466485 1:87505768-87505790 CATTAAGCAAACTAAATGCTTGG - Intergenic
910853974 1:91676288-91676310 CATCAAGCAGATAGGGAGCTAGG - Intergenic
911965150 1:104359508-104359530 TATTAAGAAAAGAAGGAGATTGG + Intergenic
912111935 1:106354028-106354050 TATTTAGAAAACAAGGGGCTAGG + Intergenic
915445247 1:155970842-155970864 CATCAGGCAAACCTGGAGCTTGG - Intronic
915986749 1:160473680-160473702 CAATAAGGAAACTGGGAGCTAGG + Intergenic
920140354 1:203806601-203806623 CATTAAGAAAAAAAGGTGTTAGG - Intronic
921854407 1:219965841-219965863 CATCAAGCAAGCAAGGAGGAAGG - Intergenic
922541023 1:226419731-226419753 CATTAAGAAAACAAGGACAAAGG - Intergenic
923047184 1:230363898-230363920 CATTGAGAAAACAACGAGATTGG - Intronic
1063041472 10:2342735-2342757 CAGAAGCCAAACAAGGAGCTAGG + Intergenic
1065433510 10:25683645-25683667 CAAAAAGCAAACAAAAAGCTGGG + Intergenic
1068629575 10:59285368-59285390 TATTTAGTAAACAAGCAGCTGGG + Intronic
1076069343 10:127474180-127474202 CATTAAACATTAAAGGAGCTAGG + Intergenic
1078556641 11:12332493-12332515 GATTAAGCATGCAAGGAACTTGG + Intronic
1079736759 11:24007064-24007086 CATTATCCAAACAAATAGCTTGG + Intergenic
1084740089 11:71133843-71133865 CATTTAGCTAACAAGCAACTGGG + Intronic
1085332256 11:75663354-75663376 CATGTACCAGACAAGGAGCTGGG - Intronic
1086144169 11:83533354-83533376 CATGTATCAAGCAAGGAGCTGGG + Intronic
1086545939 11:87967580-87967602 CATTAAGAGAACAAAAAGCTGGG + Intergenic
1088739725 11:112757339-112757361 CATGAAGCTAAAATGGAGCTTGG - Intergenic
1090080488 11:123609241-123609263 CATGCAGCTAAGAAGGAGCTAGG + Intronic
1090584349 11:128194262-128194284 CATTTAGAAAAAAAGGAACTTGG + Intergenic
1093294452 12:17370778-17370800 GATAAAGCAGACAAGGAGGTTGG + Intergenic
1094040872 12:26121361-26121383 CGTTAAAGAAACACGGAGCTGGG - Exonic
1095576157 12:43742376-43742398 AGTTAAGAAAGCAAGGAGCTGGG + Intronic
1095978117 12:47953703-47953725 CAATAAGCAAACAACGGACTTGG + Intergenic
1097359754 12:58645882-58645904 AATTAACCAGACAAGTAGCTGGG + Intronic
1099016965 12:77354962-77354984 CATTAAACAAGCACTGAGCTAGG + Intergenic
1099232677 12:80045255-80045277 AATTCAGCAAAAAAGGAGTTTGG - Intergenic
1099909634 12:88813801-88813823 AATTAAGCAAATAGGGAGGTTGG - Intergenic
1101271131 12:103146183-103146205 CATTAAGAAAACATAGGGCTGGG + Intergenic
1102197993 12:111037848-111037870 AATTGAGCTAACAATGAGCTGGG + Intronic
1102643163 12:114384227-114384249 CATTAAAAAAACAAGGAGTGTGG - Intronic
1104471635 12:129034341-129034363 CATTTAGGAATCAAGGGGCTGGG - Intergenic
1105395095 13:20024277-20024299 CATCAAGTAAACATGGAGTTAGG - Intronic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1106421026 13:29586450-29586472 CATTAAGCTAACACGGAACATGG + Intronic
1108250069 13:48556589-48556611 CATTAAGCAAAAAAAAAACTGGG - Intergenic
1108993706 13:56697675-56697697 CATTAGGCAAAACAGAAGCTGGG + Intergenic
1110030544 13:70606239-70606261 CAGTAAGCAATGAAGGAGCTAGG - Intergenic
1112639590 13:101257761-101257783 CATTAAAAAAACAAAGATCTTGG + Intronic
1113158312 13:107350801-107350823 CATTCAGCAAATCTGGAGCTGGG - Intronic
1114726011 14:24938447-24938469 CATACAGCAAACAAGGGCCTTGG - Intronic
1118187378 14:63549774-63549796 CAGGAAGAAAACAAGGAGCAGGG + Intergenic
1119206023 14:72794097-72794119 CAGCAAGTAAGCAAGGAGCTGGG - Intronic
1120361493 14:83509316-83509338 TATTAAGCATACAAGCAACTTGG - Intergenic
1120544809 14:85798102-85798124 AATTAAGAAAACAAGGAGATGGG + Intergenic
1123834497 15:24174886-24174908 CATTCACCAAAAAAGGAACTAGG - Intergenic
1126160142 15:45604203-45604225 TATTAAGAAAAAAAGAAGCTGGG + Intronic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1128714765 15:69900205-69900227 CATGAAGCAAACACTGACCTTGG - Intergenic
1131099887 15:89679532-89679554 CATTTAGCAAACAAGGAGGTAGG + Intronic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1137790645 16:51171910-51171932 CATTCATAAAACAAGGAGATAGG + Intergenic
1138446762 16:57069658-57069680 CATTAAGCCACCACAGAGCTTGG - Intronic
1140670240 16:77270256-77270278 ATTTAAAAAAACAAGGAGCTGGG - Intronic
1140692022 16:77493724-77493746 CATTAACCAAACAAGGGTGTTGG - Intergenic
1142652301 17:1362885-1362907 CATTGAGTATGCAAGGAGCTAGG - Intronic
1143208298 17:5162482-5162504 CATTTTACAAACAAGGAGATAGG + Intronic
1147338282 17:39739672-39739694 CAGGAAGTAAACAAGGAGGTTGG + Intronic
1149871970 17:60191063-60191085 CATTTTACAGACAAGGAGCTAGG - Intronic
1149890985 17:60390811-60390833 CATTAAGAAGATTAGGAGCTAGG - Intronic
1150428700 17:65098699-65098721 CATTAAGAATAAAAGAAGCTGGG + Intergenic
1154143762 18:11849204-11849226 CATTAAGAAAACTATGGGCTGGG + Intronic
1157402047 18:47396705-47396727 CATTAAGCAGATAAGGACATAGG - Intergenic
1157689164 18:49666868-49666890 GATTAAGCAATTCAGGAGCTAGG + Intergenic
1159176212 18:64838182-64838204 CATTTAGCAACTAAGAAGCTGGG - Intergenic
1165968302 19:39603554-39603576 TATTAATCAACCAAGCAGCTGGG + Intronic
925244197 2:2365499-2365521 CATTCAGCCAGCAAGGAGCTTGG - Intergenic
926398675 2:12472024-12472046 CAATAAGCAAACAATGGGCCAGG - Intergenic
926583271 2:14655620-14655642 CATTAAGGAAACAAAAAGCATGG + Intergenic
928595533 2:32855947-32855969 CATTATGCAAATAAGCAGCCTGG - Intergenic
929219933 2:39452901-39452923 CCTTAAACATACAAGGAGATGGG + Intergenic
929795954 2:45058527-45058549 CATTAAGCATTCCAGGGGCTTGG - Intergenic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
934537883 2:95151385-95151407 CAGCAAGAAAACAAGGACCTCGG + Intronic
935560746 2:104557263-104557285 CATTATCCAAACACGGTGCTTGG + Intergenic
936456196 2:112676069-112676091 AATTAAACAAAAAAGGATCTGGG + Intergenic
937765578 2:125656946-125656968 CATTTAACAAACTAGGGGCTGGG + Intergenic
939485346 2:142805240-142805262 CATGAAGAAAACAAGCAGGTAGG - Intergenic
939817740 2:146916996-146917018 CATTAACCTAACAGGGTGCTGGG + Intergenic
942290263 2:174462424-174462446 CCTTAGCCAAACAAGTAGCTGGG + Intronic
943539339 2:189192457-189192479 CATTATGCAAATAAGGAATTGGG - Intergenic
943664897 2:190599016-190599038 CATTTATCAAACAAGGAGTATGG + Intergenic
944977268 2:205068600-205068622 AGTTAAGCATACAAGAAGCTAGG - Intronic
946786631 2:223252032-223252054 CATTAAGCTAGGAAGAAGCTGGG - Intergenic
948399377 2:237672373-237672395 CACTAAGAAAACAAGAAGCTGGG - Intronic
1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG + Intronic
1170211563 20:13850616-13850638 CAATAAGGAAACAAGAACCTTGG + Intronic
1171131516 20:22658072-22658094 CAATAAGTAAACAAGGAGGGAGG - Intergenic
1172927672 20:38553536-38553558 CATTAAGCAAACATGGTCCAAGG - Intronic
1173224034 20:41151506-41151528 CATTTTACAAACAAGGATCTGGG - Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1173835218 20:46120637-46120659 CAACAAGCAAACAACCAGCTGGG + Intronic
1174872949 20:54200545-54200567 AATAAAGCAGACAAGGTGCTTGG - Intergenic
1176204021 20:63878488-63878510 CATCAACCAAACAGGGAGGTGGG + Intronic
1177361739 21:20081700-20081722 CATTAAGAAAACAAGAAGTAAGG - Intergenic
1178370123 21:32020516-32020538 CAATAAGCTAATAAGGAGATTGG - Intronic
1178588617 21:33890789-33890811 TATTTAGAAAACAAAGAGCTAGG - Exonic
1178721112 21:35009830-35009852 GACTAACCAAACATGGAGCTTGG + Intronic
1179399867 21:41073967-41073989 CATTAAGCAAAAATGTATCTGGG - Intergenic
1181961419 22:26624671-26624693 CAGTAAGCAGACAATGAGCTTGG + Intronic
1182699211 22:32220386-32220408 CATTAGGTAAACAAAGAGCCAGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949251877 3:1995019-1995041 CATTTATAAAAAAAGGAGCTGGG - Intergenic
951854141 3:27176242-27176264 CTTCAACAAAACAAGGAGCTTGG - Intronic
952510157 3:34044780-34044802 CATTAAGGGTACAAGGAACTTGG + Intergenic
953230953 3:41064628-41064650 CATGAAGCCAACAAGGACTTGGG - Intergenic
958145027 3:89613049-89613071 CATTCAGCAAACATGAAACTAGG - Intergenic
959072318 3:101714243-101714265 CATTAAAAAAACAAAGGGCTGGG + Intergenic
964666192 3:159176124-159176146 TATTAAGAAAACAAGCAGTTTGG - Intronic
965638858 3:170812182-170812204 AATTAGGCAAACAAAAAGCTGGG - Intronic
968157969 3:196398790-196398812 AATTAAGAAAAAAATGAGCTGGG - Intronic
969044201 4:4324759-4324781 AATTGAGAAGACAAGGAGCTTGG - Intergenic
969097011 4:4741128-4741150 CATTAAGCTGACATGGAGCCTGG - Intergenic
970106079 4:12586085-12586107 CATTTAGTTAAGAAGGAGCTGGG - Intergenic
971155670 4:24079433-24079455 CACTAGGAAAACAATGAGCTGGG - Intergenic
971455849 4:26842807-26842829 CATTAAGAAAACATGGAAATAGG - Intergenic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
977398212 4:96498055-96498077 GATCAAGCAAACAAAAAGCTGGG + Intergenic
977766392 4:100803640-100803662 CATTTAGCAGACAGGAAGCTAGG - Intronic
977796650 4:101173758-101173780 CATTAAGAAAAAAAAGAGCATGG + Intronic
978470018 4:109055098-109055120 CATTAAGCAAGCAAACAGGTGGG - Intronic
982342152 4:154311533-154311555 CATTATACAAACAAGAATCTTGG - Intronic
982858605 4:160418138-160418160 CATTTAAAAAATAAGGAGCTGGG - Intergenic
983959761 4:173738270-173738292 CAGTCAGCAAACACTGAGCTAGG - Intergenic
984406592 4:179340138-179340160 CATTAAGAAAACAATGATCTAGG + Intergenic
986078274 5:4360946-4360968 CATTAAGCAGTCTAGAAGCTGGG + Intergenic
986416145 5:7530115-7530137 CAGCAACCAAACAAGGAGGTTGG - Intronic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989558421 5:42824055-42824077 CATAAAACAAACAAGAACCTAGG + Intronic
989768209 5:45111374-45111396 CAGGAAGCAAACAAGCAGATGGG + Intergenic
990862956 5:60348220-60348242 CAGTTAGCAAACAAGAACCTGGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
992166160 5:74054058-74054080 CACCCAGCAAGCAAGGAGCTGGG - Intergenic
995515238 5:112947993-112948015 CATTAATCAAGCAAGGACATGGG + Intergenic
995544578 5:113217131-113217153 AATTATGAAAACAAGCAGCTAGG + Intronic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
996264330 5:121517466-121517488 AATAAAGCAAACAATTAGCTGGG + Intergenic
996581169 5:125033982-125034004 CATTGAGAAAATAAGGAGGTAGG - Intergenic
996814571 5:127560531-127560553 CTTTAAGCATACCAGGGGCTGGG + Intergenic
999767177 5:154750041-154750063 CATTCAGCAAACTCGGAGATGGG + Intronic
1002983478 6:2164953-2164975 CTTAAAGCAATCAAGGATCTGGG - Intronic
1003646601 6:7917758-7917780 CATCTAGCAGACAAAGAGCTGGG - Intronic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004369107 6:15036966-15036988 CATTTAGCCAACAGGGAGGTTGG - Intergenic
1005250526 6:23941120-23941142 CATTAAGAAAACAAATGGCTCGG - Intergenic
1005969345 6:30749134-30749156 CATTAAGCCAATAAGGGGGTGGG + Intergenic
1006972656 6:38062665-38062687 AATTAAGCAGACAATGGGCTGGG - Intronic
1008438324 6:51502258-51502280 CATGAAGCAAACAAAAAGGTGGG - Intergenic
1009006148 6:57790343-57790365 CATTAAGCAAAAATGCAACTCGG - Intergenic
1009585308 6:65593928-65593950 CATTTCACAAACAAGGAACTTGG + Intronic
1010102854 6:72130277-72130299 CATTCAGAAAAAAAGTAGCTGGG - Intronic
1014093013 6:117426749-117426771 ATTTAAGAAAACAAGGAGGTTGG - Intronic
1015884516 6:137903065-137903087 TTTTAAGCAGACTAGGAGCTAGG - Intergenic
1016786578 6:148017094-148017116 CATTAAGCAGCCAAGGAGATTGG - Intergenic
1016906003 6:149151490-149151512 CACTAAACAACCAAGGAGATGGG + Intergenic
1017345829 6:153379673-153379695 CATTAGGCAATCACAGAGCTGGG + Intergenic
1017805760 6:157944070-157944092 CATAAAGCAAAACAGGACCTTGG + Exonic
1022702953 7:32778496-32778518 CACTAAGGGAAGAAGGAGCTGGG + Intergenic
1022907187 7:34868616-34868638 CACTAAGGGAAGAAGGAGCTGGG + Intronic
1028209145 7:88052166-88052188 CATGAAGAAAACAAAGACCTCGG + Intronic
1029529337 7:101114865-101114887 CAAGAAGCAAACAAAGAACTCGG - Intergenic
1031589602 7:123573488-123573510 CCTCAAGCAAAGAAGCAGCTCGG + Intronic
1031678616 7:124642662-124642684 AATTAAGGAAACAAAAAGCTAGG + Intergenic
1033981533 7:147171023-147171045 GATTCAGCAGACATGGAGCTGGG - Intronic
1036141504 8:6213202-6213224 AACTAAGCAAGCAAGCAGCTTGG - Intergenic
1036777646 8:11624679-11624701 CATGGAGCAAATAAGGAGATGGG + Intergenic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1041837194 8:62229857-62229879 CTTTAAGTAAAAAATGAGCTAGG - Intergenic
1041914116 8:63122217-63122239 CATTAGGCAAAGAAGTGGCTGGG + Intergenic
1044466808 8:92516207-92516229 CATTAAGCAAAGAAACAGCGGGG + Intergenic
1045451505 8:102331417-102331439 CATTAAGCAAATCTAGAGCTAGG - Intronic
1045526894 8:102948565-102948587 CACTAAGCTCATAAGGAGCTAGG - Intronic
1046278638 8:111995095-111995117 GAATAATCAAACAAGGAGCAAGG + Intergenic
1047087806 8:121538374-121538396 GAGTAAGGAAACAAAGAGCTAGG - Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1048615176 8:136066499-136066521 ATTTTAGCAAACAAGGAACTAGG - Intergenic
1048715663 8:137265781-137265803 CAAAAAGCAATCAAGGAGCGTGG - Intergenic
1049769156 8:144371864-144371886 CATTAAAGAAAGAAGGGGCTAGG - Intergenic
1051565520 9:18493527-18493549 CCTTTGGCAAACAAGGATCTAGG + Intronic
1055796776 9:79983015-79983037 CATTTAGGAAACAATGATCTTGG - Intergenic
1056394510 9:86169174-86169196 CAATAAGCCCAAAAGGAGCTAGG + Intergenic
1057340344 9:94195643-94195665 CATGAAGAAAACAAGTACCTAGG - Intergenic
1058691158 9:107521854-107521876 CAGCAAGGAAACAGGGAGCTAGG - Intergenic
1058830652 9:108813344-108813366 CAGAAAGCAAACCAGGAGCATGG + Intergenic
1060045859 9:120339835-120339857 CATGAAGAAATCAAGGATCTGGG + Intergenic
1185937085 X:4269868-4269890 CATTAGGCAAGCATGGAGATGGG + Intergenic
1187008486 X:15255426-15255448 CATAAAGAAAACAAGGAAATCGG + Intronic
1188652215 X:32645616-32645638 CAGTAAGAAAACAAGGAGGTAGG + Intronic
1189256235 X:39641934-39641956 CATTAAACAAACAAGGTGGCAGG - Intergenic
1189759383 X:44305765-44305787 CATGATGCCAACAAGGACCTAGG + Intronic
1189923687 X:45930638-45930660 TATTAAGCAAATTAGGAACTGGG + Intergenic
1192034657 X:67548725-67548747 CATCAAGTAGACAACGAGCTTGG + Intronic
1193993495 X:88338294-88338316 CATTAAGTAATCAAGGAGGCAGG + Intergenic
1196432853 X:115645685-115645707 TATTAAGAAAAAAAGGAACTAGG - Intronic
1198690624 X:139280336-139280358 CATTAAGCAAGCAAGGCCCTTGG + Intergenic
1199165628 X:144671705-144671727 AATTAAGCAGACTACGAGCTTGG + Intergenic
1201144831 Y:11058534-11058556 CATTTAGCGAACAAGCAGCTGGG + Intergenic
1201461608 Y:14231773-14231795 TACTAAGCATACAAGGAGATGGG - Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic