ID: 1106217715

View in Genome Browser
Species Human (GRCh38)
Location 13:27718121-27718143
Sequence TCATGACCACACTCAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106217711_1106217715 0 Left 1106217711 13:27718098-27718120 CCGCATCCGGCCTCCTTAGGTTT 0: 1
1: 0
2: 4
3: 37
4: 249
Right 1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 168
1106217713_1106217715 -10 Left 1106217713 13:27718108-27718130 CCTCCTTAGGTTTTCATGACCAC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 168
1106217712_1106217715 -6 Left 1106217712 13:27718104-27718126 CCGGCCTCCTTAGGTTTTCATGA 0: 1
1: 1
2: 1
3: 23
4: 238
Right 1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 168
1106217709_1106217715 3 Left 1106217709 13:27718095-27718117 CCACCGCATCCGGCCTCCTTAGG 0: 1
1: 2
2: 9
3: 95
4: 771
Right 1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 168
1106217707_1106217715 30 Left 1106217707 13:27718068-27718090 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106217715 Original CRISPR TCATGACCACACTCAGAGAC AGG Intergenic
901023039 1:6264697-6264719 TGTGGACCACACACAGAGACAGG + Intronic
901931894 1:12601243-12601265 TCATGGCCAGACTCTGAGCCAGG - Intronic
902186159 1:14726959-14726981 TGATGCCAACACTCAGACACAGG + Intronic
902826058 1:18975063-18975085 TCATGGCCACTCTGTGAGACAGG - Intergenic
903368010 1:22816721-22816743 TCATGACCACCCTGGGAGTCAGG - Intronic
906519328 1:46458042-46458064 TCATGGCCACTCTCAGGGCCTGG + Intergenic
906686682 1:47767507-47767529 TCATGACAACACTGGGAGGCAGG + Intronic
909079133 1:71087890-71087912 TCCTGCCCACACTCACAGAGAGG + Intergenic
909287628 1:73839586-73839608 TCATAACCAACCTCAGATACTGG + Intergenic
913246779 1:116876985-116877007 TTATAACCACACTCAGAGATAGG - Intergenic
913439901 1:118886238-118886260 TCATGTCCATTCTCAGAGACTGG + Intronic
918923067 1:190741094-190741116 TCATCACAACTCTCTGAGACTGG - Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
923915695 1:238501728-238501750 TCATGATCACACTCAAAGAAAGG - Intergenic
924631253 1:245742963-245742985 TCAAGACCTAACTCAGGGACGGG + Intergenic
1062800467 10:375688-375710 TCCTGACCACAAGCAGAGCCAGG + Intronic
1063737917 10:8782220-8782242 TCATGACAACCCTAATAGACTGG + Intergenic
1066250641 10:33629622-33629644 TCATCACAACACTCTGAGATAGG + Intergenic
1067523197 10:47023094-47023116 TCCTGTCCACACTCAGAGGCAGG - Intergenic
1068796458 10:61086778-61086800 TCATGATCATAGTCAGAAACTGG + Intergenic
1070084040 10:73217753-73217775 TCTTGCCCACACTCAGAGTGGGG + Intronic
1073868081 10:107828276-107828298 TCATAATCACACTCAGATTCTGG + Intergenic
1074381851 10:112987580-112987602 TCATCATCACACTTAGAAACTGG - Intronic
1074914999 10:117947127-117947149 TCATGGCCACACCCAAAGCCAGG + Intergenic
1077236050 11:1482471-1482493 TCCTGACCACAGCCAGAGCCTGG - Intronic
1078070544 11:8106441-8106463 TCAGAACCACACCCAGAGGCTGG + Intronic
1079063225 11:17267707-17267729 TCATGACCACATTCAGAAATAGG - Intronic
1082780553 11:57284281-57284303 CCATGGCCACTCTCAGGGACTGG - Intergenic
1083779455 11:64910432-64910454 GCATGACCAGGCTCAGAGACTGG + Intronic
1084594013 11:70106497-70106519 TCATGACCACCACCTGAGACTGG + Intronic
1086020666 11:82226048-82226070 CTATGACCACATTAAGAGACAGG - Intergenic
1088018713 11:105092434-105092456 TCCTGACCACACACACATACCGG + Intronic
1090581336 11:128163428-128163450 TCAAGACTACACTCAAAGATTGG - Intergenic
1092021414 12:5205744-5205766 TCTTGAGCACACTCAGAGATGGG - Intergenic
1099409480 12:82306874-82306896 TCATGTTCTCACTCATAGACGGG + Intronic
1100398735 12:94208538-94208560 TGATGACCACATTCAGCTACGGG - Intronic
1100812148 12:98349873-98349895 TCCTCACAACACTCTGAGACTGG + Intergenic
1101313012 12:103600854-103600876 TCCTGACCACAGCAAGAGACAGG + Intronic
1104378139 12:128283384-128283406 TCATGAGCACATGCAGAGCCAGG - Intronic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1106500107 13:30320001-30320023 TCCTGACAACACACAGAGACTGG - Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1107905223 13:45055329-45055351 TCTTTATCACACTCAGAAACCGG - Intergenic
1109737793 13:66509354-66509376 TCATAACCTCCCACAGAGACTGG - Intronic
1109786460 13:67182010-67182032 CCATGCCCACATTCAGAGGCAGG - Intronic
1111330035 13:86753529-86753551 TAATCAACACACTCAGATACTGG + Intergenic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1112651055 13:101399065-101399087 TCAGGACCAAAGTCAGTGACTGG + Exonic
1113769732 13:112900355-112900377 TCATGCCCACCCTCAGTGGCTGG - Intronic
1114766432 14:25376305-25376327 TCTTGACCATTCTCAGAGTCGGG + Intergenic
1118328199 14:64795688-64795710 TCATCCCCAAACTCAGGGACAGG + Intronic
1119556196 14:75554872-75554894 TTATGACCACAATCAGAAAAGGG + Intergenic
1123930640 15:25170194-25170216 TCATGACCAGACAAAGAGACTGG - Intergenic
1128260990 15:66232684-66232706 GCATGACCCTAATCAGAGACTGG - Intronic
1130577370 15:85104526-85104548 TCAGGAGCCCAATCAGAGACTGG + Intronic
1132827969 16:1914337-1914359 TCTTGACCTCTCTCAGGGACGGG - Intronic
1135412789 16:22247834-22247856 TCCTGTCTAGACTCAGAGACGGG + Intronic
1135659421 16:24281794-24281816 TCATGACAACACTTTGAGATAGG + Intronic
1136847776 16:33590400-33590422 TCCTAACGACACTCAGAGAAGGG - Intergenic
1142191629 16:88720807-88720829 TCCTGACCACCCTAAGAGGCTGG + Intronic
1142244046 16:88960740-88960762 ACATGACCAAACCCAGAGGCGGG - Intronic
1203109484 16_KI270728v1_random:1439049-1439071 TCCTAACGACACTCAGAGAAGGG - Intergenic
1145760224 17:27421375-27421397 TCAGGACCCCACCTAGAGACTGG + Intergenic
1146371558 17:32267757-32267779 TCATGACCAGGCTCAGGGACTGG - Intronic
1146689876 17:34866047-34866069 TCCAGCCCACACTCAGAGACAGG + Intergenic
1149344153 17:55717371-55717393 TCTTCACCACACTCTGAGGCTGG - Intergenic
1150592312 17:66574412-66574434 TCATAAAAACACTCTGAGACAGG - Intronic
1151143933 17:72021186-72021208 TCATGAACACAAACAGACACTGG - Intergenic
1151991909 17:77580698-77580720 TGATGACAACACTCAGAACCAGG + Intergenic
1152135543 17:78501183-78501205 TCATCACCCCACTCACTGACAGG - Exonic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1157289103 18:46397370-46397392 GCATGACCACACACACACACAGG - Intronic
1159497139 18:69221335-69221357 TCATCACCACCCACAGAGCCAGG - Intergenic
1160018067 18:75159080-75159102 TGCTGCCCACACTCAGAGAAAGG - Intergenic
1160189727 18:76705688-76705710 ACATGATCACAATCACAGACTGG - Intergenic
1160715124 19:572947-572969 TCACGCCCACACACAGAGGCCGG - Intronic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1161825937 19:6565358-6565380 TAATGAAAACACTCAGACACAGG - Intergenic
1164437001 19:28239263-28239285 GCCTGACTACACTCAGAGCCTGG - Intergenic
1165008839 19:32828427-32828449 TCATGGCCACACCCAGAGGCTGG + Intronic
1165032784 19:33010329-33010351 TCCTAACGACACTCAGAGAAGGG + Intronic
1165740870 19:38204322-38204344 CCATGACTACACTCAAACACAGG - Intronic
1167633899 19:50642279-50642301 TGATGCACACACTCAGAGATGGG + Intronic
926220787 2:10934377-10934399 ACATGGCCTCACACAGAGACAGG + Intergenic
926691625 2:15738650-15738672 CCATGACCACAGTCAGAAAACGG + Intronic
927253648 2:21020576-21020598 TCATGACCAGACTAAGACGCTGG + Intronic
927280445 2:21300440-21300462 GCATGTCCCCACTCAAAGACAGG + Intergenic
928239440 2:29573786-29573808 TCATGACTACACTCACAGGAAGG + Intronic
928870359 2:35969572-35969594 TAATGACCAAACTCAGATTCAGG - Intergenic
929533841 2:42768268-42768290 TCATAACCTCTCTCAGAGAAAGG - Intronic
933851061 2:86367007-86367029 TACTGGCCACCCTCAGAGACAGG - Intergenic
933891127 2:86771086-86771108 TCCTGACCACACTCAGGACCAGG - Intronic
936490007 2:112961802-112961824 CCATGTCTACACTCAAAGACGGG - Intergenic
937353399 2:121183055-121183077 TCCTGGGGACACTCAGAGACAGG - Intergenic
939695868 2:145323648-145323670 TTATCACCACAATCAGATACAGG - Intergenic
945477566 2:210303603-210303625 GGATGACCCCACTCAGGGACCGG - Intronic
946311668 2:218885411-218885433 TCATGTCCACAGTGAGAGAAGGG - Intronic
949071901 2:242030361-242030383 TCATGACTGCACTCAGGGCCAGG + Intergenic
1169203307 20:3726183-3726205 TCATAACACCACTCTGAGACAGG - Intergenic
1172070350 20:32252184-32252206 TCACGACATCACTCAGGGACCGG - Intergenic
1172694171 20:36810255-36810277 TCATGACGACCCTCAGAGGTGGG - Intronic
1173096361 20:40032924-40032946 TTAGGACCACATTCAGAGACAGG - Intergenic
1174090151 20:48040203-48040225 TCATCACCACACTCAGCCTCTGG + Intergenic
1177469719 21:21544949-21544971 TCATGACCAATGTCAGAAACTGG + Intergenic
1179575753 21:42307328-42307350 CCAAGACCACACTCAGGCACAGG - Intergenic
1180971647 22:19819143-19819165 CCTTCACCACACTCAGAGGCAGG + Intronic
1182064825 22:27423231-27423253 TCATGAGAACCATCAGAGACAGG + Intergenic
1182399264 22:30061998-30062020 GCACAACCACCCTCAGAGACAGG - Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949930514 3:9074686-9074708 TCATGACTTCCCTCAGAGATGGG - Intronic
952374932 3:32758601-32758623 AAATGACCTCACTCAGATACAGG - Intronic
955205851 3:56895283-56895305 TCATGACTACTCTGAAAGACTGG + Intronic
957849532 3:85789259-85789281 TTATGACCACAATCACAGTCTGG - Intronic
960597183 3:119416927-119416949 TCAAGAGCAAACTCTGAGACTGG + Exonic
961909961 3:130304202-130304224 TGATGACCAAAGCCAGAGACAGG - Intergenic
962196815 3:133371040-133371062 TCCTGACCAGACTCAGAGAAGGG - Intronic
962282908 3:134065726-134065748 TAATGACCACTCCCAGGGACTGG + Intronic
963141353 3:141948580-141948602 CCATAACCACACTGAGAGAGGGG - Intergenic
966058854 3:175731449-175731471 TCCTGACAACCCTAAGAGACAGG - Intronic
968384967 4:127650-127672 TAATGATCAGACCCAGAGACTGG + Intronic
968495489 4:913130-913152 TCATGCCCACTCTCAAAGGCGGG + Intronic
968621539 4:1605467-1605489 TCACAACCACACTCCGAGTCAGG - Intergenic
972881035 4:43422686-43422708 TCATGAATACACTCACACACAGG - Intergenic
974821291 4:67069647-67069669 TCATCACCTCTCTCAGAGAGCGG + Intergenic
976704306 4:88005902-88005924 ACATGACCATACTTGGAGACAGG + Intergenic
979026515 4:115584268-115584290 TTATAACCACACTTAGAGTCAGG - Intergenic
983662382 4:170142511-170142533 TCAGGACCACTCTCAGAAACAGG - Intergenic
983838610 4:172426133-172426155 TCAGGACGGCACTCAAAGACTGG + Intronic
984122051 4:175757641-175757663 TCATGTACACAATCAGAGATTGG + Intronic
985176021 4:187202019-187202041 TCTTGCCCACACTCAGTGAGAGG + Intergenic
985508012 5:295692-295714 TCATGACCGCACTCAGGGCCCGG + Intronic
985740023 5:1609977-1609999 TCATGACCGCACTCAGGGCCCGG - Intergenic
985871017 5:2556791-2556813 TCATGGCCACACTCCGTGGCTGG - Intergenic
990353148 5:54938924-54938946 TTAGGGCCATACTCAGAGACAGG - Intergenic
991000151 5:61774665-61774687 TCATGAACACAATCAGAGAAAGG + Intergenic
991412694 5:66360593-66360615 TCACAACCACCCTCAGAGGCAGG + Intergenic
992405980 5:76458240-76458262 TCATGATCACCCTCAGAGATAGG - Intronic
993863263 5:93161466-93161488 TGATGACCACCATCAAAGACTGG + Intergenic
994613047 5:102070068-102070090 TCTTGTCCACACTCTGAGTCAGG - Intergenic
997849782 5:137321138-137321160 GAATCAGCACACTCAGAGACAGG + Intronic
999503766 5:152173956-152173978 TCATGAATATTCTCAGAGACAGG - Intergenic
1004591390 6:17055065-17055087 TCAAAAGCACACTCAAAGACAGG + Intergenic
1006842124 6:37035630-37035652 TCAAGCCCAGACTCAGAGAGTGG + Intergenic
1008743209 6:54635577-54635599 TCCTGTCCTCACTCAGAGAGGGG + Intergenic
1011190380 6:84721140-84721162 CCAAGATCACACTGAGAGACAGG - Intronic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1013750832 6:113404125-113404147 TCATGACCGTTCTCAGAGGCAGG + Intergenic
1016572853 6:145534248-145534270 GCATGACCCCATTCAGAGCCAGG - Intronic
1016980175 6:149846585-149846607 TCATGACCAGATTCTGAGAGTGG + Intronic
1018780196 6:167056656-167056678 TAATGAGCTGACTCAGAGACGGG + Intergenic
1018967398 6:168499194-168499216 TCATCTCCACCCCCAGAGACTGG - Intronic
1022773529 7:33500526-33500548 TCATGACAACCCTCTGAGATAGG - Intronic
1026504010 7:70966911-70966933 TCATAAACACCCTAAGAGACAGG + Intergenic
1027353823 7:77337651-77337673 TGATTACCTGACTCAGAGACTGG - Intronic
1029983230 7:104898556-104898578 TCCTGCCCTCACTCAGAAACTGG + Intronic
1032705641 7:134419284-134419306 TCATGCCCACACACAGGGGCTGG + Intergenic
1033660390 7:143398413-143398435 TCTTCACCAGTCTCAGAGACAGG + Exonic
1036397719 8:8383199-8383221 TTATCTCCACACTCATAGACAGG + Intronic
1037324696 8:17676719-17676741 TAATGACCACAATTAGAGAGGGG - Intronic
1037653814 8:20865917-20865939 TCCTGCCCACACTCAGAGGGAGG - Intergenic
1038566420 8:28623056-28623078 TCACGTCCACACTCCGAGGCAGG - Intronic
1039231506 8:35453861-35453883 TCCTGCCCACACTCAGTGAAAGG + Intronic
1040546603 8:48402806-48402828 TCATGACCAGTCACAGACACTGG - Intergenic
1042119771 8:65474099-65474121 TCATGATGTCAATCAGAGACTGG - Intergenic
1044917380 8:97129508-97129530 TCATAACCACAATCATAGCCAGG - Intronic
1048176670 8:132158732-132158754 TCATAACCACCCTAAGAGATAGG - Intronic
1051181376 9:14415464-14415486 TCCTGCCCACACTCAAAGGCCGG + Intergenic
1051215634 9:14794521-14794543 TCAGGACCAGAATCAGAGATGGG + Intronic
1052534582 9:29731106-29731128 TGCTGAACACCCTCAGAGACAGG - Intergenic
1056108158 9:83368225-83368247 TCATGACCACAAACATAGACAGG - Intronic
1056824063 9:89864603-89864625 TCAGGACCACACACACAGAGGGG + Intergenic
1058194445 9:101955757-101955779 TCATGGCCACAAACAGAAACGGG - Intergenic
1058529035 9:105887896-105887918 ACATGACCCTACACAGAGACAGG + Intergenic
1058592554 9:106581181-106581203 TTATGAGAACACTGAGAGACAGG - Intergenic
1059899364 9:118905630-118905652 TCATGACAACCCTGGGAGACAGG - Intergenic
1060094515 9:120775789-120775811 GCATGAACACATTCAGAAACCGG + Intronic
1060889564 9:127179425-127179447 GCCTGACCAGACTCAGGGACAGG + Intronic
1061923321 9:133794112-133794134 GCAAGACCACACTCAGGGCCCGG + Intronic
1062031879 9:134365504-134365526 CCATGGCCACAGCCAGAGACAGG - Intronic
1062257058 9:135631240-135631262 TCATGACCACAATCATCGCCTGG + Intronic
1185489265 X:508348-508370 TCACAGCCACACTCAGAGACAGG - Intergenic
1186099808 X:6144094-6144116 GCAAGACCCCATTCAGAGACAGG + Intronic
1186704873 X:12130346-12130368 TGATGACCTCATTTAGAGACAGG + Intergenic
1187094554 X:16133156-16133178 TAATTAACAAACTCAGAGACAGG - Intronic
1187269926 X:17770454-17770476 TCATGAACACAGTAAGAGATGGG - Intergenic
1196276335 X:113769696-113769718 TCATCACCAACATCAGAGACTGG - Intergenic
1196634295 X:117983219-117983241 TCACGACAACACTGTGAGACGGG - Intronic
1199235868 X:145491762-145491784 TTATGCCCACTCTCAGAGAGAGG - Intergenic
1199239985 X:145535320-145535342 GCATGACCACACCCAGAGGTAGG + Intergenic