ID: 1106219397

View in Genome Browser
Species Human (GRCh38)
Location 13:27733204-27733226
Sequence TTAAATAGGACAAGTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106219391_1106219397 28 Left 1106219391 13:27733153-27733175 CCAAAGTGCTAGGATTATAGGCA 0: 1111
1: 20803
2: 131421
3: 253929
4: 238116
Right 1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1106219394_1106219397 -8 Left 1106219394 13:27733189-27733211 CCAGCCAGGAAAGATTTAAATAG 0: 1
1: 0
2: 2
3: 20
4: 249
Right 1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1106219390_1106219397 29 Left 1106219390 13:27733152-27733174 CCCAAAGTGCTAGGATTATAGGC 0: 1874
1: 39142
2: 268468
3: 269123
4: 161683
Right 1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1106219393_1106219397 -7 Left 1106219393 13:27733188-27733210 CCCAGCCAGGAAAGATTTAAATA 0: 1
1: 0
2: 1
3: 41
4: 393
Right 1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106219397 Original CRISPR TTAAATAGGACAAGTCTAGA AGG Intergenic
904502495 1:30923581-30923603 TTTAATAGGAAAAGTATACAAGG - Intergenic
906391591 1:45421855-45421877 TTAAATAGAACAAGAAAAGAGGG + Intronic
907537848 1:55181324-55181346 GTAAATTGGACAAGGGTAGAAGG + Intronic
910968552 1:92831693-92831715 TTAAATAGGACAAGTTTGCTTGG - Intergenic
912527078 1:110291447-110291469 TTAAATAGCAAAAGCCCAGAGGG + Intergenic
913355356 1:117915270-117915292 GTAAATCAGACAAATCTAGAAGG + Intronic
913433012 1:118816061-118816083 TGAAATAGCACCAGTTTAGAAGG - Intergenic
916117830 1:161502805-161502827 TTAAATAAGAAGATTCTAGAGGG - Intergenic
916299782 1:163261196-163261218 TTATATAGGCCAAGACTAGTAGG + Intronic
916826829 1:168450208-168450230 TTAAATATGGCAAGACTTGATGG - Intergenic
919219692 1:194610850-194610872 ATAAATAGAACAAATCTAAAAGG + Intergenic
919290697 1:195626439-195626461 TAAAATTAGCCAAGTCTAGAAGG + Intergenic
921906510 1:220501110-220501132 TTTAATTGGACAAGTCTAAAAGG - Intergenic
1063832894 10:9976635-9976657 ATAAAAAGAACAAGTCCAGAGGG + Intergenic
1064726171 10:18282080-18282102 TTAAAGTGGACAATTCTGGAAGG - Intronic
1065339296 10:24688552-24688574 TCCAATAGGCCAAGACTAGATGG + Intronic
1065476546 10:26144439-26144461 TCAAATTGGACAATACTAGATGG + Intronic
1065716697 10:28577035-28577057 TTGAATAGCACAAATGTAGAGGG + Intronic
1066308454 10:34170786-34170808 GCAAATAGAACTAGTCTAGATGG - Intronic
1066497138 10:35953405-35953427 TGAGATTGGACAAGTCTAGTGGG + Intergenic
1066624768 10:37395232-37395254 TGAGATTGGACAAGTCTAGTGGG + Intergenic
1069359199 10:67622623-67622645 TAAAATAGTACAAGTCCAGTGGG - Intronic
1069409309 10:68136282-68136304 ATAAATAGGGCAGGTCCAGATGG - Intronic
1072187677 10:93057118-93057140 TCAAAAAAGAAAAGTCTAGATGG + Intronic
1074312256 10:112332322-112332344 CTAAATAAGAGAAGTCTTGATGG - Intergenic
1074611134 10:115023096-115023118 TTATAAAGCACAAGTCAAGAGGG + Intergenic
1077636859 11:3847797-3847819 ATAAATATAACAAGTCTATAAGG + Intergenic
1079694793 11:23467731-23467753 CTCAATTAGACAAGTCTAGAAGG - Intergenic
1080053823 11:27884561-27884583 AGACATAGGACAAGTCCAGATGG - Intergenic
1080265613 11:30398295-30398317 TTAATGAGGACAAGTTTTGAGGG - Intronic
1080678969 11:34455777-34455799 TTAAATATGAAATGTGTAGATGG + Intronic
1080809411 11:35688122-35688144 TTAAATAGGCCAACTCAAAAAGG - Intronic
1081335447 11:41860063-41860085 TTAAATAGCTCAAGTTTACATGG - Intergenic
1083862057 11:65425957-65425979 TTAAATGAGCCAAGACTAGAGGG + Intergenic
1085792928 11:79511462-79511484 TAAAATGGGACAAGTTCAGAAGG - Intergenic
1090167655 11:124568186-124568208 ATGCATAGGAAAAGTCTAGAAGG + Intergenic
1092597591 12:10024261-10024283 CTAAATAGGACAAGTTGGGAAGG + Intergenic
1093069208 12:14690853-14690875 TTAAGTTTGCCAAGTCTAGAGGG + Intronic
1094759806 12:33518586-33518608 TTAAATAAGACAAATATAAATGG + Intergenic
1097673635 12:62572132-62572154 CTGAATAGCACAACTCTAGATGG - Intronic
1099098747 12:78409717-78409739 TAAAATAGGCCAAGTAAAGAGGG + Intergenic
1102132070 12:110539598-110539620 AGAAGTAGGAAAAGTCTAGATGG - Intronic
1102424130 12:112827501-112827523 TGAAATAGGACAAGGGTAGATGG + Intronic
1105771265 13:23614287-23614309 TTAATTAGTAAAAATCTAGATGG + Intronic
1106219397 13:27733204-27733226 TTAAATAGGACAAGTCTAGAAGG + Intergenic
1106404691 13:29463423-29463445 TTGAATAAGACACTTCTAGAAGG + Intronic
1106706750 13:32288842-32288864 TAAAATAGGCAAAGTGTAGAGGG + Intronic
1107313153 13:39101866-39101888 GTAAATTGAAAAAGTCTAGATGG + Intergenic
1107681315 13:42854527-42854549 TGAAATAAGACAAATCTAGAAGG + Intergenic
1108897264 13:55347879-55347901 TTACCTATGACAAGTCTAAACGG - Intergenic
1109628715 13:65014711-65014733 TTCAGTAGGTAAAGTCTAGAGGG - Intergenic
1110020914 13:70470831-70470853 TTTAATTGGACAACTCAAGAAGG - Intergenic
1111149480 13:84231103-84231125 TTAGAAAGGACAACTCTACATGG - Intergenic
1111161156 13:84396927-84396949 TTAAATAGGACGCCTCTAAATGG + Intergenic
1111190873 13:84804856-84804878 TGTAATAGAACAAATCTAGATGG - Intergenic
1112694438 13:101931923-101931945 TCAAATAGGACACTTCTAAAAGG + Intronic
1114033557 14:18598115-18598137 TTAAAAAGCTCAAGACTAGATGG + Intergenic
1114078347 14:19177311-19177333 TTAAAAAGCTCAAGACTAGATGG + Intergenic
1114125142 14:19717236-19717258 TTAAAAAGCTCAAGACTAGATGG - Intergenic
1115052102 14:29074996-29075018 TTAAATGGGGCAAGAGTAGAAGG + Intergenic
1120471193 14:84927174-84927196 TTAAAAGGGAGAAGTGTAGATGG + Intergenic
1124068245 15:26366325-26366347 TTAGAAAGAACAAGCCTAGATGG - Intergenic
1126278260 15:46911066-46911088 ATAAATAGGAAAAATATAGAAGG + Intergenic
1127098560 15:55537656-55537678 TAAAATAGGAAAACACTAGAAGG - Intergenic
1128823387 15:70683735-70683757 TTTAATGGGAAAAGACTAGAAGG + Intronic
1129092005 15:73160992-73161014 TATAATAAGACAAGTCTTGATGG - Intronic
1133699054 16:8292035-8292057 TTAGACAGGACAGGTCTGGAGGG - Intergenic
1136120359 16:28128938-28128960 CAAAATAGGACAAGTTCAGAGGG - Intronic
1136123020 16:28153120-28153142 TTCAATCTGGCAAGTCTAGAAGG + Intronic
1139019927 16:62736282-62736304 TTATATAGAACAAAACTAGAAGG + Intergenic
1140159794 16:72477043-72477065 TTAAATTTGACAAAGCTAGATGG - Intergenic
1140676936 16:77341388-77341410 TTAAATACCACAAGTTTAAAAGG + Intronic
1144154170 17:12482334-12482356 TTAAATAGTTCCAGTCCAGATGG + Intergenic
1144608097 17:16685673-16685695 TTAAATAGGACAAATGAAAAAGG + Intergenic
1146135994 17:30321558-30321580 AAAAATAGGACAGGTGTAGAAGG + Intronic
1146389175 17:32405512-32405534 TAAAACATGGCAAGTCTAGAGGG + Intergenic
1148045387 17:44740776-44740798 TAAAATAGGATAAGCCCAGAGGG + Intronic
1148177846 17:45583408-45583430 TTATAAAGGACAAGTCTTGCCGG + Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1155693825 18:28659858-28659880 TTAAATATGAAAAGTTTATAGGG - Intergenic
1156015169 18:32539216-32539238 TCAAATATGAAAAGTCAAGAAGG - Intergenic
1156092857 18:33492777-33492799 TTATATAGGACAGGTTAAGAAGG + Intergenic
1157139363 18:45090232-45090254 TAAAACAGAAAAAGTCTAGATGG - Intergenic
1157460669 18:47889884-47889906 TTAAACAGGACAAGAAAAGAGGG + Intronic
1159296224 18:66492795-66492817 TTAAAGATAACAAGTGTAGAAGG + Intergenic
1164831480 19:31324744-31324766 TTATGTAGGCCAAGTCCAGAGGG + Intronic
1166437675 19:42782881-42782903 TTATATATGATAAGTCTATATGG - Intronic
1166493489 19:43280600-43280622 TTATATATGATAAGTCTATATGG - Intergenic
925029374 2:637327-637349 ATAAATAGGACATATCTAGGTGG + Intergenic
929801949 2:45111909-45111931 ATAAATAGGAGAAGGCTAGGGGG + Intergenic
930573479 2:53115802-53115824 ATAACTTGGACAATTCTAGAAGG + Intergenic
931824191 2:65982607-65982629 TTAAAAAGGAAAAATCAAGAAGG - Intergenic
931875940 2:66512377-66512399 TTAAATATTTCAAGTCCAGAGGG - Intronic
935599312 2:104906487-104906509 TTAACCAGGACAATTCTAGAAGG - Intergenic
937603965 2:123774418-123774440 TTAAATAAAACAAGTATAGTAGG + Intergenic
940481924 2:154243797-154243819 TTAAAAATGTCAATTCTAGAAGG - Intronic
941784922 2:169487497-169487519 TAAAAAAGAACAAGTCTAGCTGG - Intronic
945189227 2:207168606-207168628 TTACATAGGAAAAGTCTCAATGG - Intergenic
946498854 2:220224441-220224463 TTAAAAAGGAAAAGAATAGAAGG + Intergenic
1168746069 20:242085-242107 TTAGAATGGACATGTCTAGAAGG + Intergenic
1168974102 20:1951276-1951298 TTAAATCTGTCTAGTCTAGATGG - Intergenic
1170203110 20:13766543-13766565 TGCATTAGGACAAGTCTAGAAGG + Intronic
1170724855 20:18917270-18917292 TTAAATAGCACAATTCTGGTGGG - Intergenic
1174217197 20:48925415-48925437 TTAAATAAGACAATTATAAAAGG - Intronic
1174313330 20:49676811-49676833 TTTAAAAGAACAAGTCTAAATGG + Intronic
1174856148 20:54047319-54047341 TTATATAGGACCAGCCCAGAGGG + Intronic
1180457673 22:15525174-15525196 TTAAAAAGCTCAAGACTAGATGG + Intergenic
956335951 3:68163912-68163934 TTAAACTGCAAAAGTCTAGATGG - Intronic
959248506 3:103907200-103907222 TTAAATATGAAAAGTTTAAATGG + Intergenic
960230239 3:115217590-115217612 TTATCTAGTACAAGTCTCGAGGG - Intergenic
966040209 3:175475593-175475615 TTAAATAGAATATGGCTAGATGG - Intronic
966213076 3:177472973-177472995 TTTAATAGGAAAAGTCTGGAAGG + Intergenic
966941538 3:184750965-184750987 TTACACAGGAAAAGTCGAGATGG + Intergenic
967157064 3:186702923-186702945 ATATCTAGGAAAAGTCTAGAAGG + Intergenic
970737205 4:19186649-19186671 TTAAAGATGAAAAGTGTAGAAGG + Intergenic
973184372 4:47307245-47307267 TTAAATAGGTAAATTCTGGAGGG - Intronic
973934986 4:55836077-55836099 TTAAATAGGAAAATTCTTGCAGG - Intergenic
975011784 4:69364305-69364327 TTAAATAAAAACAGTCTAGATGG - Intronic
975102974 4:70535473-70535495 TTAAAAAGGACACTTCTAGCAGG + Intergenic
977698871 4:99998799-99998821 TTGTATTGGAAAAGTCTAGATGG + Intergenic
979783109 4:124681090-124681112 TGATATAGGGTAAGTCTAGAAGG + Intronic
979935830 4:126693872-126693894 TTAAATAGAATAAACCTAGATGG + Intergenic
980436843 4:132786956-132786978 TTAAATAGGTAAAGCCTTGATGG - Intergenic
981518557 4:145636230-145636252 TAAAATAGGATAGGTCAAGAAGG + Intronic
981893197 4:149764175-149764197 TGAAATAAGACAAGGTTAGACGG - Intergenic
983917696 4:173310166-173310188 TCAAAGAGGATAACTCTAGAAGG - Intronic
984832798 4:183991397-183991419 GTAAATTGGATAAATCTAGATGG + Intronic
985123786 4:186670097-186670119 TAAAATAGGAAAATTCTAGGAGG - Intronic
985126034 4:186695493-186695515 TTAAAAAGGACAAATTTAAAAGG + Intronic
987228579 5:15869124-15869146 TTAAAATGGACAAGCCTAGAAGG + Intronic
990606967 5:57420461-57420483 TAATATAGGACAATTCTATATGG - Intergenic
990631716 5:57677611-57677633 TTAAATAGGACAAGTGAGGCTGG + Intergenic
993404191 5:87490640-87490662 TTAAAGAGGACAAGGATAAATGG - Intergenic
995223943 5:109683026-109683048 TTGAATAGGAAAGGTCTCGAAGG - Intergenic
995234380 5:109809834-109809856 TGAAATAGGATATGTGTAGATGG - Intronic
999590050 5:153135017-153135039 GGAAATAGGAAAAGTCTTGAGGG - Intergenic
1000673644 5:164093204-164093226 TGAAATAGGAGAAATATAGAGGG - Intergenic
1009287113 6:61832997-61833019 TTACATATGCCAAGTCCAGAAGG - Intronic
1010200432 6:73277169-73277191 TTAAAAAGAACAAGTCTGGTCGG + Intronic
1010340887 6:74751208-74751230 TTAAATTGGATGAGTCAAGAAGG + Intergenic
1010435747 6:75828248-75828270 TTAAAAAGCACAATTCAAGAGGG - Intronic
1011940882 6:92841746-92841768 TTATATAATACAAATCTAGATGG - Intergenic
1013718199 6:112989523-112989545 TTCAATAGGAGAAATATAGAGGG + Intergenic
1015462271 6:133505015-133505037 ATAAAGCTGACAAGTCTAGAAGG - Intronic
1015896709 6:138024897-138024919 GTGTACAGGACAAGTCTAGAAGG - Intergenic
1016261993 6:142182952-142182974 TGAAAAAGGACAAGTATAAAAGG + Intronic
1016935316 6:149445461-149445483 TCAAATAGGACCAGGGTAGAGGG + Intergenic
1018197065 6:161364507-161364529 GGAAATAGGAAAAGTCCAGAAGG + Intronic
1018288748 6:162268796-162268818 CAAACTAGGACAAGTCTACAGGG + Intronic
1018367224 6:163133197-163133219 TTTAATAGGCCAGGTCTGGAAGG + Intronic
1019953708 7:4394868-4394890 ATAAATAGGATAAGACCAGATGG + Intergenic
1021415639 7:20381026-20381048 TTAAATAGGAAAAGACAAAAGGG + Intronic
1024466937 7:49721446-49721468 TGTAATAGAACACGTCTAGAAGG - Intergenic
1024989456 7:55221491-55221513 ATAACTAGCACAATTCTAGAAGG - Intronic
1028254285 7:88574420-88574442 TTAAATATTCCAAGTTTAGAGGG + Intergenic
1028442229 7:90876881-90876903 TCAAATATGACAAGGCTAGTGGG + Intronic
1030413760 7:109213901-109213923 TTAAGTAGGACAGGCCAAGATGG - Intergenic
1031133341 7:117858731-117858753 TTCTATATGACCAGTCTAGAGGG + Intronic
1031946015 7:127841428-127841450 TTAAATAGGACAAGGCCACAGGG - Intronic
1032057389 7:128694622-128694644 TTTGATAGGACAATTCTATAAGG + Intergenic
1035944330 8:3943645-3943667 ATTAATAGGACAAGTCAACAGGG + Intronic
1037022945 8:13996627-13996649 TTACATAGTACAGGTCTAGAGGG + Intergenic
1037023031 8:13997762-13997784 TTAAATGTGAAAATTCTAGAGGG - Intergenic
1038597833 8:28905700-28905722 TTAAATAGGATAAGGCCAGCTGG - Intronic
1042618619 8:70677865-70677887 TTATATAGGAGAAGAATAGATGG - Intronic
1044330563 8:90915539-90915561 TTAAATAGGACTATTATATATGG + Intronic
1046364179 8:113204660-113204682 TAAAATAGGACACCTGTAGAGGG - Intronic
1048243435 8:132766995-132767017 CTAAATAGGAGAAGTTTTGATGG - Intergenic
1050061388 9:1713229-1713251 TAAAAAAGGAAAAGTCCAGATGG - Intergenic
1050647598 9:7738080-7738102 TTAAATATGAAAAGCTTAGATGG + Intergenic
1050914575 9:11115842-11115864 AGAAATAAGACAAGTTTAGAAGG - Intergenic
1058097037 9:100873786-100873808 TTAAATAGCACATATCTAGAAGG - Intergenic
1059637966 9:116189172-116189194 TGTAATAGAACAAATCTAGAGGG + Intronic
1060158929 9:121342014-121342036 TTAAATCGTACATGTATAGATGG - Intronic
1061790931 9:133058465-133058487 TTAATAAGGACAATTCCAGAGGG - Exonic
1186145956 X:6623940-6623962 TTTAATAGGACAAATTTTGATGG - Intergenic
1188528500 X:31112008-31112030 TTATATAGGACCAGACTTGAAGG + Intronic
1189666638 X:43362185-43362207 TGAAATAGGATAATTCAAGAAGG - Intergenic
1190000581 X:46682711-46682733 TTAAATCGGACCAGAATAGATGG - Intronic
1191731540 X:64341155-64341177 TTAAATAGTATAAGTATAAAAGG + Intronic
1191786576 X:64922885-64922907 TTAGACAGCACAACTCTAGAGGG + Intronic
1192338532 X:70241913-70241935 TTAAAGAGGACTTTTCTAGAGGG - Intergenic
1197517430 X:127451323-127451345 TTAAATCCAACAAGTCTAAAGGG - Intergenic