ID: 1106223795

View in Genome Browser
Species Human (GRCh38)
Location 13:27770135-27770157
Sequence TTGGGGACTTTGGACTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106223786_1106223795 14 Left 1106223786 13:27770098-27770120 CCATCTGTTCTCAGACCAAAGGC 0: 1
1: 0
2: 0
3: 29
4: 200
Right 1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 153
1106223787_1106223795 -1 Left 1106223787 13:27770113-27770135 CCAAAGGCCATCCAAAGATGTGT 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 153
1106223784_1106223795 15 Left 1106223784 13:27770097-27770119 CCCATCTGTTCTCAGACCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 153
1106223783_1106223795 16 Left 1106223783 13:27770096-27770118 CCCCATCTGTTCTCAGACCAAAG 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 153
1106223791_1106223795 -8 Left 1106223791 13:27770120-27770142 CCATCCAAAGATGTGTTGGGGAC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106223795 Original CRISPR TTGGGGACTTTGGACTTGTT GGG Intergenic
902259135 1:15210927-15210949 TTGGGGACTGTGATCTTGATGGG - Intronic
904833059 1:33317766-33317788 TTTTGGATTTTGGACTTTTTTGG + Intronic
905114725 1:35628041-35628063 TTGGTGACTTTGCACTTATTAGG + Intronic
905614795 1:39388410-39388432 GAGGGGACTCTGGATTTGTTAGG + Exonic
906287127 1:44594750-44594772 TTGGGGAATTTGGATTGGATTGG + Intronic
907906575 1:58787591-58787613 TTGAGCACTTTGGGCTTATTGGG + Intergenic
909756497 1:79232050-79232072 TTAGGAACCTTGGACTTGTCTGG + Intergenic
911131930 1:94397515-94397537 TTGGGGGTTATGGACTTTTTGGG + Intergenic
911702552 1:100971034-100971056 TTGGGGGCTTAGGACTTATCAGG - Intronic
912240039 1:107897013-107897035 TTGTGGACTGTGGATTTCTTTGG - Intronic
912923956 1:113896722-113896744 TTGGGGCCTTTGGCCCTATTGGG + Intronic
913261321 1:117000436-117000458 TTGGGGAGGTTGGAATTGTGTGG + Intergenic
915390309 1:155537119-155537141 TTAGGGAGTTTTGACTTCTTTGG - Intronic
915612136 1:157002500-157002522 TTGGGTAAGTTGGACTAGTTAGG - Intronic
917022305 1:170602391-170602413 TGTGGGACTTTGGACTTGAGCGG - Intergenic
917353117 1:174098641-174098663 CTTGTGACTTTGGACCTGTTGGG + Intergenic
920498830 1:206473599-206473621 GTGGGGAATTAGGCCTTGTTTGG + Intronic
921721030 1:218471394-218471416 CTGGGAAGTTTGGACTTTTTAGG - Intergenic
1062921010 10:1279801-1279823 TTGGGAACATGGAACTTGTTTGG + Intronic
1069038352 10:63669268-63669290 TGAGGGCCTTTGGACTTCTTCGG - Intergenic
1070829917 10:79411898-79411920 CTGGGGACGGTGGACTTGCTGGG - Intronic
1074388221 10:113034436-113034458 TTAGTGACTTTGGACATGATGGG + Intronic
1074948492 10:118304439-118304461 CTGGGGAGATTGGACTTGTGCGG - Exonic
1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG + Intronic
1075530958 10:123229383-123229405 TTGGGGATTTTGAATTTCTTTGG + Intergenic
1076504727 10:130964142-130964164 TGGGGGACTTGGAAGTTGTTAGG + Intergenic
1078109230 11:8378813-8378835 TTGGGTACTTGGGACTTTTTTGG - Intergenic
1081963379 11:47154584-47154606 TTGGGGAATCTGCACTTGTGAGG - Intronic
1083363511 11:62127866-62127888 TTGGGAACTGTGGACTTATGGGG + Intronic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1084318272 11:68358473-68358495 TTTTGGATTTTGGAATTGTTGGG + Intronic
1089172041 11:116518885-116518907 TTGGGGAGTTTGGGTTGGTTTGG - Intergenic
1090825426 11:130381820-130381842 TTTTGCATTTTGGACTTGTTTGG + Intergenic
1091435837 12:472228-472250 TTGCTGAGTTTGGACTTGGTAGG + Intronic
1093902110 12:24647561-24647583 TAGTGGACATTGTACTTGTTAGG - Intergenic
1094853589 12:34393150-34393172 TTGGGGACCATGGACTTCTGTGG + Intergenic
1101303701 12:103505861-103505883 GTGGGGACTGTGGCCTTGTGAGG + Intergenic
1102766896 12:115441238-115441260 TTCTGGACATTGGAATTGTTGGG + Intergenic
1103209720 12:119157390-119157412 ATGGGGACGTTTGACTTGGTGGG + Exonic
1104683704 12:130770533-130770555 GTGGGGCCTTTGGAGGTGTTTGG + Intergenic
1105804747 13:23946454-23946476 TTGGGGCCTTGGGACATCTTTGG + Intergenic
1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG + Intergenic
1106953661 13:34912143-34912165 TTAGGGCCTTTGGGGTTGTTGGG - Intergenic
1108524228 13:51272274-51272296 TTGGGGACTCTTGATTTGGTAGG - Intronic
1108575545 13:51787314-51787336 CTGGGGACCTTGGCCTTGCTTGG - Intronic
1113286711 13:108857533-108857555 TTGGGAACTTTGTCCTTGTCAGG + Intronic
1113449971 13:110402153-110402175 CTGTGGACTTTAGACTTTTTAGG - Intronic
1113455501 13:110445981-110446003 TTGGGGATCTTGTACTTTTTAGG - Intronic
1116898795 14:50342139-50342161 TTTGTGACTTTGGATTTGCTCGG - Exonic
1118226210 14:63901938-63901960 TTGGGGGTTTTGGTTTTGTTTGG - Intronic
1118909155 14:70046793-70046815 TTGGGGACAGAGGACATGTTGGG + Intronic
1121272574 14:92648140-92648162 CTGGGGTCTTGGGACCTGTTAGG - Intronic
1121360599 14:93254844-93254866 TTGGGGACTTACGATGTGTTAGG + Intronic
1122871058 14:104639272-104639294 TCAGGGACTTTGGAGGTGTTGGG + Intergenic
1202902858 14_GL000194v1_random:53264-53286 TTAGGGACTTGGGACATCTTTGG - Intergenic
1124861603 15:33447472-33447494 ATTGGGATTTTGGACTTCTTAGG + Intronic
1129750836 15:78062333-78062355 TTAGTGACTTTGAAGTTGTTTGG - Intronic
1131526120 15:93154017-93154039 CTGTGGACTTTGGACTTGACTGG - Intergenic
1136126370 16:28184999-28185021 TTGGGTTCTTTTGACTTTTTGGG - Intronic
1137302704 16:47168207-47168229 TTGGCTACTTTGGAATTCTTTGG + Intronic
1139163698 16:64540672-64540694 CTGTGGACTTTGGACTTCTGAGG + Intergenic
1141198138 16:81876964-81876986 TTCTGGCCCTTGGACTTGTTAGG + Intronic
1149935964 17:60806943-60806965 ATGTGGACTTAGGACTTGATGGG + Intronic
1150158215 17:62871718-62871740 CTGGGTACTTTGGACTTTTGAGG + Intergenic
1151088450 17:71407756-71407778 TTAGTGACTATGGTCTTGTTCGG - Intergenic
1151777627 17:76217547-76217569 TTGGGGACTGTTGATGTGTTTGG - Intronic
1156547261 18:37976831-37976853 TAGAGGAGTTAGGACTTGTTAGG + Intergenic
1157111654 18:44826357-44826379 TTGGTGGCTTTGTACCTGTTGGG + Intronic
1158097924 18:53795983-53796005 TTGTGGTCTATGGACTTTTTGGG - Intergenic
1159778999 18:72639589-72639611 TTTAGGGCTTTGGACTAGTTGGG + Intergenic
1159908217 18:74117919-74117941 TTGAGGAGTTAGGACCTGTTAGG - Intronic
1161235689 19:3196957-3196979 TTGGGGACCCAGGCCTTGTTGGG + Intronic
1164931444 19:32179086-32179108 TGGGGGACTTTGCTCTTTTTGGG - Intergenic
925975174 2:9137416-9137438 TTGAGGACTCCGGACATGTTGGG + Intergenic
926578295 2:14607157-14607179 TTTGGGATTTTGCACATGTTTGG - Intergenic
926778957 2:16449439-16449461 TTGGGAACTTTGAAATTATTGGG + Intergenic
928094720 2:28397025-28397047 TTGGTGAGTTTGGAATTCTTAGG + Intronic
928207989 2:29300792-29300814 TTGTTGACTTCTGACTTGTTGGG - Intronic
930260420 2:49140053-49140075 TAGGGAACTATGGATTTGTTAGG + Intronic
932180251 2:69640582-69640604 ATAGGGTCTTTGGACTTGGTAGG + Intronic
932202127 2:69839090-69839112 TTGCTGACTTGGGACTGGTTTGG + Intronic
937532201 2:122842885-122842907 GTTGGGACTTTGCACTTGCTGGG - Intergenic
941539306 2:166762238-166762260 TTGTGCACTTTGGACCTGCTTGG + Intergenic
946325511 2:218982793-218982815 TTGGGGACTCGGGACTAGCTGGG - Intronic
948483833 2:238267615-238267637 TTGGGGACTGAGGAACTGTTTGG + Intronic
1174227360 20:49012736-49012758 TTGAGCACTTAGTACTTGTTGGG + Intronic
1174250395 20:49215168-49215190 TTGGGGCTTTTGCACTTGCTGGG + Intergenic
1176622222 21:9068031-9068053 TTAGGGACTTGGGACATCTTTGG - Intergenic
1177412292 21:20745917-20745939 ATGGGGACTTTGTTCTTCTTTGG + Intergenic
1178402098 21:32295649-32295671 TCTGGGACTTTGGGCTAGTTGGG - Intronic
1180253512 21:46605989-46606011 TTGGGGACCATGGACATTTTTGG - Intergenic
1181808875 22:25391557-25391579 CCGGGGACTCTGGACTTGTTTGG - Intronic
1182263779 22:29095961-29095983 TCTGGGACTTGGGACTTGGTGGG - Intronic
952794863 3:37229934-37229956 ATGCAGACTTTGGCCTTGTTTGG - Intergenic
952919680 3:38276039-38276061 TTGGGGACCTTGGTCTTGGGTGG + Exonic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
954445586 3:50545122-50545144 TTGGGGACATTGGCAGTGTTTGG - Intergenic
954847602 3:53573386-53573408 CTGGGGCCTTTGTACTTGCTCGG + Intronic
956926776 3:73997678-73997700 GTGGGGTTTTTGGACTTGATAGG - Intergenic
958861091 3:99446005-99446027 TTGTGGACTTTGAACTTGCATGG + Intergenic
959751416 3:109840641-109840663 TTTTGGATTTTGGATTTGTTTGG + Intergenic
962029410 3:131583684-131583706 TTGGGGTCCTTGTACTTGTGAGG + Intronic
965944465 3:174223758-174223780 TTGGGGCCTTTGGACATACTTGG - Intronic
977932302 4:102761794-102761816 TTGGGTACTCTGGCATTGTTAGG - Intergenic
977977813 4:103287205-103287227 TGTGGGATTTTGGACTTGTATGG + Intergenic
981796936 4:148606004-148606026 TTTGGGATTTTAGACTTATTTGG + Intergenic
982966403 4:161913756-161913778 TGCGGGATTTTGGACTTGCTTGG + Intronic
983008237 4:162512358-162512380 CTGTGGACTTTGGCCATGTTTGG + Intergenic
984355714 4:178654767-178654789 TTCTGGATTTTGGACTTGTATGG + Intergenic
984544010 4:181077115-181077137 TTTTGGACTTTGGACATTTTTGG + Intergenic
984553628 4:181188573-181188595 TTGGGGAACTGGGCCTTGTTTGG - Intergenic
985795154 5:1956488-1956510 ATGGGGACTGTGGGGTTGTTTGG + Intergenic
987826231 5:23034266-23034288 TTCTGGACTTTGGACTTGCATGG - Intergenic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
988773864 5:34457876-34457898 CTGGGGGCTCTGGACTTGTCAGG + Intergenic
988980107 5:36559588-36559610 TTATGGATTTTGGACTTGCTTGG + Intergenic
990718874 5:58670441-58670463 TTGGTGATTTTGGACTTCCTGGG + Intronic
990935606 5:61145584-61145606 TTTGGGATTTTGGAATTTTTTGG - Intronic
992093197 5:73337966-73337988 TTGGGGGCTTTGGCCCTGGTTGG + Intergenic
993770948 5:91925494-91925516 CTGAAGACTTTGGACTTGTCAGG + Intergenic
996952675 5:129146859-129146881 TAGGGGTCTTTGGAATTGCTAGG + Intergenic
998183001 5:139958450-139958472 TTGAAGTCTTTGGAGTTGTTTGG + Intronic
999230016 5:150056258-150056280 TTGGGGACTTCGGGCTGGCTAGG - Exonic
999430208 5:151519362-151519384 CAGGGAATTTTGGACTTGTTTGG - Intronic
1000984068 5:167847962-167847984 TTGGGTAATTTGGACATATTTGG + Intronic
1003990255 6:11479823-11479845 TGGGGGATTTTAAACTTGTTGGG - Intergenic
1004987896 6:21103380-21103402 TTGGGGTCTTTAGTTTTGTTTGG + Intronic
1005581974 6:27243849-27243871 TTGGAGACTTTCTACCTGTTTGG + Intergenic
1006154047 6:32004572-32004594 CTGGGGACTTTGGACTTTGAGGG + Intergenic
1006160356 6:32037309-32037331 CTGGGGACTTTGGACTTTGAGGG + Intergenic
1010372729 6:75130527-75130549 ATGGGGACTTTGGAAATGTGAGG - Intronic
1010548397 6:77188189-77188211 TTAGAGACTTTTCACTTGTTTGG - Intergenic
1015319158 6:131852392-131852414 TTTTGGATTTTGGACTTTTTTGG + Intronic
1021116850 7:16754060-16754082 TTGGGGGCTTTGCACCTGCTTGG + Intronic
1026672404 7:72401680-72401702 TTTGGGAATTTGGAATTTTTTGG - Intronic
1028466693 7:91160371-91160393 TTGGGGACTGTGGACTTCCCTGG + Intronic
1031172027 7:118304037-118304059 CTGGGGACTTTGGAGGTATTAGG + Intergenic
1031543634 7:123026573-123026595 ATGGAGATTTTGAACTTGTTGGG - Intergenic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034069334 7:148167827-148167849 CTTGGGTCTTTGGACTTCTTAGG - Intronic
1039253209 8:35689531-35689553 TTGCAGATTTTGGACTTGCTGGG - Intronic
1041080382 8:54209817-54209839 TAAGGGATTTTGGACTTGGTTGG - Intergenic
1045807325 8:106178998-106179020 ATGTGTATTTTGGACTTGTTGGG + Intergenic
1048017813 8:130513158-130513180 TTGGGGATTTTGGTGTTTTTTGG + Intergenic
1051867430 9:21697007-21697029 TTGGGGGCTTCGGTTTTGTTTGG + Intergenic
1059292810 9:113242334-113242356 TTTTGGCCATTGGACTTGTTTGG + Intronic
1059374750 9:113873406-113873428 ATGGGGACTTTGCATTGGTTTGG - Intergenic
1060638648 9:125220337-125220359 TTGGGGATTTTGGACTGTCTTGG + Intronic
1185641303 X:1590013-1590035 TTGGGGACTTGTGACATATTTGG + Intergenic
1185943589 X:4349016-4349038 TTTGGGGATTAGGACTTGTTAGG - Intergenic
1189078905 X:37947968-37947990 TTTGGTACTTTGGTTTTGTTTGG - Intronic
1189485690 X:41429887-41429909 ATGGGGAGTTTGTACTTATTTGG - Intergenic
1192298936 X:69880437-69880459 CTGGGGACTTTCAACTAGTTAGG + Intronic
1193085456 X:77444956-77444978 TTGGCGACTTTGGGAATGTTGGG + Intergenic
1197057276 X:122135873-122135895 TTTTGGATTTTGGACTTGTATGG + Intergenic
1197912658 X:131501238-131501260 TTTGGGATTTTGGATTTCTTTGG - Intergenic
1199249899 X:145648733-145648755 TTGGGGACTTTGCACTTATTTGG + Intergenic
1199265926 X:145825072-145825094 TGGGGGACTTTGAAAATGTTTGG + Exonic
1202091471 Y:21195023-21195045 TTGTGGACTTTTGGTTTGTTGGG + Intergenic