ID: 1106223966

View in Genome Browser
Species Human (GRCh38)
Location 13:27771328-27771350
Sequence CAACCAGGTGGCACCAAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106223966_1106223971 10 Left 1106223966 13:27771328-27771350 CCGATCTTGGTGCCACCTGGTTG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1106223971 13:27771361-27771383 CCAATATTCTTGTAAGTCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 131
1106223966_1106223972 26 Left 1106223966 13:27771328-27771350 CCGATCTTGGTGCCACCTGGTTG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1106223972 13:27771377-27771399 TCTCAGGCCCAGCCACATTCTGG 0: 1
1: 0
2: 1
3: 17
4: 232
1106223966_1106223973 27 Left 1106223966 13:27771328-27771350 CCGATCTTGGTGCCACCTGGTTG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1106223973 13:27771378-27771400 CTCAGGCCCAGCCACATTCTGGG 0: 1
1: 0
2: 2
3: 33
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106223966 Original CRISPR CAACCAGGTGGCACCAAGAT CGG (reversed) Intergenic
900237394 1:1599296-1599318 CAGGCAGGTGGCGCAAAGATGGG + Exonic
901717516 1:11168432-11168454 GACACAGGTGGCACCAAGGTTGG + Intronic
904351224 1:29908087-29908109 CAGCCAAGTGGAACCAAGACAGG - Intergenic
910859628 1:91731227-91731249 CAACCAGGGGGTCCCAAGACTGG + Intronic
911594984 1:99789154-99789176 TAATCAGGTGGCACCAAGAAAGG - Intergenic
918065592 1:181099090-181099112 GAACCAGGTGGCAGCTAGAAAGG + Intergenic
918981917 1:191572304-191572326 CAACCAGGTGGTATCAAACTTGG + Intergenic
922665347 1:227464356-227464378 CAAGCAGATGGCAGCAAGAGAGG + Intergenic
923585420 1:235265554-235265576 CAAGCAGGTGCCACCATGCTTGG - Intronic
1063477762 10:6343792-6343814 CAACCAGATGGAACCAGGCTGGG - Intergenic
1070256156 10:74814424-74814446 CACCAAGGAGGCACAAAGATGGG - Intergenic
1076576716 10:131474403-131474425 CACCCAGGGGGCTCCAAGAGGGG + Intergenic
1077160830 11:1112127-1112149 CAGGCATGTGGCACCATGATTGG + Intergenic
1080224961 11:29950075-29950097 CAAGCAGGTGTGACCAAGCTGGG - Intergenic
1080514878 11:33011066-33011088 CTACCATTTGGCACCAAAATTGG + Intergenic
1081833495 11:46134760-46134782 CCACCAGAAGGCACCAACATGGG + Intergenic
1085659058 11:78345849-78345871 CTACCAGCTGACACAAAGATTGG + Intronic
1086020261 11:82219868-82219890 CAACCAAGTGGCAGAAAGACTGG - Intergenic
1086039497 11:82458740-82458762 CATCTGGGTGGCACCCAGATAGG + Intergenic
1089350585 11:117819599-117819621 CAAATAGGTGGCCCCAAGAGTGG + Intronic
1092208209 12:6629529-6629551 CAGGCAGGTGCCACCAAGCTCGG - Intronic
1106223966 13:27771328-27771350 CAACCAGGTGGCACCAAGATCGG - Intergenic
1107255719 13:38424820-38424842 TAACCAGGTGGCACCCAGGATGG + Intergenic
1109941117 13:69367044-69367066 CAACCAGCTGGCACCACCACAGG + Intergenic
1112616570 13:101013087-101013109 CAACTAGGTGGCAGGAAGCTAGG + Intergenic
1113810368 13:113138174-113138196 GAAACAGGTTGCACCAAGAATGG - Intronic
1114202100 14:20531159-20531181 CCACCAGATGGCGCCATGATTGG + Intergenic
1115987911 14:39121680-39121702 GAACAAGGTGGCAGCAAGGTTGG + Intronic
1116116237 14:40654554-40654576 GAACCATGTGGCACCAATTTGGG + Intergenic
1116317917 14:43421414-43421436 CAAACTGCTGGCACCAAAATTGG + Intergenic
1116727237 14:48575973-48575995 CAGCCAGGTGGCAGCAAGGCTGG - Intergenic
1117970332 14:61245277-61245299 CAATCAGGTAGCCCTAAGATAGG + Intronic
1121708831 14:96021562-96021584 CAACCAGGTGATGGCAAGATTGG + Intergenic
1124267074 15:28245923-28245945 CAACCATCTGGCACCAGGAAAGG - Exonic
1126725600 15:51628477-51628499 TAACCAAGTGGCAACAAGGTAGG - Intergenic
1130434528 15:83884415-83884437 CAAGCATGTGGCACCATGCTGGG + Intronic
1132572562 16:650356-650378 CAGAGAGGTGACACCAAGATGGG + Exonic
1135958921 16:26979681-26979703 CAAGCAGGTGGAGGCAAGATGGG - Intergenic
1137005985 16:35274710-35274732 GAACCGGGTGGCACCTAGAAGGG - Intergenic
1137765384 16:50973795-50973817 GAACCAGGTGGAAGCAAGAGTGG + Intergenic
1137782751 16:51111634-51111656 GAACCAGGTGTCACCAATTTTGG + Intergenic
1140805191 16:78526561-78526583 CAAACAGGTGTCCCCCAGATTGG + Intronic
1141249305 16:82340361-82340383 CACACTGGTGGCACCAAGAGTGG - Intergenic
1141664301 16:85458024-85458046 CAACCAGGGTGCACCAGGATGGG - Intergenic
1142866810 17:2796313-2796335 ACTCCAGGAGGCACCAAGATAGG - Intronic
1147254583 17:39174386-39174408 CACCCAGGTGGCACAGGGATGGG + Exonic
1148386108 17:47236342-47236364 CAACCAGATGCCACAAAGAAAGG - Intergenic
1154430955 18:14308108-14308130 CAACCAGGTTGAAACAAGGTAGG + Intergenic
1155398719 18:25415453-25415475 CAAGAAGGAGGTACCAAGATGGG - Intergenic
1155819917 18:30362174-30362196 CAACATGGTGGCACCCAGACAGG - Intergenic
1159069275 18:63605328-63605350 GAGCCAAGTGGCACCAAGAGAGG - Intergenic
1162166196 19:8754949-8754971 CCACCAGGAAGCACCAAGACTGG - Intergenic
1162167262 19:8762405-8762427 CCACCAGGAAGCACCAAGACTGG - Intergenic
1162168206 19:8768705-8768727 CCACCAGGAAGCACCAAGACTGG - Intergenic
1162169271 19:8776158-8776180 CCACCAGGAAGCACCAAGACTGG - Intergenic
1162169950 19:8781470-8781492 CCACCAGGAAGCACCAAGACTGG - Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1164063613 19:21695563-21695585 GAACCAGGTGGCCCCTAGAAGGG - Intergenic
1166365758 19:42277750-42277772 CAACCAGGTGGCCCCCAGCAAGG - Intronic
1166977289 19:46612101-46612123 CAACCAGGTGGCAGGAAAAGGGG - Intergenic
1167480611 19:49728471-49728493 AAACCAGCTGGAACCAAGACAGG + Intergenic
925072667 2:983478-983500 CATGCAGGAGGCACCAAGTTGGG - Intronic
931228154 2:60351713-60351735 GAAGCAGGTGGCACCAGAATGGG + Intergenic
931517122 2:63056469-63056491 CAAGCAAGTGGCACAAAAATGGG - Exonic
934785798 2:97004761-97004783 CAGCCAGGTGGCACCATGCCTGG + Intronic
937446446 2:121962709-121962731 CAGCCAGGTGGCACCAGGAGGGG - Intergenic
940312339 2:152291906-152291928 GAACCAGGTGGCACAAAGGGAGG + Intergenic
944945848 2:204684006-204684028 CAAACAAATGGCAGCAAGATGGG - Intronic
944994457 2:205278015-205278037 GAACCAGGTAGCACCATGCTTGG + Intronic
947690672 2:232133120-232133142 CAGCCAGGTAGCACCAATAAAGG + Intronic
1174840728 20:53899199-53899221 CCACCATGTGCCACCATGATGGG - Intergenic
1175126878 20:56759064-56759086 AAAGCAGGTGGCAGAAAGATTGG - Intergenic
1176020941 20:62962070-62962092 CAGCCAGGTTGCACCCAGAAGGG + Intronic
1178135870 21:29626545-29626567 CATCAAGGTGTCACCAAGTTTGG - Intronic
1178274926 21:31228537-31228559 CATCCAGGTGCCACCAATAGGGG + Intronic
1178593462 21:33931703-33931725 CAACCAGGTGCCTCCAAAATGGG - Intergenic
1181271560 22:21661583-21661605 CAACCATGTGGCTGCAAGACAGG + Intronic
1183325958 22:37194426-37194448 CAACCAGTTTGCACCAAGAGAGG + Intronic
1184076850 22:42185597-42185619 CAACTACGTGGCAGCTAGATGGG + Intronic
949703335 3:6784958-6784980 CAATCATGGGGCAGCAAGATGGG - Intronic
950524490 3:13516089-13516111 GAAGCAGCTGGCACCAAGGTGGG + Intergenic
954139748 3:48598755-48598777 CAGCCAGCTGGTCCCAAGATTGG - Intergenic
954745015 3:52782814-52782836 CAACCAGGTGGCCCCGAGACAGG - Intronic
955820337 3:62889768-62889790 CAAGCAGGTGGTATCATGATAGG - Intergenic
958847013 3:99277395-99277417 AAACCAGGTGTCAACAAGCTGGG - Intergenic
962943508 3:140146972-140146994 CAACCAGCTGGCACCATGAAAGG + Intronic
963882066 3:150539260-150539282 CAACCAGAGGTCACCAAGCTTGG + Intergenic
966148164 3:176835343-176835365 CAAGCAGGTGACACCAGGAAGGG + Intergenic
966993498 3:185257337-185257359 CAACCAGTTTGCACAAAGAGGGG + Intronic
967933516 3:194707963-194707985 CAAGCACGTGCCACCAAGCTCGG + Intergenic
968814966 4:2817545-2817567 AAACAAGCTGCCACCAAGATGGG - Intronic
969725545 4:8916110-8916132 CAGCAAGGTGGCATGAAGATTGG - Intergenic
971234917 4:24832321-24832343 TAGCAAGGTGGCACAAAGATAGG + Intronic
994152101 5:96459375-96459397 CAACCATGTGGCACAAAGTTAGG + Intergenic
996658321 5:125967997-125968019 CAATTAGGTGGCACCAACCTAGG - Intergenic
997079917 5:130726059-130726081 GAAACAGCTGGTACCAAGATGGG + Intergenic
997624326 5:135321310-135321332 CAGCCAGCTGGCAGCAAGAGGGG - Intronic
1002088871 5:176792949-176792971 CGAACAGGTGGCAGCAAGATTGG - Intergenic
1005407040 6:25500467-25500489 CAGCCAGCAGGCACCAAGAATGG - Intronic
1016429637 6:143969248-143969270 GCTCCAGGTGGCACCAAGATTGG - Intronic
1016678916 6:146805289-146805311 CATCAAGGTGTCACCAAGGTGGG - Intronic
1017412413 6:154182790-154182812 CAACCATGTGGATCCATGATGGG + Intronic
1019255350 7:46340-46362 CAACCAGGTGGCACCTGAGTCGG - Intergenic
1032536995 7:132672587-132672609 TGACCAGATGGCACCAAGAAGGG + Intronic
1036712599 8:11091077-11091099 CCAGCAGGTGGCACCAGGAATGG + Intronic
1038521140 8:28233132-28233154 CAACTTGTTGGCACCAAGCTGGG + Intergenic
1039945316 8:42123743-42123765 CAACCAGGTGTCATCAACCTTGG + Intergenic
1040071589 8:43193002-43193024 CACCCCGGTGCCCCCAAGATTGG - Intronic
1041027623 8:53703368-53703390 CAAACAGGCGGCCCCAAGAAGGG - Intergenic
1043418945 8:80079389-80079411 CTACCAGGTGCAACCAAGAGAGG + Intronic
1045192935 8:99900974-99900996 TAACCAGGTGACACCAAAATAGG - Intergenic
1056571924 9:87824454-87824476 CATCCAGGTGGCCCCATGCTCGG + Intergenic
1060966678 9:127715692-127715714 CAAACAGTTGGCAACACGATTGG - Exonic
1185713335 X:2321641-2321663 CATCCAGGTGGCACCATGGTTGG - Intronic
1186795003 X:13038462-13038484 AAAAGAGGTGGCAACAAGATGGG - Exonic
1191070382 X:56394449-56394471 CAGCAAGGTGGCAGCAAGGTTGG - Intergenic
1193738092 X:85185087-85185109 CAACAAGGTGGTACCACTATGGG - Intergenic
1198847619 X:140929547-140929569 CTTCCAGGTGGCACATAGATTGG + Intergenic
1199970012 X:152852765-152852787 CTTCCAGCTGGCACCAGGATGGG - Intronic