ID: 1106224150

View in Genome Browser
Species Human (GRCh38)
Location 13:27772595-27772617
Sequence CAGGCAAATCCATTTTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106224150_1106224157 10 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224157 13:27772628-27772650 GACGTCACCGACCTGGTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1106224150_1106224158 11 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224158 13:27772629-27772651 ACGTCACCGACCTGGTGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1106224150_1106224156 9 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224156 13:27772627-27772649 GGACGTCACCGACCTGGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 63
1106224150_1106224161 23 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224161 13:27772641-27772663 TGGTGCAGGGGTCACCGACCAGG 0: 1
1: 0
2: 1
3: 3
4: 96
1106224150_1106224162 24 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224162 13:27772642-27772664 GGTGCAGGGGTCACCGACCAGGG 0: 1
1: 0
2: 1
3: 5
4: 123
1106224150_1106224155 3 Left 1106224150 13:27772595-27772617 CCACCCTAAAATGGATTTGCCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1106224155 13:27772621-27772643 GTCTCAGGACGTCACCGACCTGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106224150 Original CRISPR CAGGCAAATCCATTTTAGGG TGG (reversed) Intergenic
907129545 1:52083613-52083635 CAGGCAAATCCAAATTAAGATGG - Intronic
910965704 1:92806051-92806073 TAGGAAAATCCATTAGAGGGGGG + Intergenic
911706593 1:101020849-101020871 TAGGTAAATGGATTTTAGGGAGG - Intronic
912893315 1:113558337-113558359 CAGCCAAAGCCATTTTAGAGAGG + Intronic
914762856 1:150612976-150612998 CAGATAAAACCATTTGAGGGGGG + Intronic
918585776 1:186186730-186186752 CAGGCAAATTGACTTTAGAGAGG + Intronic
921796376 1:219349234-219349256 CAGAGAAATCCTTTTTAGGATGG + Intergenic
1065410151 10:25417271-25417293 CAGGCAAATCAATTCTGTGGGGG + Intronic
1068774620 10:60856618-60856640 GAGGCACAGCCATTTTAGGAGGG - Intergenic
1069731994 10:70622962-70622984 GAGGCAAATTGATTTTTGGGTGG + Intergenic
1073873025 10:107888003-107888025 CTGCCAAATATATTTTAGGGTGG - Intergenic
1075004583 10:118820727-118820749 CAGGCAAATACACTTCTGGGTGG + Intergenic
1075921335 10:126215639-126215661 CAGGCACATCCATTGGAAGGTGG + Intronic
1077531191 11:3096045-3096067 CAGGAAAATCCATGCTAGAGGGG + Intronic
1082268227 11:50142607-50142629 AAGAAAAATCCATTTTTGGGGGG + Intergenic
1082287849 11:50335908-50335930 AAGAAAAATCCATTTTTGGGGGG - Intergenic
1083918909 11:65769744-65769766 CATGCAAAACCATTTTGGGTGGG - Intergenic
1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG + Intronic
1085847385 11:80081926-80081948 CAGGAAAATCCACTCTAGTGTGG + Intergenic
1087413149 11:97817944-97817966 CACTCAAATGCATTTTTGGGGGG - Intergenic
1088372810 11:109110202-109110224 CATACACATCCATTTTAGAGAGG + Intergenic
1090667744 11:128925988-128926010 CAGACAAAACCCTTTCAGGGTGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1094248138 12:28326818-28326840 CAGAGAAACCCATTTTGGGGGGG - Intronic
1094713864 12:32992103-32992125 CATAAAAATACATTTTAGGGTGG + Intergenic
1097294427 12:57947298-57947320 CAAGCTAAACCATTTTAGGTGGG + Intronic
1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG + Intergenic
1098128308 12:67322736-67322758 CAGGGAGCTCCATTTCAGGGAGG - Intergenic
1098308426 12:69124289-69124311 TAGGCCAAACCATTTTAGGTTGG - Intergenic
1099813561 12:87617572-87617594 GAGGCACACCCATATTAGGGAGG + Intergenic
1101987076 12:109455722-109455744 CAGGCAAATTCAATTAAGGGGGG + Intronic
1102242579 12:111334374-111334396 CAGACACATCCACTTTCGGGAGG - Intronic
1104665962 12:130647501-130647523 CAGGTGAATCCATTTTGGTGGGG - Intronic
1105551453 13:21400096-21400118 AAGACATATTCATTTTAGGGAGG - Intronic
1106224150 13:27772595-27772617 CAGGCAAATCCATTTTAGGGTGG - Intergenic
1107704133 13:43082260-43082282 CAGCCAGATGCATTCTAGGGAGG + Intronic
1110463045 13:75767863-75767885 GAAGCAAATCCATTACAGGGAGG - Intronic
1111026048 13:82526065-82526087 AAGGCAAACCCAATTTAAGGTGG + Intergenic
1111236324 13:85413212-85413234 CAAGTAAATGTATTTTAGGGGGG + Intergenic
1111755784 13:92393804-92393826 CAGGCAAACACATTTCATGGGGG - Intronic
1112653201 13:101420386-101420408 CATGTAAATCCATGTTAGTGAGG - Intergenic
1116234885 14:42267218-42267240 CAAGCAACTCCATTTTAGTGTGG + Intergenic
1117180494 14:53186333-53186355 GAGGCAAATTCAATTTGGGGAGG + Intergenic
1133839824 16:9397597-9397619 CATCCAAATACATTTTAGAGGGG - Intergenic
1134304406 16:13019351-13019373 CCGGCAGATCCATTTTCTGGTGG + Intronic
1139442620 16:66976265-66976287 CTGGGAAGTCCATTTTGGGGAGG + Intergenic
1140834477 16:78780611-78780633 CAGGGAAGACCATTTTAAGGAGG + Intronic
1143302230 17:5919101-5919123 CATGCAAACCTATTTGAGGGGGG - Intronic
1144046895 17:11462055-11462077 CAGGCAAAGCCATATAAGAGGGG + Intronic
1144321469 17:14125528-14125550 GAGGCAAATACATTTGAGAGAGG + Intronic
1145990006 17:29073671-29073693 CAGGGATAACCTTTTTAGGGTGG + Exonic
1146625220 17:34430282-34430304 ATGGCAAGTCCATTTTTGGGGGG - Intergenic
1146934335 17:36802505-36802527 CAGGGAAACCCATGTTACGGGGG - Intergenic
1147867797 17:43564996-43565018 CAGGGAAACCCATCTTGGGGTGG - Intronic
1150194635 17:63283543-63283565 CAGACAGATCAATTTGAGGGGGG + Intronic
1158808525 18:61003693-61003715 CAGGCAAATCAAATTTTGGAAGG - Intergenic
1168589886 19:57624511-57624533 CAGGCAAACCCAAATAAGGGAGG + Intergenic
931245145 2:60486126-60486148 CAGTCAAATCCATTTCAGAATGG - Intronic
932414303 2:71564523-71564545 CAGGCAGGTCCCTTATAGGGAGG + Intronic
933556167 2:83833643-83833665 CAGTAAAATGCATTTTAAGGGGG + Intergenic
934208194 2:89951472-89951494 CAGCCATATCCATTTTGGTGTGG + Intergenic
937916919 2:127103766-127103788 TAGGCAAAGCCAGTGTAGGGTGG - Intronic
938171641 2:129082713-129082735 ACAGCAAATCCATTTTAGGGAGG - Intergenic
940653287 2:156458503-156458525 AAGGCAAATTCATTTTAGTTAGG + Intronic
943506001 2:188758442-188758464 CATGGAAATCCATTGTAGTGTGG + Intronic
948730246 2:239958639-239958661 CAGGCAACTCCATTTTGCTGAGG + Exonic
1169890665 20:10448538-10448560 CATGCAAATCCATGTAAGAGTGG + Intronic
1172952168 20:38729118-38729140 CTGGGAAATCCATTTTGGGTGGG + Exonic
1177493363 21:21857000-21857022 CAGGTAAATGCATGTTATGGGGG - Intergenic
1178293153 21:31386714-31386736 CAGGTACATACATCTTAGGGAGG + Intronic
1182717256 22:32367474-32367496 CAGGCATATTCACTTTAGGTGGG - Intronic
951912741 3:27768554-27768576 CTGGCAAAGCCACTTAAGGGGGG - Intergenic
953627215 3:44580884-44580906 CAGGCAAAACCCATTTATGGCGG - Intronic
955826828 3:62956359-62956381 CATGCAAATCAATTACAGGGAGG + Intergenic
956037790 3:65114065-65114087 CAGGTTAATACATTTTTGGGGGG + Intergenic
957401272 3:79717385-79717407 CAGACAATTGCATTTTAGGTTGG + Intronic
958630008 3:96672325-96672347 CATGCAAATTCATTTCAGAGAGG + Intergenic
960206479 3:114906748-114906770 CAGGATAATACATTTTAGGTAGG + Intronic
963136326 3:141908657-141908679 TAAGCAAGTCCATTTGAGGGAGG - Intronic
963961129 3:151310373-151310395 CAGGCAAAGCCATTTTACAGAGG - Intronic
964953220 3:162323292-162323314 TAGGCAAATTCATTTCAGAGAGG - Intergenic
965921626 3:173923388-173923410 CTGGCCAATTCATTTTAGGGTGG - Intronic
972100169 4:35405999-35406021 CAGAAAAATTCATTATAGGGTGG - Intergenic
979044897 4:115851273-115851295 CAGGGAACTCCATCTCAGGGAGG - Intergenic
979395966 4:120189523-120189545 CTGGCAAATTCAATTTTGGGAGG + Intergenic
979772423 4:124544498-124544520 CTGGCAACTCCATTTTCTGGAGG - Intergenic
981393337 4:144217412-144217434 AAGGAAAACCCATTTTTGGGGGG - Intergenic
984326363 4:178257366-178257388 AAAGCAATTCCATTTTAGGAAGG + Intergenic
985354175 4:189099464-189099486 CAAGCGACTCCATTTAAGGGTGG + Intergenic
989094665 5:37770749-37770771 CTGGCAAATTCATTGTAGTGAGG - Intergenic
990171398 5:53053737-53053759 CAGGCAATTACATTCTAGGAGGG - Intronic
990654609 5:57941363-57941385 CAGAAAAATTCATTTTAGTGGGG + Intergenic
995407868 5:111822088-111822110 CAGGCAAATTCCATTTAGTGTGG + Intronic
1000840849 5:166216310-166216332 CAGTCAAATTAATTCTAGGGGGG + Intergenic
1002088867 5:176792920-176792942 CAGGAAAATCCATCTTGCGGAGG - Intergenic
1002471558 5:179438792-179438814 CGGGCAAATACATTCTAAGGCGG + Intergenic
1003044592 6:2721663-2721685 GAGGCAAAACCACTTTAGGTTGG - Intronic
1007335222 6:41150709-41150731 CAGGCAAATCCATTTGTAGGGGG + Intronic
1011637321 6:89386278-89386300 CAGGCAGATACATTTTAGGAAGG - Intronic
1015176292 6:130312704-130312726 AAGGCAATGCCATTTTAGGCTGG - Intronic
1017191616 6:151660018-151660040 CAGACATATCTATTTTAAGGTGG - Intronic
1017461413 6:154654615-154654637 CAGGCAAATGCATTTAAGGCTGG - Intergenic
1022994178 7:35737535-35737557 CAGGCAAAACTAATTTATGGTGG + Intergenic
1027676451 7:81164174-81164196 TAGGGAAATCCATATTAGAGAGG + Intergenic
1032154532 7:129456991-129457013 CAAGCAAATCCATTTTTCTGGGG + Intronic
1034408942 7:150927636-150927658 AAGGCAAATCCATGGGAGGGCGG - Intergenic
1034835942 7:154351675-154351697 CAGTCAAAGCCATTTTAAGGAGG + Intronic
1039016440 8:33154760-33154782 CAGGCACATTCATTTTTGAGTGG - Intergenic
1039304474 8:36246753-36246775 CAGGCACATAGATGTTAGGGAGG - Intergenic
1039973641 8:42341345-42341367 CAGGCAAACACAGTTTATGGAGG - Intronic
1047125065 8:121950948-121950970 GAGGCAAATCCTCTTTAGGGGGG - Intergenic
1047825010 8:128563760-128563782 CAGGTAAATGGATTTTAGAGGGG - Intergenic
1050518707 9:6474023-6474045 CAGGCAAAACTGTTTTAGGGAGG + Intronic
1053422671 9:37989592-37989614 CCGGCAACTCCATTTAAGTGGGG + Intronic
1055004613 9:71491349-71491371 AAGACAAATCCATTTCATGGAGG - Intergenic
1055503906 9:76929107-76929129 CTGGAAAATCCATTCTAGGCTGG + Intergenic
1056586234 9:87929167-87929189 AAGGCAAGTCCATTTTCAGGGGG + Intergenic
1056610648 9:88123776-88123798 AAGGCAAGTCCATTTTCAGGGGG - Intergenic
1056757690 9:89392173-89392195 CTCCCAAATCCATTTTTGGGGGG + Intronic
1058217404 9:102252538-102252560 CACGCAATTCCATTATTGGGAGG - Intergenic
1059202860 9:112434209-112434231 CAGGAAAGTCCACTTTTGGGTGG + Intronic
1061600140 9:131663621-131663643 CAGGCAGATCCAACTTACGGGGG - Intronic
1185893581 X:3840454-3840476 AAGAAAAATCCATTTTTGGGGGG + Intronic
1185898696 X:3878878-3878900 AAGAAAAATCCATTTTTGGGGGG + Intergenic
1185903813 X:3917307-3917329 AAGAAAAATCCATTTTTGGGGGG + Intergenic
1186588497 X:10902501-10902523 CAGCCAAATCCATCTTACAGAGG - Intergenic
1186861442 X:13676160-13676182 CAGGCAAAACAATTTGAGAGTGG + Intronic
1190604567 X:52127236-52127258 CAGGCAAAATCATTTTATAGAGG - Intergenic
1192507392 X:71697163-71697185 CAGACAAATCCAGCTGAGGGGGG - Intergenic
1192508143 X:71703125-71703147 CAGACAAATCCAGCTGAGGGGGG - Intergenic
1192518553 X:71778428-71778450 CAGACAAATCCAGCTGAGGGGGG + Intergenic
1192519304 X:71784389-71784411 CAGACAAATCCAGCTGAGGGGGG + Intergenic
1193620525 X:83748139-83748161 CTGGAAAATTCATTTTAGGCAGG + Intergenic
1194405013 X:93485981-93486003 CAGGCTAATGCATTTTAAGGGGG + Intergenic
1195046034 X:101055419-101055441 CAGGCAAATTCATTTAAAGCAGG + Intergenic
1199121331 X:144057676-144057698 CAGGTAAGTCCATTTTGAGGTGG - Intergenic