ID: 1106224745

View in Genome Browser
Species Human (GRCh38)
Location 13:27776351-27776373
Sequence CCCAAATAGAAGTCTAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106224743_1106224745 14 Left 1106224743 13:27776314-27776336 CCTTTGCAGGAAATGTGGCTTAT 0: 1
1: 0
2: 2
3: 27
4: 231
Right 1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1106224739_1106224745 28 Left 1106224739 13:27776300-27776322 CCTTTGTCCGGCGGCCTTTGCAG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1106224738_1106224745 29 Left 1106224738 13:27776299-27776321 CCCTTTGTCCGGCGGCCTTTGCA 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1106224741_1106224745 21 Left 1106224741 13:27776307-27776329 CCGGCGGCCTTTGCAGGAAATGT 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106224745 Original CRISPR CCCAAATAGAAGTCTAGACT AGG Intergenic
900517625 1:3090524-3090546 CCCAAATGGAAGCAAAGACTGGG + Intronic
903616372 1:24661792-24661814 CCCTATTAAAAATCTAGACTGGG + Intronic
905985622 1:42278512-42278534 CCCAAATACAACTCTGGACCAGG - Exonic
907406224 1:54255130-54255152 CCGCAATAGAAATCTACACTGGG - Intronic
908133671 1:61103956-61103978 CTCAAATAAAAGTCAAGACCAGG - Intronic
908744325 1:67360934-67360956 TCCACATAGAAGGCCAGACTAGG - Intronic
910655488 1:89614210-89614232 GCCAATTAGAAGTCCAGACGGGG - Intergenic
912824070 1:112889383-112889405 CACAAACAGAAGTCATGACTTGG + Intergenic
912869779 1:113293592-113293614 CCCAACTAGAAATCTAGCCCTGG + Intergenic
915476819 1:156157820-156157842 CCCAAGTTTAAATCTAGACTTGG - Intronic
916195747 1:162220537-162220559 CCCAAATTGCAATCTGGACTTGG + Intronic
916866386 1:168864009-168864031 CCCCAATAAAACTCTAGTCTTGG + Intergenic
920030825 1:203036501-203036523 CCAAAAGAGAAGACTAGGCTAGG - Intronic
922525122 1:226296001-226296023 CCAAAATACAATTCTATACTTGG + Intronic
922922777 1:229320741-229320763 CTCAAAAAGAAGTATAGAGTTGG - Intergenic
1065735294 10:28745876-28745898 CCCAAAGAGAGGTCTGGCCTTGG + Intergenic
1068155345 10:53190003-53190025 CCCACATAGAACTCTAGAGATGG - Intergenic
1072012877 10:91319431-91319453 CCCAAACAGAACTCCAGCCTGGG - Intergenic
1072667704 10:97406345-97406367 CACAACCAGAGGTCTAGACTTGG + Intronic
1074169168 10:110916323-110916345 ATCAAATATAAGTCTAGGCTAGG + Intronic
1074411175 10:113230150-113230172 CCCACCTGGAAGTCTGGACTTGG + Intergenic
1077619454 11:3707450-3707472 ACCAAAAAAAATTCTAGACTGGG + Intronic
1086878640 11:92128399-92128421 AGCAAATACAAGTCTAGACCAGG - Intergenic
1088503381 11:110506690-110506712 CCCAAATGGAAGTCTTTGCTAGG + Intergenic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1089548580 11:119251055-119251077 CCCAAATTAAATTTTAGACTGGG - Intronic
1093671277 12:21878927-21878949 CCCAACTAGATGTCTGAACTTGG + Intronic
1098802129 12:74974503-74974525 CCAAAATAATAGTATAGACTTGG + Intergenic
1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG + Intergenic
1107831980 13:44382660-44382682 CACTGATAAAAGTCTAGACTTGG + Intronic
1110594530 13:77305023-77305045 CACAAAGAAAACTCTAGACTCGG + Intronic
1111100355 13:83576284-83576306 CCCACATAGAAATGTAGAGTAGG - Intergenic
1112745307 13:102520907-102520929 TCCAAATGTAACTCTAGACTTGG - Intergenic
1115170433 14:30498801-30498823 ACCCCAGAGAAGTCTAGACTTGG + Intergenic
1116249034 14:42457386-42457408 GCCAAATAGAAGTGTTGAATGGG - Intergenic
1117899178 14:60515264-60515286 CCCAAAGAGAAGCCCAGACTGGG + Intronic
1121896581 14:97653856-97653878 CCCAAATAGGAGTCAAAAATAGG + Intergenic
1121952027 14:98179522-98179544 GCTAAACAGAAGTCTAGATTTGG - Intergenic
1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG + Intergenic
1125283753 15:38071201-38071223 ACCAAATAGAAGTCTAAACCAGG + Intergenic
1135512632 16:23100437-23100459 TTTATATAGAAGTCTAGACTAGG + Intronic
1137759709 16:50930533-50930555 CTAAAATTGGAGTCTAGACTGGG - Intergenic
1140164912 16:72541011-72541033 TAAAAATAGAAGTTTAGACTGGG - Intergenic
1140752050 16:78033716-78033738 ACCAAAGAGAAGTCTAGGTTAGG - Intronic
1146494545 17:33309714-33309736 CCACAATAGAAGTCTACACAAGG - Intronic
1150512025 17:65764120-65764142 CCCATATAGAAGGCTAGAGTTGG + Intronic
1151078722 17:71304111-71304133 CCCAATTAAAAATATAGACTGGG - Intergenic
1152299736 17:79488179-79488201 TCCAAATAGAAGGCCACACTTGG + Intronic
1154272099 18:12929257-12929279 CCCAAATGGAAGTCCTGGCTGGG - Intronic
1155649429 18:28122586-28122608 GACTAATAGAATTCTAGACTTGG - Intronic
927278767 2:21285179-21285201 TCCAAACAGCAGTCTACACTTGG + Intergenic
928544537 2:32317076-32317098 ACCAAATAAAAAACTAGACTAGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
937365179 2:121256347-121256369 TCCAAATAAAAGTCTCGTCTGGG - Intronic
940350609 2:152682610-152682632 CCAAAACAGAAGTCAAAACTAGG - Intronic
941407247 2:165105701-165105723 CAGAAATGGAAGTCCAGACTGGG + Intronic
942504354 2:176626082-176626104 TCCAAATAGATGGATAGACTAGG - Intergenic
943022442 2:182591486-182591508 ACCAAATAGCATTCTAGACCTGG + Intergenic
943456514 2:188114638-188114660 GACAAATAGAAATCTAGGCTTGG + Intergenic
1168917616 20:1504095-1504117 CCCAAAGAGAAGTCAGGAGTTGG + Intergenic
1170486201 20:16818464-16818486 CCAGAAAAGAAGTCTATACTAGG + Intergenic
1182549489 22:31093260-31093282 CCCAAATAGAAACCTATTCTGGG - Intronic
954825971 3:53373721-53373743 ACCAAAGGGAAGTCCAGACTTGG - Intergenic
958881723 3:99679788-99679810 CCCAAATAGAAATTCTGACTTGG - Intronic
960433442 3:117598006-117598028 CCTAAGTGGAAGTCTAGATTTGG - Intergenic
960696400 3:120400891-120400913 CCCACATAGAGTTCTGGACTTGG + Intronic
970803918 4:20007532-20007554 CCCCAATAGAAATCCAGATTTGG - Intergenic
971641602 4:29140263-29140285 ATCAAATGGAGGTCTAGACTTGG + Intergenic
973621924 4:52735413-52735435 CACAAGTTGAAGACTAGACTGGG + Intronic
974488865 4:62538025-62538047 TCCATGTAGAAGTCTAGAGTGGG - Intergenic
977949292 4:102951609-102951631 CCCAAACAGCAGTCTAGACATGG + Intronic
978657978 4:111088997-111089019 CCCATGTAGAAGACTAGAGTAGG - Intergenic
980918410 4:139056517-139056539 TCAAAAAAAAAGTCTAGACTTGG - Intronic
996087671 5:119321214-119321236 CTCAAAAAAAAGACTAGACTTGG + Intronic
999033729 5:148322925-148322947 CTGAAATTGAAGTCTAGATTTGG + Intronic
999479167 5:151929617-151929639 ACCAAGTACAAGTATAGACTTGG - Intergenic
999534776 5:152504409-152504431 CCCAAGCAGAAGTCTCCACTGGG - Intergenic
1002344360 5:178537199-178537221 CCCTAAGAGAAGTCTAGAGATGG - Intronic
1003243509 6:4365108-4365130 CCTAAATGGAAGACAAGACTGGG - Intergenic
1006870314 6:37245450-37245472 CCCGATTCGAAGTCTAGAGTGGG + Intronic
1009960481 6:70514985-70515007 CCCATACAGAAGGCTAGAGTTGG - Intronic
1012259576 6:97072055-97072077 CCCAAGCCGAAGTGTAGACTAGG - Intronic
1012449367 6:99338940-99338962 CCCAATCCGAAGTCTGGACTCGG + Intronic
1013188871 6:107785162-107785184 CCCAAATACAACTCTGGACCGGG - Intronic
1013234268 6:108183197-108183219 CCCATTAAGAAGTATAGACTGGG + Intronic
1013420698 6:109964064-109964086 CCCAAATTGGAGCCTAGCCTGGG - Intergenic
1014027777 6:116669238-116669260 GGCAAATAGCAGTCTACACTAGG + Intergenic
1014972729 6:127837551-127837573 CACAAATAGAAATTTAGGCTGGG - Intronic
1015314659 6:131805130-131805152 CCCAATTGGAAGTCTAAAATCGG - Intergenic
1020073551 7:5243083-5243105 CCCAAATAGAAGACTCTCCTGGG + Intergenic
1020101804 7:5397955-5397977 CCCAAATAGAAGTATGTCCTGGG - Intronic
1021350911 7:19593325-19593347 TCAAATTAGAAGTCAAGACTAGG - Intergenic
1023007003 7:35881672-35881694 CCAAAATATAAGTATAGACAGGG + Intronic
1025476683 7:60931088-60931110 CCCAAATAGAATTATTGAATGGG - Intergenic
1030652728 7:112132800-112132822 CCCAAGTAGAAGTTTAAACCAGG - Intronic
1030923633 7:115423550-115423572 CCCAAATAGAAGTTTAAATATGG - Intergenic
1035851460 8:2923060-2923082 CCTAAATAGAAGGCTGTACTGGG - Intergenic
1037487453 8:19361912-19361934 CTCAAATAGGAGTCAAGGCTGGG - Intronic
1037851419 8:22332866-22332888 CCCAGATAGAAGTTTAGAAATGG + Intronic
1043019258 8:74981131-74981153 CCCAAATAAAAGCCTTGTCTGGG - Intergenic
1047875869 8:129137204-129137226 CCTAAAAAGAAGTATAGATTTGG - Intergenic
1050306378 9:4309623-4309645 TCAAAATAGAAATGTAGACTGGG - Intronic
1050602942 9:7271234-7271256 CACAAATAAAAGCCTAGAGTTGG - Intergenic
1052824538 9:33165789-33165811 GTCAAAGAGAAGTCCAGACTAGG + Intronic
1185597474 X:1316511-1316533 CCCAAAGGGAAGTCTTGCCTTGG - Intergenic
1186457363 X:9720506-9720528 CCCAAATTCAAGTCTTGAATTGG + Intergenic
1188162139 X:26817509-26817531 CCCAATTAAAAATATAGACTGGG - Intergenic
1190453150 X:50600895-50600917 CCCAAATAAAAGTCAATGCTGGG + Intronic
1191902814 X:66056489-66056511 CCGAACAAGAATTCTAGACTAGG + Intergenic
1193925853 X:87483264-87483286 CTCATATAGTAGTCTAGTCTGGG + Intergenic
1197350265 X:125373423-125373445 ACCTAATAGAGGTCTATACTAGG + Intergenic
1199876773 X:151937557-151937579 CCCAAATATAATTGTAGATTTGG + Intergenic
1200276186 X:154735282-154735304 CCAAAATATAAGCGTAGACTGGG - Intronic
1201851618 Y:18489265-18489287 CCCAAATCTAAGTCTAGGCCTGG - Intergenic
1201881702 Y:18831115-18831137 CCCAAATCTAAGTCTAGGCCTGG + Intergenic