ID: 1106226312

View in Genome Browser
Species Human (GRCh38)
Location 13:27789744-27789766
Sequence CGGCTAAAGCAAGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106226298_1106226312 30 Left 1106226298 13:27789691-27789713 CCCACCCCGCCCCGCTCTGGGGG 0: 1
1: 0
2: 6
3: 42
4: 352
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226305_1106226312 20 Left 1106226305 13:27789701-27789723 CCCGCTCTGGGGGACTTTTGCTC 0: 1
1: 0
2: 3
3: 9
4: 139
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226306_1106226312 19 Left 1106226306 13:27789702-27789724 CCGCTCTGGGGGACTTTTGCTCG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226304_1106226312 21 Left 1106226304 13:27789700-27789722 CCCCGCTCTGGGGGACTTTTGCT 0: 1
1: 0
2: 2
3: 11
4: 101
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226302_1106226312 25 Left 1106226302 13:27789696-27789718 CCCGCCCCGCTCTGGGGGACTTT 0: 1
1: 1
2: 2
3: 9
4: 154
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226300_1106226312 29 Left 1106226300 13:27789692-27789714 CCACCCCGCCCCGCTCTGGGGGA 0: 1
1: 0
2: 1
3: 38
4: 362
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226303_1106226312 24 Left 1106226303 13:27789697-27789719 CCGCCCCGCTCTGGGGGACTTTT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1106226301_1106226312 26 Left 1106226301 13:27789695-27789717 CCCCGCCCCGCTCTGGGGGACTT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106226312 Original CRISPR CGGCTAAAGCAAGCCCTGGG AGG Intergenic
900572709 1:3366664-3366686 CTGCTCCAGCAAGCCCAGGGTGG - Intronic
900951878 1:5862651-5862673 CCGCTCAAGCCTGCCCTGGGTGG - Intergenic
902290803 1:15433498-15433520 CGGCTGACGGAAGCCCTGGGAGG - Intergenic
908088449 1:60661682-60661704 TGGCTAAAGCAAACGCTGAGAGG + Intergenic
908460433 1:64343754-64343776 AAGCTGAAGCAAGCACTGGGAGG - Intergenic
910519337 1:88101298-88101320 CTGTTAAAGTAAGCCCTGAGAGG + Intergenic
912956158 1:114155151-114155173 GGGCTAAGGCAAGGCCTGTGAGG + Intergenic
913521239 1:119647712-119647734 CGGAGAAACCAAGCCCAGGGAGG - Exonic
913548798 1:119896478-119896500 CAGCTAGACCGAGCCCTGGGAGG - Exonic
915084816 1:153378990-153379012 CAGTAAAAGCAGGCCCTGGGTGG + Intergenic
915509156 1:156377185-156377207 CGGCTCAAGGCAGCCCTGGCTGG + Intronic
1063224736 10:4005112-4005134 AGGTTAAGGCAGGCCCTGGGAGG - Intergenic
1063350810 10:5352914-5352936 CAGCTCAAGCAAGCCCTGCATGG + Intergenic
1066957646 10:42188268-42188290 GGGCTCAAGCAGGTCCTGGGGGG + Intergenic
1073624986 10:105087944-105087966 CTGCTAATGACAGCCCTGGGAGG - Intronic
1076218987 10:128717969-128717991 AGGCAAGAGCAAGCCCTTGGGGG + Intergenic
1077530425 11:3092391-3092413 CAGCTAAGACCAGCCCTGGGTGG + Intronic
1078421537 11:11216694-11216716 CCACTAAGGCCAGCCCTGGGAGG + Intergenic
1081854109 11:46293291-46293313 CAGCTAATCCCAGCCCTGGGCGG + Intronic
1083939449 11:65887853-65887875 CGGCTGAAACAGGCCCAGGGAGG - Intronic
1087746178 11:101949914-101949936 CTGCTAAAGCAAGCCCAGCAGGG + Intronic
1095952502 12:47789497-47789519 AGGCTAAGGGAAGACCTGGGTGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096473728 12:51895611-51895633 GGGCTACAGACAGCCCTGGGTGG - Intergenic
1100628108 12:96357654-96357676 CTGATAAAGCAAGCACTGAGAGG + Intronic
1101825738 12:108218702-108218724 AAGCTGAAGCAAGCCCAGGGTGG - Intronic
1104616705 12:130276477-130276499 TGTCCAAAGCAAGCCCTGTGTGG - Intergenic
1104837472 12:131800745-131800767 TGGCTACTGCAAGCCGTGGGCGG - Intergenic
1106226312 13:27789744-27789766 CGGCTAAAGCAAGCCCTGGGAGG + Intergenic
1114458315 14:22871748-22871770 CGGCTACTCCAACCCCTGGGCGG + Exonic
1117546493 14:56798096-56798118 CGGCGAAAGCAAGCCCAGCAGGG - Intergenic
1121553963 14:94822455-94822477 CGGGTACAGGAAGCCCTGTGAGG - Intergenic
1202935457 14_KI270725v1_random:83498-83520 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1133765223 16:8833011-8833033 CTGCTAAAGCAATGCCTGGCGGG + Intronic
1134290265 16:12899070-12899092 CGTCTAAATCCAGCCCTGGTGGG + Intergenic
1136748667 16:32614192-32614214 CAGCTCAGGCAAACCCTGGGAGG + Intergenic
1142144414 16:88486969-88486991 AGGCTAAACCCAGACCTGGGTGG - Intronic
1203050800 16_KI270728v1_random:873406-873428 CAGCTCAGGCAAACCCTGGGAGG + Intergenic
1147479087 17:40741926-40741948 CAGCTGAAGCAACCCCTGAGGGG + Intergenic
1148477273 17:47937025-47937047 CACCTAAAGCCAGCCCTGGTGGG + Intergenic
1160996527 19:1884709-1884731 TGGCTAGAGCAGACCCTGGGAGG + Intronic
1162252283 19:9455820-9455842 CTGTTAATGCAAGCCATGGGAGG + Intergenic
1162560994 19:11418274-11418296 GGGCTGAGGGAAGCCCTGGGTGG - Intronic
1164897541 19:31890390-31890412 TGGCTAAAACAGGTCCTGGGTGG - Intergenic
1165389895 19:35532792-35532814 CAGCCAAGGGAAGCCCTGGGTGG + Intergenic
1166573246 19:43812958-43812980 CAGCTAAAACAGGGCCTGGGTGG - Intronic
1167497825 19:49829856-49829878 CGGCTCCAGCAAGGCCGGGGGGG - Exonic
1167894509 19:52570245-52570267 GGACTAAAGCCAGGCCTGGGTGG - Intronic
1168659554 19:58155202-58155224 CGGCTAACGCAACCCGAGGGCGG - Intergenic
1168703154 19:58453441-58453463 AGGCTAGAGCAAGCCCTGGCTGG - Intronic
925145871 2:1583039-1583061 CAGCTGAAGAAACCCCTGGGTGG - Intergenic
926727556 2:16010206-16010228 GGTCAAAAGCAAGCCCTGTGAGG - Intergenic
927256908 2:21047630-21047652 GGGCTGCAGCCAGCCCTGGGTGG - Intergenic
929603805 2:43221387-43221409 CGGCTAAGGCAGGGCCCGGGAGG + Intergenic
934305764 2:91820782-91820804 GGGCTCAAGCAGGTCCTGGGGGG + Intergenic
934327492 2:92031960-92031982 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
936377531 2:111954750-111954772 GGGCTAAAACAAGTCCAGGGAGG + Intronic
937859480 2:126696718-126696740 GGTGAAAAGCAAGCCCTGGGTGG - Intergenic
940010200 2:149045544-149045566 CAGCTAAAGCAAGGCCTAGAGGG - Intronic
946168542 2:217879875-217879897 CAGCTGAAGCCAGTCCTGGGTGG - Intronic
946479512 2:220040673-220040695 CTGAGAAAGCAAGCCCAGGGAGG + Intergenic
948237714 2:236402832-236402854 TGGATAAAGCAAGGCCTGGGAGG + Intronic
1172486825 20:35303562-35303584 AGGCCACAGCAGGCCCTGGGGGG + Exonic
1172490203 20:35330463-35330485 CAGCTAGGGCTAGCCCTGGGTGG + Intronic
1173900003 20:46580784-46580806 CAGCTAAAACAGGTCCTGGGCGG + Intronic
1174556260 20:51397693-51397715 TGGCAGAAGGAAGCCCTGGGGGG - Intronic
1176246563 20:64100045-64100067 TGGCTCAAGCAAGCCCTGCCAGG - Exonic
1176596879 21:8705734-8705756 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1180279799 22:10683176-10683198 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1180587016 22:16901712-16901734 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1182000195 22:26913768-26913790 CAATTAAAGCAAACCCTGGGGGG - Intergenic
1182769008 22:32780260-32780282 GGGCTGAAGCTGGCCCTGGGGGG + Intronic
1182781146 22:32868965-32868987 CTTCTGCAGCAAGCCCTGGGTGG - Exonic
1183686011 22:39361887-39361909 GGGGTAAAGAAGGCCCTGGGGGG + Intronic
950199577 3:11033774-11033796 AGGCTAGACCAAGCCCTGGGGGG + Intronic
960087591 3:113607544-113607566 TGGCTAGAGCATGGCCTGGGAGG - Intronic
962319788 3:134381284-134381306 CAGCTAATGGAAGCCCTGTGTGG + Intergenic
962957542 3:140279942-140279964 TGGCTAAAGCAGTCCCTTGGTGG + Intronic
967884138 3:194321960-194321982 CGTCTAAAGCATGGCCTGGTGGG + Intergenic
972548214 4:40102733-40102755 CTGGTAAATCAAGCCCTGGAAGG - Exonic
981310719 4:143295417-143295439 GGGCTAATGTAGGCCCTGGGTGG - Intergenic
981938685 4:150259004-150259026 TGGCTAAATCAAGGCCTGGAGGG + Intergenic
982482605 4:155930618-155930640 CTGCTATAGCAAGCCATGGGTGG + Intronic
985492302 5:186981-187003 TTTCTAAACCAAGCCCTGGGAGG + Exonic
991002029 5:61792353-61792375 GGGCTAAAGCAGGCTATGGGAGG + Intergenic
994105832 5:95947521-95947543 CTCCTAAAACCAGCCCTGGGTGG + Intronic
994353658 5:98773071-98773093 CTGGTAAAGCAAGCTCGGGGCGG - Intronic
998874569 5:146586352-146586374 GGGCTCAAGAAAGCCCTGGTAGG - Intronic
1001990539 5:176112568-176112590 CAGCTCAGGCAAACCCTGGGAGG + Intronic
1002226334 5:177725572-177725594 CAGCTCAGGCAAACCCTGGGAGG - Intronic
1002267514 5:178045641-178045663 CAGCTCAGGCAAACCCTGGGAGG + Intronic
1006271829 6:32971138-32971160 CAGAAAAAGCAAGTCCTGGGAGG - Exonic
1007689437 6:43689704-43689726 TGTCCAAAGCAAGCCCTGGGTGG - Intergenic
1014111081 6:117619079-117619101 GGGCTGCAGCATGCCCTGGGTGG + Intergenic
1028603462 7:92628887-92628909 TGGCTGAAGCAAGCACTGGAGGG - Intronic
1029597894 7:101547279-101547301 TGGCTCAGGCCAGCCCTGGGGGG - Intronic
1033273619 7:139955206-139955228 CGTCTAAACAAAGACCTGGGAGG - Intronic
1037297074 8:17413061-17413083 CAGCTAAGGCTAGGCCTGGGAGG + Intronic
1044395126 8:91702579-91702601 TGGTTACAGCAAGCCTTGGGTGG - Intergenic
1045168729 8:99639377-99639399 CGGCTACAGCAAGCTCAGAGGGG + Intronic
1053537156 9:38937442-38937464 TGGCTAAAGCTACCCCTGGTAGG + Intergenic
1053695936 9:40639316-40639338 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1053942921 9:43270354-43270376 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1054307183 9:63438534-63438556 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1054405915 9:64762526-64762548 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1054439541 9:65248013-65248035 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1054490866 9:65773926-65773948 GGGCTCAAGCAGGTCCTGGGGGG + Intergenic
1054628979 9:67426488-67426510 TGGCTAAAGCTACCCCTGGTAGG - Intergenic
1058958076 9:109967779-109967801 CTGCTTAAGGAAGCTCTGGGAGG + Intronic
1060355549 9:122904635-122904657 CGGCCAAACAATGCCCTGGGAGG - Intronic
1061224514 9:129272950-129272972 TAGCTAAAGCAAGCCTGGGGTGG + Intergenic
1202778383 9_KI270717v1_random:12929-12951 GGGCTCAAGCAGGTCCTGGGGGG - Intergenic
1192131639 X:68557581-68557603 CGCCTAAAGAGAGCCCTGTGTGG + Intergenic
1199930967 X:152521128-152521150 CAGCAACAGCAAGCCCAGGGAGG + Intergenic
1201072009 Y:10155648-10155670 TGGCTAAAGCTAGCACTGGATGG - Intergenic