ID: 1106226520

View in Genome Browser
Species Human (GRCh38)
Location 13:27790668-27790690
Sequence TCCGCTGGGCAGAGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106226520_1106226526 -2 Left 1106226520 13:27790668-27790690 CCAGCCTGCCTCTGCCCAGCGGA 0: 1
1: 0
2: 5
3: 45
4: 391
Right 1106226526 13:27790689-27790711 GAAAGCCCCTCTCCCCGCCCGGG 0: 1
1: 0
2: 1
3: 41
4: 392
1106226520_1106226525 -3 Left 1106226520 13:27790668-27790690 CCAGCCTGCCTCTGCCCAGCGGA 0: 1
1: 0
2: 5
3: 45
4: 391
Right 1106226525 13:27790688-27790710 GGAAAGCCCCTCTCCCCGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106226520 Original CRISPR TCCGCTGGGCAGAGGCAGGC TGG (reversed) Intergenic
900192451 1:1357154-1357176 TCCGCAGGGCAGAGGCCTGAAGG + Intronic
900376578 1:2357493-2357515 TCCCCTGGGCAGGGGCACGTCGG + Exonic
900404518 1:2486551-2486573 CCCCCTTGGCAGAGCCAGGCAGG - Intronic
900431804 1:2606214-2606236 GCCGGTGGGCAGGGGTAGGCAGG - Intronic
900710375 1:4109587-4109609 TCCCCGGGCCAGTGGCAGGCTGG - Intergenic
901199501 1:7458558-7458580 TCCTCTGGGCAGGGGCGGGAAGG - Intronic
901209887 1:7518797-7518819 TCCCATGGGCAGAGGGAGCCTGG + Intronic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
901761644 1:11475780-11475802 GCCACTGGGCAGAGTCAGGTAGG - Intergenic
902761444 1:18583511-18583533 TGGGCTGGGCAGTGCCAGGCAGG - Intergenic
902785584 1:18730798-18730820 TCTGCTGGGGAGAGGCTTGCTGG - Intronic
902982781 1:20137882-20137904 GCAGCTGGGCAGAGGAAGGGTGG + Intergenic
903238761 1:21968498-21968520 GTGGCTGGGCAGGGGCAGGCTGG + Intergenic
903242686 1:21994162-21994184 GTGGCTGGGCAGGGGCAGGCTGG + Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903769722 1:25756345-25756367 TGGCCTGGGCAGAGGCAGGCAGG - Intronic
905202086 1:36322345-36322367 CCTGCTGGGCACAGGCACGCTGG - Exonic
905239101 1:36571087-36571109 ACAGCTGGGCTGAGGCAGGCAGG - Intergenic
906530378 1:46520349-46520371 GGGGCTGGGCTGAGGCAGGCTGG + Intergenic
906695661 1:47821665-47821687 TGGGCTGGACTGAGGCAGGCAGG - Intronic
907459133 1:54594759-54594781 CCCACTGGGCAGAGGCAGGAAGG + Intronic
911075971 1:93875288-93875310 TCCGGGTGGAAGAGGCAGGCAGG + Intronic
912725379 1:112054727-112054749 TCATCTTGGCAGAGTCAGGCAGG - Intergenic
913223594 1:116679388-116679410 TCTGGTGGCCAGAAGCAGGCTGG - Intergenic
915103970 1:153520904-153520926 TCCTCTAGGCAGAGGTAGCCAGG + Intergenic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915837393 1:159188500-159188522 CCAGCTGGGGAGAGGCAGGTGGG - Intronic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
917889895 1:179425694-179425716 TGTGCTGGGCAGAAGCAGGGAGG + Intronic
918070309 1:181129412-181129434 GCCACTGGGCAGGGCCAGGCTGG - Intergenic
920059290 1:203216590-203216612 TCCGCAGGTCAGAGCCAGGTGGG - Exonic
920100566 1:203514597-203514619 TCCGGTGGGCAGAGGCTCACAGG - Intergenic
920554724 1:206896347-206896369 TCAGCTTAGCAGTGGCAGGCTGG + Intergenic
921648991 1:217654365-217654387 TTCGGGAGGCAGAGGCAGGCAGG - Intronic
922654012 1:227365096-227365118 TCAGCTGTGCAAATGCAGGCAGG + Intergenic
924102044 1:240613938-240613960 TCTTCTGTGCAAAGGCAGGCAGG - Intergenic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1063982287 10:11463718-11463740 CCCGCTGGCCAGCGGCAGGAGGG - Exonic
1067044587 10:42977197-42977219 AATGCTGGGCACAGGCAGGCAGG + Intergenic
1067147593 10:43704417-43704439 TTGGCTGGGCTGAGGAAGGCAGG - Intergenic
1067449763 10:46375156-46375178 GTGGCTGGGCAGAGCCAGGCAGG + Intergenic
1067804564 10:49384059-49384081 CGGGTTGGGCAGAGGCAGGCTGG - Intronic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1069526947 10:69180601-69180623 TCTGCTGGGCCGAGGCTGGTTGG + Intronic
1069715082 10:70515436-70515458 CCAGCAGGGCAGAGCCAGGCTGG - Intronic
1070963675 10:80516542-80516564 CCCTCTGGGCGGGGGCAGGCTGG + Intronic
1071486831 10:86107778-86107800 TCTGCTGGTCAGTGGCTGGCTGG - Intronic
1071520524 10:86329274-86329296 ACAGCTGGGGAGAGGCAGCCTGG - Intronic
1072188178 10:93061397-93061419 GCCCTTGGGCAGAGGCAGGGTGG - Exonic
1072635274 10:97173878-97173900 CCCCCTGGGCCAAGGCAGGCTGG - Intronic
1072963971 10:99955514-99955536 TCTGCTGTGCTGAGGGAGGCAGG + Exonic
1073598088 10:104819627-104819649 TGTGCTGGGCAGTGGGAGGCAGG + Intronic
1074972511 10:118550719-118550741 GCAACTGGGCAGAGGCAGACAGG + Intergenic
1075333883 10:121595765-121595787 TCCTCTGGGCAGGGACAGGTGGG - Intronic
1075521974 10:123148565-123148587 TGGTCTGGGCAGAAGCAGGCGGG - Exonic
1076057476 10:127387267-127387289 CCCGCTGGGCAGTGGCAGAGAGG - Intronic
1076413094 10:130265670-130265692 TCCTCTGGGGAGAAGCAGCCTGG + Intergenic
1076479115 10:130772729-130772751 TCCACTGGGAAGAGCCAGCCTGG - Intergenic
1076634850 10:131875512-131875534 TCCTCTGGGGAGGGGCAGGCGGG - Intergenic
1077066035 11:641285-641307 GACGCTGGGCAGAGGTTGGCTGG - Intergenic
1077183473 11:1226537-1226559 TCCCCTGGGCCGAGGCACCCTGG - Intronic
1077250579 11:1558949-1558971 CACGCTGGGCACAGGCAGGCAGG + Exonic
1077281109 11:1746688-1746710 GAGGCTGGGCAGAGGCTGGCTGG - Intronic
1077332147 11:1988467-1988489 GCGGCAGGGCAGAGCCAGGCTGG + Intergenic
1077367822 11:2168268-2168290 TCCGGGGGGCAGAGGCAGCCGGG + Intronic
1077393922 11:2311996-2312018 GCTGCTTGGCAGAGCCAGGCAGG + Intronic
1080269650 11:30437609-30437631 TCAACTGGGTAGAGGAAGGCTGG - Intronic
1081575784 11:44317853-44317875 TCAGTTGGGCAGTGCCAGGCTGG - Intergenic
1081761191 11:45577415-45577437 TGAGCTGGGCAGGGGCAGGGAGG - Intergenic
1081990492 11:47334914-47334936 AACGCTGGGCAGAGACAGGAGGG - Intronic
1083047922 11:59753539-59753561 CCCTCTGAGCAGAGGCAGACAGG + Intronic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083633693 11:64108924-64108946 TCCTAAGGACAGAGGCAGGCAGG + Intronic
1083749738 11:64754455-64754477 GGCTGTGGGCAGAGGCAGGCCGG + Intronic
1084004617 11:66316411-66316433 GCCGCTGTGCAGTGCCAGGCTGG - Exonic
1084161977 11:67355067-67355089 GCCGATGGGGAGAGCCAGGCAGG - Intronic
1085302263 11:75465753-75465775 TCTGCTGGTCAGAGGCACACAGG - Intronic
1085417324 11:76328071-76328093 GGCTCTGGGCAGAGGCTGGCGGG + Intergenic
1085742805 11:79091436-79091458 TCCGCAGGGTAGAGGAATGCAGG - Intronic
1086324314 11:85682745-85682767 TCCCATGGGCAGAGGCCGGACGG - Intronic
1089119740 11:116125115-116125137 ACCCCTGGGCACAGGCAAGCCGG + Intergenic
1089286692 11:117412022-117412044 GTCGCTGGGCATAGCCAGGCAGG - Intronic
1089399677 11:118157216-118157238 GGCTCTGGGCAGAGGCAGGTAGG + Intergenic
1089452926 11:118609835-118609857 TCCGCAGGGCCGAGGGAGGGAGG - Intronic
1089620094 11:119717246-119717268 TGGTCAGGGCAGAGGCAGGCCGG + Intronic
1089686167 11:120148107-120148129 TCCCCAGGGTGGAGGCAGGCAGG - Intronic
1091222251 11:133936418-133936440 TCTGCTGGGAGAAGGCAGGCAGG - Intronic
1091275116 11:134344728-134344750 GCCGCTGGGCTGGGGCAGGGCGG + Intronic
1091302103 11:134514434-134514456 TCCACTGGGAAGATGCAGCCTGG + Intergenic
1091303124 11:134520375-134520397 TGGGGTGGGCAGAGGCAGACAGG - Intergenic
1202815128 11_KI270721v1_random:43643-43665 GCGGCAGGGCAGAGCCAGGCTGG + Intergenic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1091711500 12:2743688-2743710 GCTGCTGTGCAAAGGCAGGCGGG + Intergenic
1091766419 12:3122993-3123015 TCCCTGGGGGAGAGGCAGGCAGG + Intronic
1091771941 12:3157780-3157802 GGCGCTGGGCAGACGCTGGCAGG + Intronic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1093261318 12:16940888-16940910 TCCCCTGGGAACAGCCAGGCAGG + Intergenic
1094095568 12:26700522-26700544 ACCGCTGGGGAGTGGCAGGGTGG + Intronic
1094406448 12:30121422-30121444 TCCGCTGGTCAATGGCCGGCCGG - Intergenic
1095584486 12:43835758-43835780 GCCGCTCTGCAGAGGCGGGCCGG + Intergenic
1096784630 12:54009884-54009906 TCCGCTGGGGCGGGGCAGGGAGG + Intronic
1099973731 12:89525502-89525524 CCCGCTGGCCCAAGGCAGGCAGG + Intronic
1102236860 12:111299015-111299037 TCTGGTGGGCAGAGTCAGGCAGG + Intronic
1102991386 12:117318733-117318755 TGTGCTGGGCACAGGGAGGCGGG + Intronic
1105038844 12:132946361-132946383 ACCCCTGGGCAGACGCAGGCTGG + Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105836361 13:24215768-24215790 TCTGCTTGGCAGAGGCAGACTGG - Intronic
1106057767 13:26254431-26254453 ACGGCGGGGCAGAGGCCGGCCGG - Exonic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1107416518 13:40206276-40206298 TGCTCTGGGAAGAAGCAGGCAGG + Intergenic
1107726286 13:43303194-43303216 ACAGGAGGGCAGAGGCAGGCTGG + Intronic
1110860132 13:80339080-80339102 TTAGCTGGGGAGAGGGAGGCGGG - Exonic
1112438404 13:99408020-99408042 TCCGCTCGGCACAGGATGGCAGG + Intergenic
1113985667 13:114314188-114314210 TCCGCACGGCGGCGGCAGGCCGG + Intergenic
1114160838 14:20165307-20165329 TCTGCTTGGCAGTTGCAGGCAGG + Intergenic
1116817498 14:49597889-49597911 TTTGCGGGGCTGAGGCAGGCAGG - Intronic
1117478115 14:56118162-56118184 TCCGCCGGGCCGAGGGGGGCGGG + Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119436206 14:74599519-74599541 TCTGCTGGGCAGGGCCCGGCAGG + Intronic
1120852111 14:89180666-89180688 TGCGCTGGGCAGAGCCAGCCTGG - Intronic
1121716257 14:96078190-96078212 TCCGCTGGCCAGAGGAAGCCAGG - Intronic
1121767844 14:96502707-96502729 CCCGCTGGTAGGAGGCAGGCAGG + Intronic
1121878274 14:97474987-97475009 TGAGCTGGGGAGAGGCAGGATGG - Intergenic
1122309467 14:100785395-100785417 ACTGCTGGGCAGAGTCAGGAAGG - Intergenic
1122577349 14:102750745-102750767 TCTCCTGGGGAGAGGCTGGCTGG + Intergenic
1122799170 14:104221280-104221302 TCCGGTGGGGAGAGTCAGGATGG - Intergenic
1123109158 14:105857380-105857402 TGGGCTGGGCTGAGCCAGGCTGG - Intergenic
1123109441 14:105858870-105858892 TGAGCTGGGCTGAGCCAGGCTGG - Intergenic
1123109517 14:105859270-105859292 TGAGCTGGGCCGAGCCAGGCTGG - Intergenic
1123768784 15:23508593-23508615 GCCACTGCTCAGAGGCAGGCTGG + Intergenic
1124136150 15:27037978-27038000 TCTGCTGGCCAGAGCCTGGCTGG - Intronic
1124355882 15:28994499-28994521 TCCCCTGAGCAGAGGCAAGCAGG + Intronic
1124550874 15:30680412-30680434 TCCACTGGGCAGAGGCTGTGAGG + Intronic
1124593587 15:31075721-31075743 TGAGCTGGGCAGAGGGAGGGAGG + Intronic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124680378 15:31725255-31725277 TCCACTGGGCAGAGGCTGTGAGG - Intronic
1125051210 15:35299660-35299682 ACAGCTGGGGAGAGGCAGGAAGG - Intronic
1125087550 15:35748094-35748116 TCCTCTGTACAGAGGCAGGGGGG + Intergenic
1125766135 15:42137750-42137772 CCGGGTGGGGAGAGGCAGGCAGG - Intergenic
1126926220 15:53589719-53589741 ATCTCTGGGCAGAGCCAGGCTGG + Intronic
1127503317 15:59574921-59574943 TCCGCTGGGCAGTGGTTGGGGGG - Intergenic
1128301415 15:66568332-66568354 TTCCCTGGGCTGAGGTAGGCAGG + Intergenic
1128302433 15:66575008-66575030 ACCCCTGGGCAGAAGCAGGCTGG + Intergenic
1128469605 15:67941137-67941159 TCCCCTGGGGAGAGCGAGGCTGG + Intergenic
1129232365 15:74203874-74203896 TCCGCTGAGCAGAGGGTGGCAGG + Intronic
1129252699 15:74317749-74317771 TCAGCTGGGGAAAGGCAGGCAGG + Intronic
1129322374 15:74782304-74782326 TCCGGCGGCCAGAGGCTGGCTGG - Exonic
1130149170 15:81298364-81298386 TCCCAGGGGCAGAGGGAGGCTGG - Intronic
1130555321 15:84918479-84918501 ACCGCAGGTTAGAGGCAGGCAGG - Intronic
1130897655 15:88183542-88183564 TGCTCTGGGCTGAGGCTGGCAGG + Intronic
1130985033 15:88839105-88839127 TCCGCAGTGCAGGCGCAGGCAGG + Intronic
1131263531 15:90902680-90902702 TCCGCCGGGCACACGCAGGCCGG + Intronic
1131341756 15:91608886-91608908 TGAGCAGGGCACAGGCAGGCAGG + Intergenic
1132598605 16:764151-764173 TCAGTTGGGCTGAGGCAGGTGGG + Intronic
1132828868 16:1918072-1918094 ACCGCTGGCCAAAGGCAGGCCGG + Exonic
1132841774 16:1981513-1981535 TCCTGTGGCCAGAGGCAGGCAGG - Exonic
1132940108 16:2502189-2502211 TGCGCTGGCCAGACGCAGGTAGG + Exonic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133453531 16:5923013-5923035 TCCCCTGGGAAGAGGCATGGGGG - Intergenic
1134378595 16:13702867-13702889 TCCTCTTGGCTCAGGCAGGCAGG - Intergenic
1134450266 16:14358974-14358996 TCTGCTGGGCAGAGCCTTGCTGG - Intergenic
1135572172 16:23557685-23557707 GCCGCTGGGAAGAGGCGAGCTGG - Exonic
1136221887 16:28834537-28834559 TCGGCGGGGCTGAGGCTGGCTGG - Exonic
1136411917 16:30082675-30082697 TCCGCTGGACAGAAACAGGTAGG + Intronic
1137006168 16:35275917-35275939 TCCTCTTGGCATTGGCAGGCTGG + Intergenic
1137553439 16:49455700-49455722 AACGCTGGGGAGAGGGAGGCAGG + Intergenic
1138548788 16:57735900-57735922 TGGGCTGGGCCGAGCCAGGCGGG + Intronic
1139635461 16:68255744-68255766 TCTGCAGGCCAGAGCCAGGCAGG - Exonic
1139687668 16:68616866-68616888 TCGGCTGGGCTGAGGCAGTCAGG + Intergenic
1139954691 16:70687410-70687432 TCAGCTGGGAAGGAGCAGGCCGG + Intergenic
1140092492 16:71849891-71849913 GTGGCTGGGCAGAGCCAGGCAGG + Exonic
1140956318 16:79869725-79869747 GCCTCTGGGCAGTGGCAGGTTGG - Intergenic
1141141315 16:81498470-81498492 ACCACTGGGCAGAGGCAGAGTGG - Intronic
1141178242 16:81734727-81734749 TTCTCTGGGAAGAGGCAGCCAGG + Intergenic
1141605365 16:85150112-85150134 ACCGCTGGGCCGAGGCAGCCTGG + Intergenic
1141658363 16:85428316-85428338 AACGATGGGCAGAGGCAGGTAGG + Intergenic
1142030635 16:87836728-87836750 TCAGCTGGGCCCAGCCAGGCTGG - Intronic
1142207467 16:88790985-88791007 TCCTCTGAGCAGCAGCAGGCAGG - Intergenic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143681721 17:8480778-8480800 ACAGCTGGAGAGAGGCAGGCAGG - Intronic
1143995936 17:11006483-11006505 CCCTGTGGGCAGAGGCAGCCTGG + Intergenic
1144785257 17:17827818-17827840 TGGTCAGGGCAGAGGCAGGCCGG - Intronic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145272087 17:21410156-21410178 TAGGCTGGGCACAGGCAGCCAGG - Intronic
1145310294 17:21697618-21697640 TAGGCTGGGCACAGGCAGCCAGG - Intronic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1146688612 17:34857702-34857724 CCTGGTGGGAAGAGGCAGGCAGG + Intergenic
1147019296 17:37518400-37518422 TCCCCTGGACAGTAGCAGGCAGG - Exonic
1147971524 17:44220930-44220952 TGCGCTGCGCCGAGGCGGGCGGG - Intronic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148330633 17:46812011-46812033 TCCGCTGCCCAGAAGCAGGGAGG + Intronic
1148748592 17:49931878-49931900 TCGGCTTGGCAGAGCCAGGAGGG - Intergenic
1149457285 17:56798184-56798206 TAAGCTGGGCAGAGGCAGTCGGG - Intronic
1149461497 17:56833555-56833577 TCCGCTGCGGAGCGGCGGGCGGG - Intronic
1150209350 17:63433706-63433728 TTCTCTTGGCAGATGCAGGCGGG - Exonic
1150590550 17:66558541-66558563 TGAGCTGAGCAGAGGCAGACAGG + Intronic
1150619412 17:66798064-66798086 TCCTCAGGGATGAGGCAGGCAGG - Intronic
1151680506 17:75620398-75620420 TCCACTTGGCAGAGGCTGCCCGG + Intergenic
1152205085 17:78970293-78970315 TCCCCTGGGCTGAGTGAGGCGGG - Intergenic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1152609041 17:81306708-81306730 GGTGCTGGGGAGAGGCAGGCGGG - Intergenic
1152614086 17:81329958-81329980 TCCACTGGGCAGAGGAGGGTGGG - Intronic
1152699068 17:81810353-81810375 ACCACTGGGCAGAGGGGGGCAGG + Intronic
1152963560 18:95789-95811 ACCGCTGTGCAGACCCAGGCTGG + Intergenic
1153305152 18:3624282-3624304 ACCGCGGGGCAGGGGCACGCAGG - Intronic
1153636250 18:7116408-7116430 TCTGCTGCGCAGAGCCAGGCTGG - Intronic
1153674357 18:7443004-7443026 CCCACTGGGCAGATGCTGGCTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1158435766 18:57435104-57435126 GTCGCTGGGGAGAGGGAGGCTGG - Intergenic
1160689369 19:454261-454283 TCTGCTGGGCAGTGCCGGGCTGG + Intronic
1160837355 19:1131207-1131229 TCCGCTGAGCTGAGGCTGGAGGG - Intronic
1160860694 19:1236271-1236293 CCCGCTGGGCAGAGCCAAGCCGG - Intronic
1161043939 19:2124402-2124424 TCCTTTGGGCAGGGACAGGCAGG + Intronic
1161327273 19:3669957-3669979 GCCTCGGGGCAGGGGCAGGCCGG + Intronic
1161405783 19:4090479-4090501 TCCGCAGGGGTGAGGCAGGAGGG + Exonic
1161554542 19:4933153-4933175 TTCCCTGGGCAGAGGCACTCAGG - Intronic
1161622307 19:5304750-5304772 TGCGCTGGGCTGGGGCAGGGAGG + Intronic
1161849807 19:6732430-6732452 GCAGCTGGGGGGAGGCAGGCAGG - Intronic
1162182024 19:8876458-8876480 TGGGTTGGTCAGAGGCAGGCAGG + Intronic
1162385685 19:10359331-10359353 TCCAGAGGGCAGAAGCAGGCAGG - Intronic
1162568718 19:11458403-11458425 GGCGCTGGGCAAAGGCAGTCAGG - Intronic
1163288871 19:16365678-16365700 GAAGCTGGGCAGAAGCAGGCAGG - Intronic
1163769039 19:19179657-19179679 TGTGATGGGCAGACGCAGGCAGG - Intronic
1163826891 19:19528993-19529015 TCAGCTGGGGAGAGGGAAGCTGG + Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164560974 19:29292024-29292046 TCAGCAGGGCAGATGCAGGTAGG + Intergenic
1164608879 19:29618791-29618813 CCCCCTGGGCTCAGGCAGGCAGG + Intergenic
1165220976 19:34316543-34316565 AAAGGTGGGCAGAGGCAGGCTGG + Intronic
1165838848 19:38774831-38774853 AGGCCTGGGCAGAGGCAGGCTGG + Intergenic
1165840607 19:38787309-38787331 AGGCCTGGGCAGAGGCAGGCTGG - Intergenic
1165992776 19:39825825-39825847 TCCGGAGGGCTGAGGCAGCCGGG + Exonic
925768123 2:7257582-7257604 CCCCCTGGGCTGAAGCAGGCAGG - Intergenic
927478267 2:23430675-23430697 TCCTGTGGGCTGAGGTAGGCAGG - Intronic
928259690 2:29755546-29755568 TCCGCTGAGTAGAAGAAGGCTGG + Intronic
929876605 2:45801682-45801704 GCCGTTGGGCAGAGCCAGGGTGG + Intronic
929888759 2:45902361-45902383 TGGGCTGGGCATTGGCAGGCTGG - Intronic
931052398 2:58428790-58428812 TCCGCTGGGCTGGCCCAGGCGGG - Intergenic
931671772 2:64654006-64654028 ACCGCCGGGGAGAGGCGGGCCGG - Intronic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
933990854 2:87632994-87633016 TCCCCAGGGCAGATGCATGCAGG + Intergenic
934915159 2:98295597-98295619 TTCTCTGGGCAGAGGCTGGCGGG - Intronic
935175851 2:100648192-100648214 TATTCTGGGCAGAAGCAGGCGGG + Intergenic
936009249 2:108914820-108914842 TCCACTGGGCTGGGCCAGGCTGG - Intronic
936057524 2:109272101-109272123 ACAGCTGGCCAGAGGCAGACGGG - Intronic
936163554 2:110102219-110102241 TCAGCTGGGGAGAGCCAAGCAGG - Intronic
936302988 2:111317829-111317851 TCCCCAGGGCAGATGCATGCAGG - Intergenic
936399165 2:112152760-112152782 TCCGCAGGGCAGGAGCAGGCTGG - Intronic
937088690 2:119190223-119190245 AGGGATGGGCAGAGGCAGGCTGG + Intergenic
937111109 2:119367608-119367630 CCGGATTGGCAGAGGCAGGCGGG - Exonic
938079328 2:128361166-128361188 GCCGCTGGGCAGAGCCCAGCTGG + Intergenic
938573364 2:132582713-132582735 TTGGCTGGGCAGAGGCAGGCAGG - Intronic
940709567 2:157145254-157145276 TCCACTGGGTAGAGGAAGACAGG + Intergenic
942314178 2:174682847-174682869 TCCGCAGGGCTGAGCCGGGCGGG + Intronic
943033919 2:182716650-182716672 ATCGCTGGGCAGAGGAAGGGTGG - Intronic
946238932 2:218342099-218342121 TCCCCTGAGAAGAGGCAGGAGGG - Exonic
946418211 2:219551132-219551154 TGAGATGGGCAGAGGCAAGCTGG + Intronic
947807848 2:232980952-232980974 TGCGCAGGTCAGAGGCAAGCAGG + Intronic
947876639 2:233471877-233471899 TCTGCTGTGCAGAGAGAGGCAGG + Exonic
948049641 2:234969775-234969797 CCCACTGGGCAGAGGCAGTAAGG - Intronic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
948588590 2:239035982-239036004 TCCCCAGGGGAGAGGCAGCCAGG + Intergenic
948588611 2:239036029-239036051 TCCCCAGGGGAGAGGCAGCCAGG + Intergenic
948803732 2:240444156-240444178 TGGGCTGGGCTGAGGCTGGCCGG - Intronic
948853170 2:240718232-240718254 TCCCCAGGGCCCAGGCAGGCAGG + Intronic
948863988 2:240766250-240766272 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1168968831 20:1916930-1916952 ACCGCTGGACATAGGCAGGGAGG + Intronic
1169046599 20:2538250-2538272 AGAGCTGGGCAGAGGCTGGCAGG + Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169384381 20:5135842-5135864 GTCCCTGGGGAGAGGCAGGCGGG - Intronic
1170149923 20:13219163-13219185 TCCTATTGCCAGAGGCAGGCTGG - Intergenic
1170226356 20:13995546-13995568 TCCGCGGGGCTGAGGCGGGTGGG + Exonic
1170436800 20:16338682-16338704 TCTGCTGGGCAGGTGCAGGCAGG - Intronic
1170732104 20:18984702-18984724 TGCGGTGAGGAGAGGCAGGCAGG + Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171393218 20:24814789-24814811 GTCACTGGGCAGAGACAGGCAGG - Intergenic
1171462980 20:25309292-25309314 TCCCCATGGCAGAGGCAGGAGGG - Intronic
1172128878 20:32642674-32642696 GCAGCTGGTCAGAGGCGGGCAGG + Intergenic
1172134183 20:32676010-32676032 TCCGCTGGGGAGACTCAGGTTGG + Intergenic
1172600903 20:36182309-36182331 TCAGCTGGGCAGGATCAGGCGGG - Exonic
1172629626 20:36369190-36369212 TCTCCAGGGCAGAGGCAGCCAGG + Intronic
1172777622 20:37416596-37416618 AGGGCTGGGCAGAGCCAGGCAGG + Intergenic
1173414839 20:42846254-42846276 TCTGCAGGGGAGAGGCATGCCGG + Intronic
1174062919 20:47845356-47845378 TGGGATGGGCAGGGGCAGGCAGG - Intergenic
1175297921 20:57921958-57921980 TCAGCTGGGGAGTGGCAGGGCGG + Intergenic
1175313678 20:58029845-58029867 TCTTCTGGCCAGAGGCAGCCTGG - Intergenic
1175702416 20:61149454-61149476 TGCCCTGGGAAGAGGCAGGAGGG - Intergenic
1175729021 20:61340351-61340373 TGTGCTGGACAGCGGCAGGCTGG - Intronic
1176083776 20:63286694-63286716 ACAGCAGGGCAGAGACAGGCAGG - Intronic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1178514060 21:33230750-33230772 TCCGCTGCGTGGAGGCAGGAGGG + Intronic
1179165388 21:38931645-38931667 TCTGCTTTGCAGCGGCAGGCAGG - Intergenic
1179818360 21:43922363-43922385 GACGCTGGGCCGAGCCAGGCAGG + Intronic
1179826944 21:43971542-43971564 TGCGCTGGGCAGAGGCCAGGAGG + Intronic
1180012063 21:45058070-45058092 TCCGCTGGGCTGTGGGAAGCAGG + Intergenic
1180123479 21:45769639-45769661 TGGGTGGGGCAGAGGCAGGCTGG - Intronic
1180170301 21:46054982-46055004 TGTGCAGGGCAGAGGGAGGCAGG - Intergenic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180182162 21:46122965-46122987 GCAGCTGGGCAGAGGCAGGGAGG + Intronic
1180715758 22:17871166-17871188 CGTGATGGGCAGAGGCAGGCTGG - Intronic
1180720944 22:17907974-17907996 TCTGCTGGACAGAGGCTGGGAGG + Intronic
1181838014 22:25626929-25626951 TCAGTGGGGCAGAGGTAGGCAGG + Intronic
1181848143 22:25729824-25729846 TCCGCGGGTCAAGGGCAGGCTGG + Intergenic
1181860911 22:25817526-25817548 TCCTTTGGTAAGAGGCAGGCTGG - Intronic
1181915090 22:26273527-26273549 GGCTCTGGGCAGAGGCTGGCTGG + Intronic
1181923073 22:26335753-26335775 TGCTCTGACCAGAGGCAGGCAGG + Intronic
1182161007 22:28121717-28121739 CCCCATAGGCAGAGGCAGGCAGG - Intronic
1183335385 22:37243394-37243416 TCGGCAGGGGAGGGGCAGGCTGG - Intronic
1183380945 22:37490215-37490237 GGCTCTGGGAAGAGGCAGGCGGG + Intergenic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184104907 22:42361869-42361891 AGCTCTGGGCAGAGGCATGCAGG + Intergenic
1184640250 22:45866763-45866785 TTTGCCGGGCACAGGCAGGCCGG - Intergenic
1184973976 22:48047807-48047829 TCCGCTGGGCTGGAACAGGCTGG + Intergenic
1185001706 22:48250344-48250366 TCCCCGGGGCAGAGACAGACAGG + Intergenic
1185161664 22:49233666-49233688 TCCTCTGAGCAGAGGGAGGTGGG + Intergenic
1185196068 22:49470252-49470274 TCCTCTGGACAGGGGCACGCAGG - Intronic
950093607 3:10315156-10315178 TCCGCTGAGGACAGCCAGGCTGG + Intronic
950487593 3:13282430-13282452 GCCGCAGCGCAGAGCCAGGCCGG + Intergenic
952824918 3:37516725-37516747 TCCCCAGTGCAGAGGCAGTCTGG - Intronic
953404434 3:42653657-42653679 TCTGCTGGGGAGATGCAGCCAGG - Intergenic
953449119 3:42991646-42991668 TCCGCTGGGCCCAGGCACCCAGG - Intronic
954292323 3:49656186-49656208 GCCGCAGGACTGAGGCAGGCTGG - Exonic
954333476 3:49903110-49903132 TGGGCTGAGAAGAGGCAGGCTGG + Exonic
954400408 3:50316744-50316766 TGCTGTGGGCAGAGGCAGGAGGG - Intergenic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
955158111 3:56437315-56437337 CCCGCTGGGCAGTGGCTGGTTGG - Intronic
955916379 3:63912290-63912312 TCCTCTGAGCAGAAGCAGGCAGG + Intronic
958936503 3:100261234-100261256 TCCCTTGGGCAGAACCAGGCAGG - Intronic
960733445 3:120751226-120751248 TGGGGTGGGCAGAGGCAGGAGGG - Intronic
961451605 3:127004722-127004744 GCAGGTGGGCAGGGGCAGGCGGG + Intronic
961511493 3:127406561-127406583 GCCGGTGGGCCGAGGCAGGCTGG - Intergenic
961594271 3:128004859-128004881 GGGGCTGGGTAGAGGCAGGCTGG - Intergenic
961663261 3:128481518-128481540 TGCGGTGGGCAGAGCCAGGGAGG - Intronic
962809256 3:138947264-138947286 CTCGCTGGGCGGGGGCAGGCCGG - Exonic
963923782 3:150930226-150930248 TTAGCTGAGCAGAGGGAGGCTGG + Intronic
967967770 3:194975491-194975513 TCCGCTGCTCAGATGCTGGCTGG + Intergenic
968598262 4:1496343-1496365 ACCGCAGGGCAGAGGGAGTCCGG + Intergenic
968600889 4:1508850-1508872 TTCCCTGGGCTGTGGCAGGCTGG + Intergenic
968830641 4:2931590-2931612 TCCGCCGGGCATAGGCACCCTGG + Exonic
968959742 4:3737412-3737434 GATGCTGGGCAGGGGCAGGCGGG + Intergenic
968975844 4:3821701-3821723 TCAGCAGGGCTGGGGCAGGCAGG + Intergenic
972737461 4:41857508-41857530 TCCTCTGAGACGAGGCAGGCCGG + Intergenic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
975717268 4:77217085-77217107 TCAGCTGGGCAGAGGCCCTCTGG + Intronic
976524230 4:86067796-86067818 TCCGCTGGGAAGAGGGAATCTGG + Exonic
977411945 4:96677487-96677509 TCTGCTGGGGAGAGAGAGGCAGG + Intergenic
984556519 4:181220172-181220194 TCAGCTGCCTAGAGGCAGGCAGG + Intergenic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985129897 4:186728380-186728402 TCCGCTGGGCACTGACAGACTGG - Intergenic
985269380 4:188179397-188179419 TCCACTAGGCAAAGTCAGGCAGG + Intergenic
985309502 4:188581704-188581726 TGCGTGGGGCAGAGGGAGGCAGG + Intergenic
985524591 5:395536-395558 GCCACTGGGCACAGGCAGGGTGG - Intronic
985580619 5:693624-693646 ACCGCTGGGCAGGGGGCGGCGGG + Intergenic
985595246 5:784957-784979 ACCGCTGGGCAGTGGCAGCGAGG + Intergenic
985666412 5:1183664-1183686 AGGGCTGGGCAGAGGCAGGAAGG + Intergenic
985712734 5:1439019-1439041 GCCGCTGGCCAGGGCCAGGCAGG + Intronic
985950943 5:3220878-3220900 GCGTCTGGGCAGATGCAGGCCGG + Intergenic
992444323 5:76820093-76820115 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
995391679 5:111646751-111646773 TCCATTGGGCTGAGGCTGGCAGG + Intergenic
999825956 5:155274105-155274127 CCCTCTGGGGAGGGGCAGGCGGG - Intergenic
999889212 5:155958397-155958419 TCAGCTAGGCATTGGCAGGCTGG + Intronic
1001642195 5:173252378-173252400 TCCTCTGGAGAGCGGCAGGCAGG + Intergenic
1001951033 5:175816666-175816688 TGCGTGGGGCAGAGGCAGCCAGG + Intronic
1002385107 5:178860419-178860441 AGCGCAGGGCAGAGGCAGCCGGG + Intronic
1002577108 5:180180268-180180290 TCAGCTGTGCACATGCAGGCTGG + Intronic
1002792660 6:447281-447303 TGCGCTGGGAAGAGGCAGGCTGG - Intergenic
1003180838 6:3789971-3789993 TTCCCTGGGCAGTGGCAGGATGG + Intergenic
1006339842 6:33440773-33440795 TGCGCTGCGCAGAGCGAGGCCGG + Exonic
1006419479 6:33924322-33924344 TTTGCTGGCCAGAGGCAGACAGG + Intergenic
1009313781 6:62191358-62191380 TCCACTGGTCAGAGGAAGGAGGG - Intronic
1010205039 6:73315027-73315049 TTCGCTGGGCACTGGAAGGCCGG + Intergenic
1010221537 6:73452484-73452506 TCCGAGAGGCCGAGGCAGGCGGG + Intergenic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1013359612 6:109382158-109382180 TCGGCTGGGCAGGGGAGGGCGGG + Intronic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1016965897 6:149718268-149718290 TCGTATGGGCAGGGGCAGGCGGG - Intergenic
1019291158 7:251044-251066 TGCTCTGAGCAGAGCCAGGCAGG - Intronic
1019490575 7:1311386-1311408 TGGGCTAAGCAGAGGCAGGCAGG + Intergenic
1019921106 7:4163750-4163772 CCCGGTGAGCAGAGCCAGGCTGG + Intronic
1021085968 7:16421289-16421311 GCCGCCGGGCAGCGCCAGGCCGG - Exonic
1024101481 7:46036991-46037013 ACCGCTTAACAGAGGCAGGCAGG - Intergenic
1024242501 7:47446512-47446534 TGGGCTGGGCAGAGGCTGGGTGG - Intronic
1026970145 7:74462836-74462858 CCCGGAGGGCAGCGGCAGGCAGG - Intronic
1027188381 7:75984755-75984777 TCTGCAGGGAAGAGACAGGCAGG - Exonic
1032117336 7:129127814-129127836 TCCGCAGGGGTGAGGCAGGAGGG - Intergenic
1032720799 7:134549650-134549672 TCCTCTTGGCATTGGCAGGCTGG - Intronic
1032927509 7:136624523-136624545 TTTGCGAGGCAGAGGCAGGCAGG + Intergenic
1034125659 7:148669076-148669098 TCCAAGGGGCAGAGGCAGACTGG + Intergenic
1035375179 7:158402846-158402868 TCTGCTGGGCAAAGCCAGGAAGG - Intronic
1036620673 8:10422985-10423007 TGTGCTGGACAGAGGGAGGCAGG - Intronic
1037780831 8:21867981-21868003 TCAGCTGGATAGAGACAGGCTGG + Intergenic
1037803691 8:22048388-22048410 CCAGCTGGGAAGGGGCAGGCCGG + Exonic
1039401675 8:37275179-37275201 GCTGCTGGGCAGAGCCAGGCAGG + Intergenic
1039555972 8:38475233-38475255 TCCTCTGGGCAGAGGCAGCCGGG - Intergenic
1039887506 8:41663614-41663636 TGTGCTGGGGAGAGGCAGGTGGG - Intronic
1040054799 8:43048239-43048261 TTTGCGGGGCTGAGGCAGGCGGG - Intronic
1040948613 8:52912787-52912809 TCAGCTGGACCCAGGCAGGCTGG - Intergenic
1041463209 8:58133795-58133817 TCCACTGGGCAGAGCTAGGTTGG - Intronic
1042796008 8:72664159-72664181 TCCGCTGGACAAAGACAGGCCGG - Intronic
1044713003 8:95074834-95074856 TCCAATGGGCAGTGGCAGGTGGG - Intronic
1045905467 8:107339658-107339680 TCAGCTGCACAGAGGCAGGAAGG + Intronic
1046004643 8:108464375-108464397 TCCAATGGGCACAAGCAGGCTGG - Intronic
1049343288 8:142125242-142125264 TCCGCAGGGGAGACGCAGCCGGG - Intergenic
1049549671 8:143251267-143251289 GCCGAGGGGCAGATGCAGGCTGG - Exonic
1049749909 8:144278167-144278189 GCCACTGGGCAGAGGCAGGCGGG + Intronic
1053034132 9:34810104-34810126 TCCGCTGGGCAGCGCAGGGCCGG + Intergenic
1053056101 9:34993912-34993934 TCTGCTGGCCAGAAGCAGGCAGG - Intronic
1053230220 9:36401305-36401327 TCCGCAGGGCAGCGGGGGGCGGG - Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1055772322 9:79730671-79730693 TCCTCTTGGAAGAGGCAGGGGGG - Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1056434045 9:86558010-86558032 TGTGCTGGGCACAGGCATGCAGG + Intergenic
1059402272 9:114077792-114077814 GCTGCAGGGCAGTGGCAGGCAGG + Intronic
1060202064 9:121657102-121657124 TCCAGGGGGCAGGGGCAGGCCGG - Intronic
1060829663 9:126705712-126705734 ACAGCTGGGAAGCGGCAGGCTGG + Intergenic
1060869998 9:127032070-127032092 GCCCCTGGGAAGAGGAAGGCAGG + Intronic
1060979150 9:127782843-127782865 TCCTCTGAGCAGAGACAGACGGG - Intergenic
1061177368 9:129005823-129005845 TCAGCTGGGAAGTGGCAGGCAGG - Intronic
1061843240 9:133372426-133372448 TCAGATGGGCAGAGGGAGGTTGG - Intronic
1062002842 9:134225457-134225479 TCTGCTGGGCAGTGGGAGGTGGG + Intergenic
1062423984 9:136497656-136497678 TCCGCGGGGTGGGGGCAGGCAGG + Intronic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1062626973 9:137447812-137447834 GCTGCTGGGCACAGCCAGGCTGG - Exonic
1062734536 9:138127937-138127959 ACCGCTGTGCAGACCCAGGCTGG - Intergenic
1203760787 EBV:12378-12400 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203761716 EBV:15450-15472 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203762645 EBV:18522-18544 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203763574 EBV:21594-21616 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203764503 EBV:24666-24688 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203765432 EBV:27738-27760 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203766361 EBV:30810-30832 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1203767290 EBV:33882-33904 TCCGGGGGGCAGAGACAGGCAGG + Intergenic
1185507717 X:642672-642694 TCCGGTGCGCAAAGCCAGGCAGG - Intronic
1186119165 X:6340071-6340093 TTCTCTGGGCAGAGGAATGCAGG + Intergenic
1187572096 X:20515139-20515161 GCCACTGGGCAGAGGTAGGATGG - Intergenic
1190685879 X:52872701-52872723 TCCACTGGGCAAAGTCCGGCGGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic