ID: 1106226904

View in Genome Browser
Species Human (GRCh38)
Location 13:27792907-27792929
Sequence TTGAGTAGAGGCAGCGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106226904_1106226915 24 Left 1106226904 13:27792907-27792929 CCGCCCGCGCTGCCTCTACTCAA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1106226915 13:27792954-27792976 GCAGTACTGCCACGCGCCCCTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1106226904_1106226916 25 Left 1106226904 13:27792907-27792929 CCGCCCGCGCTGCCTCTACTCAA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1106226916 13:27792955-27792977 CAGTACTGCCACGCGCCCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1106226904_1106226909 -2 Left 1106226904 13:27792907-27792929 CCGCCCGCGCTGCCTCTACTCAA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1106226909 13:27792928-27792950 AAGGCTTCCTTCCCACCCTTCGG 0: 1
1: 0
2: 2
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106226904 Original CRISPR TTGAGTAGAGGCAGCGCGGG CGG (reversed) Exonic
904775256 1:32902112-32902134 TTTAGTAGAGACGGGGCGGGGGG - Intergenic
907038501 1:51236906-51236928 GCGAGTAGAGGCAGCTCTGGCGG + Intronic
909732716 1:78914760-78914782 TTGAGTAGGGGCAGAGTGGTTGG + Intronic
910548779 1:88452515-88452537 ATGAGTAGAGGCAAAGAGGGAGG - Intergenic
915982809 1:160432103-160432125 TATAGTAGAGACAGCGGGGGAGG - Intergenic
917853435 1:179083570-179083592 TTTAGTAGAGGCGGGGGGGGGGG + Intronic
1063334638 10:5199740-5199762 TTGAGTGGAGGTAGCTTGGGGGG - Intronic
1066334019 10:34457885-34457907 TTGAGTAGAGGCTAGGCTGGTGG - Intronic
1069788474 10:71004727-71004749 GTGAGTAGAGGCAGAGCCAGTGG - Intergenic
1069904032 10:71721883-71721905 TGAAGTAGAGGCAGCTGGGGAGG - Intronic
1078327492 11:10392563-10392585 TTGAGTAAAGGCATCAGGGGTGG + Intronic
1084581247 11:70024791-70024813 TTCAGGGGAGGCAGCTCGGGCGG - Intergenic
1085059975 11:73436749-73436771 TTGAGGAGAGGCAGGGAGGTTGG - Intronic
1085263695 11:75223985-75224007 TAAAGTAGAGGCAGCCGGGGAGG + Intergenic
1090240373 11:125177291-125177313 GCGAGGAGAGGCAGCGGGGGAGG + Intronic
1094073434 12:26445770-26445792 GTGAGTAGAGGCAGCTCTTGAGG + Intronic
1095688122 12:45058876-45058898 TTGAGGAGAGGCAGAGAGGTGGG + Intergenic
1097166039 12:57087326-57087348 TCGAGCAGAGGCTGCGTGGGCGG + Intronic
1103511703 12:121479284-121479306 TTTAGTAGAGACGGCGGGGGTGG - Intronic
1103712323 12:122921998-122922020 TTGAATAGAGGCGGCTAGGGAGG + Intronic
1106226904 13:27792907-27792929 TTGAGTAGAGGCAGCGCGGGCGG - Exonic
1112337056 13:98524493-98524515 TTCAGCAGAGGCAGCGAGGAAGG - Intronic
1112759430 13:102677372-102677394 TGGAGAACAGGCAGCGGGGGGGG - Intronic
1115677907 14:35701480-35701502 CTGAGTGGCGGCAGCACGGGAGG - Intronic
1119403702 14:74382112-74382134 TTTTGTAGAGGCGGCGGGGGGGG - Intergenic
1119503114 14:75147803-75147825 TTCTGTAGAGGGAGGGCGGGCGG - Intronic
1122235197 14:100327371-100327393 GTGAGTAGGGGCAGCCAGGGTGG + Intronic
1122238815 14:100348371-100348393 TTGAGCAGAGGCAGCACGTGAGG + Intronic
1122514546 14:102297873-102297895 TTGAGCACAGGCAGGGCCGGTGG - Intronic
1127900680 15:63338796-63338818 GTGAGGAGAGGCAGTGCTGGGGG - Intronic
1128068310 15:64777464-64777486 TTGATTAGGGGGAGCGGGGGAGG - Intergenic
1128511277 15:68315501-68315523 TTGAGTGGAGGCAGTGGGGTGGG - Intronic
1131036519 15:89226031-89226053 GTGAGTGGAGGCAGAGAGGGAGG + Intergenic
1132075770 15:98818568-98818590 TTGGGGAGTGGCAGGGCGGGGGG + Intronic
1134676852 16:16096724-16096746 TTGAGTAAAGGCAGTGTTGGTGG + Intronic
1134783614 16:16921065-16921087 TTGAGTAGTGACAGAGAGGGAGG + Intergenic
1136114491 16:28086307-28086329 CTGGGTAGAGGCAGTGAGGGTGG - Intergenic
1139248026 16:65466664-65466686 TTGAGTGGAGGCAGGGGCGGGGG + Intergenic
1139972978 16:70787633-70787655 TGGAGGAGAGGCAGCTGGGGTGG + Intronic
1142217917 16:88838912-88838934 ATGGGGAGAGGCAGCTCGGGAGG - Intronic
1146208378 17:30923112-30923134 TGGAGTAGAGGCAGCGGGCAGGG + Intronic
1149393093 17:56212077-56212099 TTGAATAGAAGCAGCGAGAGTGG + Intronic
1152038432 17:77887883-77887905 CTGAGGAGGGGCAGCTCGGGCGG - Intergenic
1157430299 18:47619342-47619364 TTGAGGGGAGGCAGGGAGGGTGG - Intergenic
1162212502 19:9103696-9103718 TTTAGTAGAGACGGCGGGGGTGG + Intergenic
1163449004 19:17364657-17364679 TTGAGTTGAGGCATGGAGGGTGG - Intronic
1167339388 19:48905886-48905908 GTGAGCAGGGGCAGGGCGGGAGG + Intronic
926186705 2:10696399-10696421 TTTAGTAGAGACGGCGGGGGGGG + Intergenic
926660470 2:15460082-15460104 TTGAGTGGAGGCAGCAAGGGAGG + Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
933328088 2:80863817-80863839 TTGAGCAGAGGCTGTGCTGGAGG + Intergenic
934549321 2:95245436-95245458 TTTAGTAGAGACGGCGGGGGGGG + Intronic
936011485 2:108927982-108928004 TGGAGCAGAGGCACCGGGGGTGG - Intronic
947747595 2:232516983-232517005 TGGAGTGGAGGCAGTGAGGGAGG + Intergenic
948959913 2:241326503-241326525 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
948959935 2:241326652-241326674 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
1171447339 20:25214190-25214212 ATGAGTGGAGGCAGCACGGAGGG - Intronic
1172189953 20:33055988-33056010 TAGAGTAGAGGCAGGCCAGGGGG - Intronic
1180064170 21:45404719-45404741 TTGAATAGAGTCACCGCGGGGGG - Intergenic
1180171960 21:46064174-46064196 GTGAGTAGAGGCAGCGGAGATGG - Intergenic
1181539141 22:23564088-23564110 GTGAGGAGAGGCAGGGCGGGAGG - Intergenic
1181673951 22:24439957-24439979 TTGAGGAGAGGCAGCATGGAGGG - Intronic
1184783167 22:46659136-46659158 TGGAGTGGAGGCTGAGCGGGAGG - Intronic
949924472 3:9030281-9030303 TTGAGCAGTGGCAGCGCTGTTGG - Intronic
950461026 3:13122314-13122336 TTGAGAAGTGGCAGGGCAGGTGG + Intergenic
952798024 3:37260453-37260475 TTTAGTAGAGACAGCGGGGGTGG - Intronic
952889170 3:38029582-38029604 TTGAGTAGCGACAGCACCGGCGG + Intronic
953180260 3:40588418-40588440 GGGAGTCGAGGCAGGGCGGGGGG + Intergenic
963053935 3:141168179-141168201 TTGAATAGAAGCAGTGAGGGAGG + Intergenic
966221055 3:177551586-177551608 TTGAGTAGAGGAAGGGCAAGAGG - Intergenic
967514540 3:190350981-190351003 TTGAGTTGAGGCATAGTGGGAGG + Intronic
968985092 4:3870713-3870735 TTCTGGAGAGGCAGAGCGGGTGG + Intergenic
971264451 4:25085650-25085672 TTGAGGAGAGGCAGGGGTGGGGG + Intergenic
972392267 4:38624794-38624816 TTAAGAAGAGGCAGCACGAGTGG + Intergenic
975004525 4:69269353-69269375 TGGAGGAGAGTCAGTGCGGGAGG - Intergenic
979029148 4:115618375-115618397 CTGAGTAGAAGCAGCACGGATGG - Intergenic
979197945 4:117942199-117942221 CTGACTAGAAGCAGCGCGGTTGG - Intergenic
984425325 4:179577501-179577523 TTGAGTAGAGGTAGTGAGAGTGG - Intergenic
985838140 5:2285372-2285394 TTGGATAAAGACAGCGCGGGTGG - Intergenic
994961052 5:106603348-106603370 TTGAGGAGAGGGAGAGCGGTGGG - Intergenic
997454249 5:134005408-134005430 TTGTCTAGACGCCGCGCGGGCGG - Intergenic
1001065894 5:168534878-168534900 TGCAGCAGAGGCAGCGAGGGTGG + Intergenic
1001929884 5:175665322-175665344 GGGAGTAGAGGCAGCGGGAGAGG + Intronic
1006029260 6:31167370-31167392 TTAAATAGAGGCAGCAGGGGTGG - Intronic
1014956408 6:127623147-127623169 TTGAGTAGAAGAAGTGAGGGTGG + Intergenic
1016330326 6:142946844-142946866 GTGAGTAGAGGCAGGGGGCGAGG - Intergenic
1023141788 7:37109485-37109507 CAGAGTGGAGGCAGCGCGTGGGG - Intronic
1029233041 7:99087753-99087775 TTGAGCAGTGGCAGCGGGGCTGG - Intronic
1029943455 7:104506236-104506258 TTGGGTGGGGGCAGCGGGGGCGG - Intronic
1033018590 7:137698513-137698535 TTGAGTACAGGCAGCCCCTGGGG + Intronic
1035655466 8:1301842-1301864 CACAGCAGAGGCAGCGCGGGAGG + Intergenic
1036787843 8:11699622-11699644 TTGAGGAGCGCCAGCGCTGGAGG - Intronic
1045431830 8:102122243-102122265 TTGAGCAGAGGCTACGTGGGGGG + Intronic
1050977770 9:11963748-11963770 TTGAGTGGAGGCAGCTGGGATGG - Intergenic
1053157553 9:35791544-35791566 AGGAGGAGAGGCAGCGGGGGAGG + Intergenic
1060542375 9:124439668-124439690 TTGAGGAGAGGCAGCTGGAGTGG + Intergenic
1061005500 9:127926780-127926802 GTGGGTAGAGTCAGCGCTGGAGG + Intronic
1061275279 9:129566618-129566640 GTGAGGAGAGGCAGGGCGGGAGG - Intergenic
1061893161 9:133633357-133633379 TGGAGCAGAGGCAGCAGGGGTGG + Intergenic
1196595591 X:117541973-117541995 TTGAGGAGAGGTAGCGCAGTAGG - Intergenic
1197829039 X:130621792-130621814 TTTAGTAGAGACGGGGCGGGGGG + Intergenic