ID: 1106228274

View in Genome Browser
Species Human (GRCh38)
Location 13:27801469-27801491
Sequence CAGAGCATGGAGAAGTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106228272_1106228274 -5 Left 1106228272 13:27801451-27801473 CCTGCACAGGATTGTGAACAGAG 0: 1
1: 0
2: 3
3: 23
4: 178
Right 1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG 0: 1
1: 0
2: 0
3: 22
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106228274 Original CRISPR CAGAGCATGGAGAAGTATGA TGG Intergenic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
902964442 1:19988864-19988886 CAGAGCATAGAGAATTTTTAAGG - Intergenic
904585562 1:31577883-31577905 AAGTGCATGGAAAAGGATGATGG - Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905830396 1:41061458-41061480 CAGAGCAAGGAAAATTATCAGGG + Intronic
906327439 1:44856072-44856094 AAAAGCATGGAGAGGTATAATGG + Intronic
908070092 1:60450910-60450932 CGGAGCATGGAGAAATTTTAGGG + Intergenic
908177083 1:61566310-61566332 CAGAGGTTGGAGGAGTTTGAAGG - Intergenic
909174018 1:72332388-72332410 CAGAGAATGAAGAGGAATGATGG + Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
911032126 1:93500407-93500429 CATATCCTGGAGAAGAATGATGG + Intronic
911770635 1:101736632-101736654 TAGAGAATGAAGAAGAATGAGGG - Intergenic
912107714 1:106301737-106301759 CAAAGCATGGAGAATTTTTAGGG - Intergenic
913272872 1:117111311-117111333 CAGAGCTGTGAGAAGGATGAAGG + Exonic
914869477 1:151460820-151460842 CAGGGCATGGGGAAATATGTTGG - Intergenic
915067977 1:153242847-153242869 CAGAGGATTAAGAAGTTTGAGGG - Intergenic
915579650 1:156805784-156805806 CAGAGAATGGGGAAGCAAGAGGG + Intergenic
916014974 1:160741898-160741920 CAGAGCTTGGAGGAGTCTTAGGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916735940 1:167607131-167607153 CAGAGGTTGGAGGAGTATGGAGG + Intergenic
916933383 1:169602959-169602981 CAGAGAATGGAGAATCATCAGGG - Intronic
917042325 1:170819535-170819557 CAGAGGGTGGAGAAGAATTAGGG + Intergenic
917114800 1:171591958-171591980 CAGAGCTTGGAGATGTACAAGGG + Exonic
918273876 1:182931892-182931914 CAGAGCATAGAGAATTCTAAGGG - Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
919198825 1:194324809-194324831 CAGAACATGGAAACGTATCAAGG + Intergenic
920739659 1:208568631-208568653 CAAAGCATTGAGATGAATGAGGG + Intergenic
921465186 1:215478432-215478454 CAGAGGGTGGAAAAGTATGGGGG - Intergenic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
924174974 1:241381629-241381651 CAGAGCAAGGAAAATTATCAGGG + Intergenic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924486418 1:244487734-244487756 CAGAGCATGGAGGGGAATCAGGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063004784 10:1959239-1959261 CAGAGCAAGGAAAATTATCAGGG - Intergenic
1063506296 10:6603302-6603324 CAGAGCCTTGAGAAGAATGCAGG - Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1067582993 10:47457271-47457293 CGGGGTATGGAGAAGTTTGAGGG - Intergenic
1067901321 10:50244523-50244545 CAGAGCATGAAGTTGTCTGATGG - Intronic
1068761296 10:60712836-60712858 CAGAGCAAGGAAAAATATCAGGG + Intronic
1069401184 10:68048524-68048546 CAGAGCATAGAGGATTTTGAGGG + Intronic
1070377807 10:75850882-75850904 CAGAGTATGCAGAGGTTTGAAGG + Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071831721 10:89378697-89378719 CAGAGCATGGTGAAGAATGTAGG + Intronic
1072172331 10:92877455-92877477 AAGAACCTGGAGAAGTATAAAGG - Intronic
1072174585 10:92906101-92906123 CAGAGCAAGGAAAATTATTAGGG - Intronic
1072227459 10:93383817-93383839 CACAGGATGGAGAAGGATCATGG + Intronic
1073574787 10:104613222-104613244 TAGAGCATGGAAAGGTCTGAGGG + Intergenic
1075243871 10:120802785-120802807 CAGAACATGGACAAGTTTCATGG + Intergenic
1077203062 11:1322959-1322981 CAGAGCAAGGAAAATTATTAGGG + Intergenic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1078848573 11:15143397-15143419 CAGAGGAAGGAGTACTATGAAGG + Intronic
1079111729 11:17609100-17609122 CAGAGCAGGGAGCAGTTTAAAGG - Intronic
1079365293 11:19803730-19803752 AAAAGCAGGGAGAAGAATGAGGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1085190242 11:74614372-74614394 TTGGGGATGGAGAAGTATGAAGG + Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1086016840 11:82178547-82178569 CAGAGGAGGAGGAAGTATGATGG - Intergenic
1086062914 11:82718607-82718629 CAGAGCATGGGGAAGTCCGTTGG + Intergenic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087010168 11:93506206-93506228 TAGAGCATGCAGATGAATGATGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087073151 11:94101730-94101752 CAGAGCACGGAGAATTTTTAGGG - Intronic
1087447167 11:98269547-98269569 CAGAGGATGGAGCAGTTTGGAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1091024573 11:132130724-132130746 CAGAGAATAGGGAAGTCTGATGG + Intronic
1091307618 11:134547333-134547355 CAGAGCAAGGAAAATTATCAGGG + Intergenic
1091328089 11:134707243-134707265 CAGAGCATGGAGAAATCACAAGG + Intergenic
1092111906 12:5970178-5970200 CAGAGGAGGGAGAAGTCTGGAGG - Intronic
1093880170 12:24395210-24395232 CAGAGCCTGGAGAATAAGGATGG + Intergenic
1094205025 12:27830769-27830791 CAGGGCAAGGTGAAGTATCAGGG - Intergenic
1094397714 12:30025703-30025725 CAGAGGTTGGAGAAGTTTGGAGG - Intergenic
1095193091 12:39281000-39281022 CAGAGCAAGGAAAATTATCAAGG + Intergenic
1095583582 12:43827197-43827219 CAGAGCATCAAGAAGGATGTGGG - Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097718272 12:62991507-62991529 CAGAGCAAGGAGAGTTATCAGGG - Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098595535 12:72270799-72270821 CAGAGTATGTATAAGTATGTGGG - Intronic
1101908310 12:108844356-108844378 CAGAGCATGAACAAGCATGTGGG + Intronic
1102788035 12:115620039-115620061 AAGGGCATGGAGAATTATGTAGG + Intergenic
1103865560 12:124049287-124049309 CAAAGCATGCAGAGGAATGAGGG - Intronic
1105703578 13:22952640-22952662 GAGAGAATGGAGAAATATAAGGG + Intergenic
1106167479 13:27261689-27261711 CAAATCATGGGGAAGGATGAAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1107397228 13:40030444-40030466 CAGAGCACAGAGCAGTGTGACGG - Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1109422272 13:62129629-62129651 CAAGGCATGCAGAAGTATAAGGG + Intergenic
1110566329 13:76960724-76960746 CAGAGGTTGGAAAAGTCTGAAGG - Intergenic
1111604610 13:90520721-90520743 CAGAGCATTGAGAGGTAGCATGG + Intergenic
1113498229 13:110750790-110750812 CAGAGAATGGAGAAATAGAAAGG - Intergenic
1114064022 14:19044763-19044785 CAGGGCATGCAGAACTATGGTGG + Intergenic
1114098237 14:19355233-19355255 CAGGGCATGCAGAACTATGGTGG - Intergenic
1114583753 14:23790324-23790346 CAGAGCCTGGACTAGTGTGAAGG + Intergenic
1114780761 14:25536083-25536105 CAGAACATGGAAAACTATTAAGG + Intergenic
1116867438 14:50042274-50042296 CAGAGCATGGAGAATTACACAGG - Intergenic
1117106524 14:52402692-52402714 AAAAGCCTGGAGAAGTATTAAGG + Intergenic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119778845 14:77265117-77265139 CAGAGCATGGAGGAGCATGCAGG + Intergenic
1121762549 14:96458191-96458213 GAGAGCATGGAGCAGAATGCAGG + Exonic
1127279875 15:57479747-57479769 CAGAGCAGTTTGAAGTATGATGG + Intronic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1129000854 15:72332641-72332663 CAGAGCAAGGAAAATTATGAAGG - Intronic
1130055132 15:80516429-80516451 CAGAGCAAGGAAAATTATCAGGG - Intronic
1130379863 15:83362293-83362315 GAGACCATGGAGAACTATAAGGG + Intergenic
1130509692 15:84579119-84579141 CAGCCCATGGTGAAGTCTGAGGG + Intergenic
1130585480 15:85177636-85177658 CAGCCCATGGTGAAGTCTGAGGG - Intergenic
1132123151 15:99195593-99195615 CAGAGCATGGAGGATTTTTAGGG + Intronic
1132134398 15:99320618-99320640 AAGAGCATGGAGAAATATGCTGG + Intronic
1133123958 16:3632474-3632496 CAGAGCAAGGAAAATTATCAGGG - Intronic
1133926937 16:10200875-10200897 CAGAGGAGGGAGAAGCCTGATGG + Intergenic
1134099294 16:11440392-11440414 CAGAGAGTGGAGAATTATGTAGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136064900 16:27751988-27752010 TAGAGCAGGGAGAATTAAGATGG + Intronic
1136547851 16:30965594-30965616 AAGAGCATGGAGAAGCCTGCGGG - Exonic
1136987768 16:35127025-35127047 CAGAGCATGGAAAATTATTTTGG + Intergenic
1137251284 16:46742843-46742865 CAGAGCCTGCAGAAGGATAAGGG - Intronic
1137253365 16:46756413-46756435 CAGAGAATGAAGAAATATGGAGG + Intronic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1139319518 16:66102334-66102356 CAGTGAATGGGGAAGTATGAGGG + Intergenic
1140752414 16:78037503-78037525 GAGAGAATGGAGAGGGATGAAGG - Intronic
1142072350 16:88098138-88098160 AAGCGCATGGAGAAAGATGAGGG - Intronic
1142919358 17:3170819-3170841 CAGAGGATGGAAGAGTTTGAAGG + Intergenic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1146701101 17:34961123-34961145 CAGAGCAGGGATGAGAATGAGGG + Intronic
1147380885 17:40055486-40055508 CATAGCATGGGGAGGGATGAGGG - Intronic
1147767649 17:42847583-42847605 CAGAGCTGGGAGGAGTATGCAGG + Intronic
1148901225 17:50879149-50879171 CAGAGCTTAGGGAAGCATGAAGG + Intergenic
1150614597 17:66759810-66759832 CAGAGCAAGGAGAGTTATCATGG + Intronic
1151345810 17:73500549-73500571 GGGAGGATGGAGAAGGATGAAGG - Intronic
1151575478 17:74950832-74950854 CAGAGCTGGGTGAAGGATGAGGG + Exonic
1155524000 18:26697981-26698003 CAAAGCAAGGAAAAGTATGGTGG + Intergenic
1155564382 18:27117517-27117539 CAGAGCATGGAGGATTTTTAGGG - Intronic
1157115611 18:44860012-44860034 CAGAGAATGGAAAAGTCAGAAGG - Intronic
1157592847 18:48845988-48846010 CATAGCATGGAGATGTAGGTAGG - Intronic
1157789094 18:50514896-50514918 CTGAGAATGGATAAATATGAAGG + Intergenic
1158865859 18:61637005-61637027 CAAAGCAGGAAGAAGTAGGATGG + Intergenic
1159423705 18:68256126-68256148 CAAAGCATGGAAAAAAATGAAGG - Intergenic
1160601760 18:80019076-80019098 CAGAGATTGGAAAAGTTTGAAGG - Intronic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1166157454 19:40924569-40924591 CAGAGCATAGTGAAGCATGATGG + Intergenic
1166166323 19:40991602-40991624 CGGAGCATGGTGAAGCATGATGG + Intronic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926691277 2:15735716-15735738 GAGAGCATGGAGAATGAAGAAGG - Intronic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928109000 2:28491274-28491296 CAGACAATGGAGAAGTAACATGG - Intronic
928680233 2:33693819-33693841 CATAGGATGGAAAAGTTTGAGGG - Intergenic
929349446 2:40931271-40931293 CAGAGCAGTGAGAACTATGGAGG - Intergenic
929495909 2:42443353-42443375 CAAAGAATTGAGAAGTATGCTGG + Exonic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
932402201 2:71488853-71488875 CAGACCATGGGGAAGGGTGAAGG - Intronic
933148524 2:78886197-78886219 CAGAGCATGGACATTTATCAGGG + Intergenic
933464897 2:82639681-82639703 CAGAGGATGGACAAGTTTGGGGG + Intergenic
933490056 2:82974540-82974562 CTGATCATGAAGAAGCATGAGGG - Intergenic
934126275 2:88894523-88894545 CAGAGCAAGGAAAAGTATCAAGG - Intergenic
934318224 2:91945987-91946009 CAGAAGATGGAAAAGTTTGAAGG - Intergenic
935856171 2:107276828-107276850 CAAAGAATGGAGAAGGTTGATGG + Intergenic
936058861 2:109281524-109281546 CAGAGCATGCAAAGGGATGAGGG + Intronic
938481283 2:131663747-131663769 CAGGGCATGCAGAACTATGGTGG + Intergenic
938624179 2:133090748-133090770 CAGAGAATGTAGAAGTCTTAGGG - Intronic
938739338 2:134216399-134216421 TAGAGAATGAAGAAGAATGAAGG + Intronic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
941207920 2:162597523-162597545 CAGAGGCTGGGGAGGTATGAAGG + Intronic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942721496 2:178958152-178958174 CAGAGCACGGAGGATTATTAGGG + Intronic
943095867 2:183428574-183428596 TAGAGCATGGAGGAGTTTTAGGG - Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943945407 2:194055529-194055551 CAGACTATGGAGAAATATAATGG - Intergenic
944146883 2:196515256-196515278 CAGAGCAGCGAGAAGTGTGTGGG - Intronic
946217833 2:218199485-218199507 CAGAACATGGAGGAGCATGTTGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
947576956 2:231283151-231283173 CAGAGCAGGGAGAAAAAAGACGG + Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1170903103 20:20485244-20485266 CAGAGCAGGGAAAATTATCAGGG - Intronic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1177735491 21:25083883-25083905 GAGAGCAAGAAGAAGTATAAGGG - Intergenic
1180482514 22:15767397-15767419 CAGGGCATGCAGAACTATGGTGG + Intergenic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181467709 22:23118986-23119008 CAGAGCATGGACAGGTCAGAGGG + Intronic
1181821044 22:25475927-25475949 CAGAGCATGGCGAGGTCTGGAGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1185421280 22:50735636-50735658 GAGAGCAGGGAGGAGTTTGAGGG + Intergenic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
951647622 3:24910757-24910779 AAGACCATGGAGAATTATGAGGG + Intergenic
952230761 3:31427842-31427864 CAGAGCAAGGAAAATTATTATGG - Intergenic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
954324583 3:49856436-49856458 CAGAGCACGGATAGGCATGATGG + Exonic
954953771 3:54500159-54500181 CAGAGCAGGGAAAATTATCAAGG - Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955713710 3:61806419-61806441 CAGAACCTGGATAAGGATGATGG - Intronic
956468723 3:69542893-69542915 CAGAGCTTGGAGGAGTCGGAGGG - Intergenic
957323693 3:78664787-78664809 CACAGCAAGGAGAAAAATGAGGG - Intronic
957524039 3:81357387-81357409 AAGAGGATGGAAAAGTATGGAGG + Intergenic
958651799 3:96945962-96945984 CAGAGCATGGAGAATTTTTAGGG - Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959283521 3:104378632-104378654 GAGAGGCTGGAAAAGTATGAGGG + Intergenic
959738418 3:109687657-109687679 AAGAGCATGGAGAAATATTCTGG + Intergenic
960618839 3:119620206-119620228 CATAGCATAGGGAAGGATGACGG - Intronic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
964663649 3:159149574-159149596 AAGAGAATGGAGAAATATAATGG + Intronic
965670541 3:171143292-171143314 CTGTGCATGGAGCCGTATGAGGG + Intronic
965881160 3:173389820-173389842 TAGAGCATGGAGAGGTAAGTAGG - Intergenic
965935216 3:174100936-174100958 CGGAGCCTCTAGAAGTATGATGG - Intronic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
968858753 4:3149712-3149734 CAGAGAAGGGAGAAGACTGATGG - Intronic
970059380 4:12013792-12013814 CATGACTTGGAGAAGTATGAAGG - Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970855251 4:20643933-20643955 GAGAGAATGGAGAAGTGAGAGGG + Intergenic
974184534 4:58429804-58429826 CAGATCATTGAGAAGCATCATGG - Intergenic
975586555 4:75955785-75955807 GAGAGCATGGAGAGGTGAGAAGG - Intronic
977395851 4:96469543-96469565 CAGAGGTTGGAGCAGTTTGAAGG - Intergenic
977964484 4:103128148-103128170 CAGAGCAAGGAAAACTATCAGGG + Intronic
978581562 4:110236655-110236677 CAGAGCAGAGAGAAATTTGAAGG - Intergenic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
979364492 4:119804509-119804531 CACAGCATTTAGAAATATGAAGG - Intergenic
979496741 4:121392396-121392418 CCGATCATGGAGATGGATGAGGG + Intergenic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
981141619 4:141276094-141276116 ATGAGAATGGAGAAGTATGTAGG - Intergenic
981511432 4:145562815-145562837 AAGAGAATGGAGAGGTAGGAAGG + Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
986331735 5:6721516-6721538 GAAAGCCTGGAGAAGTATGGAGG + Intronic
987305174 5:16630737-16630759 CAGAGCATGCAAAAGCATGAGGG + Intergenic
987659465 5:20854219-20854241 CAGAGGATGGAGCAGTTTGTAGG + Intergenic
987674959 5:21062792-21062814 CAGAGGTTGGAGAAGTTTGGAGG + Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988231639 5:28487238-28487260 CCCAGCCTGGAGAATTATGAGGG + Intergenic
988290786 5:29282964-29282986 TAGAGCATGGAGAAATTTTAAGG - Intergenic
989471331 5:41822416-41822438 CAGAGCAAGGAAAATTATTAGGG - Intronic
990957212 5:61354155-61354177 CTGAGCAGGGATAAGTACGATGG - Intronic
992068627 5:73129726-73129748 TAGATCATGGAGAGGTGTGAGGG + Intronic
992745198 5:79812598-79812620 CTGAGCATGAAGGAGCATGAAGG + Intergenic
993252562 5:85548335-85548357 CACTGCATGGAGATGGATGAGGG - Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
994234344 5:97343606-97343628 CAGAGAATGGAAAAGTTTGGAGG - Intergenic
994915007 5:105963934-105963956 CAGAGCACAGAGAATTTTGATGG - Intergenic
994970630 5:106731807-106731829 CAGAATATGGATAAGAATGAAGG + Intergenic
994982558 5:106894700-106894722 CTAAGCACGGAGAAGAATGAGGG - Intergenic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997383043 5:133450982-133451004 CAGAGGAGGGAGAGGCATGATGG + Intronic
998324029 5:141262793-141262815 CAGGGCCTTGAGAAGTATTATGG - Intergenic
998889245 5:146729008-146729030 CAGAGATTGGAAAAGTTTGAAGG + Intronic
999537168 5:152529791-152529813 CAGAACATGGAGAACTTTGTAGG + Intergenic
1001007675 5:168068152-168068174 CAGAGCAAGGAGAAATCTCATGG + Intronic
1001768833 5:174277117-174277139 CAGTGCATGGTGAAGCATTAGGG - Intergenic
1002377554 5:178799060-178799082 GAGAGCCTGGAGCAGCATGAGGG + Intergenic
1004291988 6:14375703-14375725 CACAGCTAGGAGAAGTATAAAGG + Intergenic
1005854299 6:29848872-29848894 AAGAGGATGGAAATGTATGAAGG - Intergenic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1008390717 6:50948262-50948284 CAGAGCATGGTGGGGTAAGAAGG - Intergenic
1008430991 6:51416523-51416545 AAGAGCATGGAAAAGTGTCAGGG + Intergenic
1008607333 6:53152939-53152961 CCGAACATGTAGAAATATGAAGG - Intergenic
1009459632 6:63896681-63896703 CAGAGCACAGAGAATTTTGAGGG - Intronic
1010137057 6:72567560-72567582 CAGAGCAAGGAAAATTATCAGGG + Intergenic
1010263641 6:73844306-73844328 CAGAGAATGGAACAGTTTGAAGG + Intergenic
1013171441 6:107639966-107639988 CTGAGCCTGGAGTAGTATCATGG - Intronic
1013694255 6:112682596-112682618 CAGAGTATGGAGGAATTTGAGGG - Intergenic
1015291947 6:131547458-131547480 CATAGAACTGAGAAGTATGAAGG + Intergenic
1016149948 6:140728360-140728382 CAGAGCATGAGGAAGAAAGAGGG + Intergenic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1018662686 6:166102789-166102811 CAGAGGATGGAAAAGTTTGGAGG - Intergenic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019265700 7:116405-116427 CAGAGCCCGGAGCAGAATGATGG - Intergenic
1020837311 7:13169193-13169215 CAGAGGATGGAACAGTTTGAAGG - Intergenic
1021455919 7:20829684-20829706 CAGCCCATGCTGAAGTATGAGGG + Intergenic
1021527294 7:21603027-21603049 CAGGGCATGGAGGAGGATAATGG - Intronic
1022893645 7:34726879-34726901 CAGAGCATGGAGGATTTTTAGGG + Intronic
1023725065 7:43134822-43134844 GTGATCATGGAGAAGTCTGAGGG + Intronic
1024382737 7:48717681-48717703 GAGATCATGGAAAAGGATGAGGG + Intergenic
1026581793 7:71624506-71624528 AAGAGAATGGAGAAAAATGATGG + Intronic
1027693722 7:81381890-81381912 AAAATCATGTAGAAGTATGATGG + Intergenic
1028207145 7:88031290-88031312 CAGAGGATGGAGCAGTTTGAAGG + Intronic
1028699265 7:93757821-93757843 TAGAGCATGGAGCATTATCAAGG + Intronic
1030640803 7:112004047-112004069 CAGATCCTGGAGAAGTGTGATGG - Exonic
1031115188 7:117659545-117659567 CAGAGCCTTGAGATGTCTGAGGG + Intronic
1031185228 7:118471330-118471352 CAGAGGATGTAGAAGAAAGAAGG + Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031783912 7:126004729-126004751 CAGAGAATGGTGAAGCATTATGG + Intergenic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1037763073 8:21755081-21755103 CAGAGCATGGAGCATTTTTAGGG + Intronic
1038084898 8:24185195-24185217 CAGAACATGGAGAACTTTTAGGG + Intergenic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038722361 8:30048263-30048285 CAAAGAATGGAGAGGTTTGATGG - Intergenic
1041222853 8:55669409-55669431 CAGAGGTTGGAAAAGTTTGAAGG + Intergenic
1043526611 8:81104601-81104623 CAGAGGATGGAGCAGTTTGCAGG - Intronic
1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG + Intronic
1044887539 8:96795016-96795038 CAGAGGTTGGAATAGTATGAAGG - Intronic
1046213232 8:111107302-111107324 CAGAGCAGGGAATAGGATGATGG - Intergenic
1046360343 8:113145200-113145222 CAGACCATGTAGAAATTTGAAGG + Intronic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046537309 8:115531840-115531862 CAGAGCATGAAGACGTCTGATGG + Intronic
1048127994 8:131658870-131658892 TAGTGCATGGAGAAATGTGATGG - Intergenic
1049281026 8:141744719-141744741 TAGAGGATGAAGAAGTGTGATGG + Intergenic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1050057893 9:1674666-1674688 TAGAGCATGAAGAAATATCATGG - Intergenic
1051975533 9:22943040-22943062 CAGAGCTTGGAACAGTTTGAAGG - Intergenic
1052637374 9:31122259-31122281 CAGAGATTGGAAAAGTTTGAAGG - Intergenic
1055500811 9:76900769-76900791 CTGAGCAGTGAGAAGAATGAGGG - Intronic
1055583167 9:77729714-77729736 CATAACATGGAGAACTAAGAAGG - Intronic
1056241245 9:84648767-84648789 CACAACATGGAGGAGTCTGAAGG - Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1056530666 9:87484401-87484423 TAGAGCATGGAGAATTTTTAGGG + Intergenic
1056663332 9:88560568-88560590 AAGAGCATGCAGAAGTATCTTGG + Intronic
1057508406 9:95656186-95656208 CAGAGCATGGAGAATTCTTAGGG - Intergenic
1059374342 9:113870668-113870690 AAGGGCATGGAAAAGAATGAAGG - Intergenic
1059381029 9:113925263-113925285 CAGAGCAAGGAAAATTATCAGGG - Intronic
1060886433 9:127155701-127155723 AAAAGCAGGGAGATGTATGAGGG + Intronic
1062536510 9:137023467-137023489 AAGAGCCTGAAGGAGTATGAAGG + Intronic
1187795268 X:22996961-22996983 CAATTCATGGAGAAGTATGGAGG + Intergenic
1187894517 X:23967741-23967763 CAGAGGTTGGAGCAGTTTGAAGG - Intergenic
1187928175 X:24269521-24269543 GAGAGAATGGAGAGGTATGGGGG + Intergenic
1188632505 X:32383051-32383073 CAGAGCATAGAGAAATAAAAAGG + Intronic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189385179 X:40531325-40531347 CAAAGCCTGGAGAAGTTTTATGG - Intergenic
1189897908 X:45674378-45674400 CAGAACATGGATAGGAATGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190379878 X:49829316-49829338 GAGAGCCTGGCGAAGAATGAAGG - Exonic
1190570745 X:51779076-51779098 CAGAGCATGGACAGGGATGATGG - Intergenic
1191702007 X:64052998-64053020 CAGAACATGGATGAGTCTGAAGG + Intergenic
1192696549 X:73422236-73422258 CAGAGCATTGAGAAGAAACATGG - Intergenic
1193475429 X:81958771-81958793 CAGACAATGGAGAATTATTAAGG + Intergenic
1194018389 X:88656385-88656407 CAGAGCAAGGAAATGTATCAGGG + Intergenic
1194115550 X:89892383-89892405 CAGAGCTTGGAGATGTACAAGGG - Intergenic
1194480697 X:94419573-94419595 CAGAGCTTGAAAATGTATGAAGG - Intergenic
1199002947 X:142662208-142662230 CAGAGGATGGAACAGTTTGAAGG + Intergenic
1199594353 X:149494716-149494738 GAGAGCATGTAGAAGTATCTAGG - Intronic
1200468344 Y:3549518-3549540 CAGAGCTTGGAGATGTACAAGGG - Intergenic