ID: 1106229687

View in Genome Browser
Species Human (GRCh38)
Location 13:27812252-27812274
Sequence CACAGCTACCACCCTAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106229687_1106229694 30 Left 1106229687 13:27812252-27812274 CCTGCACTAGGGTGGTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 173
Right 1106229694 13:27812305-27812327 GTCACTACTTGCTGATGGATTGG 0: 1
1: 0
2: 1
3: 21
4: 192
1106229687_1106229693 25 Left 1106229687 13:27812252-27812274 CCTGCACTAGGGTGGTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 173
Right 1106229693 13:27812300-27812322 CCGAAGTCACTACTTGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1106229687_1106229691 2 Left 1106229687 13:27812252-27812274 CCTGCACTAGGGTGGTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 173
Right 1106229691 13:27812277-27812299 TAGTGATCGGATATATTTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106229687 Original CRISPR CACAGCTACCACCCTAGTGC AGG (reversed) Intergenic
900024340 1:207042-207064 AACCTCTACCACCCAAGTGCTGG + Intergenic
900103175 1:971427-971449 CACAGCTGCCTCCCTGGGGCGGG - Intronic
900268782 1:1776025-1776047 CACAGCCTCCCCCCAAGTGCTGG + Intronic
900385177 1:2407313-2407335 CACTGCTGCCACCCTCCTGCTGG + Intronic
901210852 1:7525234-7525256 CACTGCTCCCACCCTGCTGCAGG - Intronic
901274870 1:7983474-7983496 CACTGTCACCAGCCTAGTGCAGG + Intronic
902277501 1:15350238-15350260 CAGAGCTTCCATCCTAGCGCAGG + Intronic
904826252 1:33275802-33275824 CACCCCTATCACCCCAGTGCTGG - Intronic
907035874 1:51215750-51215772 CACGGCCACCATCCTAGTTCAGG + Intergenic
911579206 1:99615983-99616005 CAAATGTACCACCCTGGTGCTGG + Intergenic
912697504 1:111852456-111852478 GACAGCTTCCAGCCTGGTGCTGG + Intronic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
916087015 1:161278301-161278323 CATCACTACCACCCTAGTCCAGG + Intronic
916923411 1:169492751-169492773 CACCACTACCACCCTAGTTCAGG + Intergenic
917016848 1:170541515-170541537 TACACCTTCCACCTTAGTGCTGG - Intronic
917876412 1:179290969-179290991 CACACCAACCAGCCTAGTCCAGG + Intergenic
918138463 1:181699717-181699739 CACTGCTGTCACCCTAGTCCAGG - Intronic
920258086 1:204670143-204670165 CACAGCCTCCACACTAGTTCAGG - Intronic
920492944 1:206432162-206432184 CACAGCTAACACCCTGGTCTAGG - Intronic
923112971 1:230907733-230907755 CATAGCAACCACTCTATTGCTGG - Intronic
1065508789 10:26456880-26456902 CCCAGCTACCATCCTAGTACAGG - Intronic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1072138764 10:92572448-92572470 CACTGCTACCATCCTAATACAGG + Intronic
1072215095 10:93281220-93281242 AACAGCTCCCACACTTGTGCAGG + Intergenic
1073005895 10:100324242-100324264 CAAAGGTACCACCCTGGTGTTGG - Intronic
1074665188 10:115714396-115714418 CCCAGGTACCACCCTAGAACAGG + Intronic
1077339999 11:2021998-2022020 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1078048137 11:7936813-7936835 GTCAGCAACCACCCCAGTGCTGG + Intergenic
1079122912 11:17697831-17697853 CACAGCTCCCACGCTAATGTGGG - Intergenic
1079280491 11:19082935-19082957 CGAAGCTACCACCCTATTTCTGG + Intergenic
1080633603 11:34104344-34104366 CACAACTACCATCCTAGCACAGG + Intergenic
1080685851 11:34514076-34514098 CAGAGATTCCACCCTGGTGCCGG + Intergenic
1081731737 11:45376510-45376532 CCAAGCTACCACCTTAGTGTGGG - Intergenic
1083563278 11:63691758-63691780 CATTGCTACCACCCTGGTCCAGG + Intronic
1084116571 11:67046027-67046049 CCCAGCACCCACCCTAGGGCTGG - Intronic
1086159809 11:83709532-83709554 TACATTTACCACCCCAGTGCTGG + Intronic
1087304877 11:96477085-96477107 CACAGCTAACATCATAGTGAAGG + Intronic
1088504014 11:110511746-110511768 CACCGCTACCACCCTAGGCCAGG + Intergenic
1088702143 11:112422954-112422976 AGCAGCTACCATCCTAGGGCTGG + Intergenic
1088895091 11:114072479-114072501 CACAGATACCACCTTACTGATGG + Intronic
1089583379 11:119495375-119495397 CACAGCCACCATCCTAGTCCAGG + Intergenic
1090889125 11:130907452-130907474 AACAGCTAGGGCCCTAGTGCAGG + Intronic
1202822984 11_KI270721v1_random:77187-77209 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1091378037 12:38577-38599 AACCTCTACCACCCAAGTGCTGG + Intergenic
1093652612 12:21661881-21661903 CCCATCTACCACCCAAGGGCTGG + Intronic
1095408166 12:41890858-41890880 TACCGCTATCACCCTAGTTCAGG + Intergenic
1098414139 12:70214590-70214612 CACAGAGGCCAGCCTAGTGCTGG + Intergenic
1099074183 12:78084275-78084297 CCCAGCTACCTCCCTACTGATGG + Intronic
1100360179 12:93870572-93870594 CAGAGCTTCCACCCTACTGGTGG - Intronic
1100405141 12:94266316-94266338 CACAGCTGCCATCCGAGAGCGGG + Intronic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1101134677 12:101730201-101730223 CACTGCTACTACCCTAGTTTAGG - Intronic
1101994029 12:109511878-109511900 CCCAGGGCCCACCCTAGTGCAGG - Intronic
1102123579 12:110462524-110462546 CACCGTGACCACCCTAGTCCTGG + Intronic
1102478195 12:113202372-113202394 CACAGCCCCCTCCCTGGTGCTGG - Intronic
1104186991 12:126442355-126442377 CTCAGCTCCCACGCTAGAGCAGG - Intergenic
1104917323 12:132272392-132272414 CAGCGCCACCACCCTACTGCCGG + Intronic
1104984900 12:132591296-132591318 CACAGCTCCCTGCCTGGTGCAGG + Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1106283308 13:28296791-28296813 TACTGCTACCACCCTAGTCCAGG - Intergenic
1108411084 13:50147716-50147738 AACAGGTACAACCCTAATGCAGG + Intronic
1109233816 13:59791514-59791536 CTCTGCTACCACCCTATGGCAGG - Intronic
1111784735 13:92772112-92772134 CACAGCTGCCACCCTAGTCTCGG + Intronic
1112552283 13:100432748-100432770 CACTGCTTGCACCCTAGTGGAGG - Intronic
1113723629 13:112580894-112580916 CACAGCTACCATCCCATTACAGG + Intronic
1118575034 14:67233683-67233705 CACTGCTACCACCCTCCTCCAGG - Intergenic
1119600078 14:75969903-75969925 CACTGCTACCGCCCTAGTCTCGG + Intronic
1120860134 14:89247599-89247621 CACTGCTACCACCATAGTCTCGG + Intronic
1123128978 14:105970493-105970515 CTCAGCTACCAGGCTTGTGCAGG - Intergenic
1125727566 15:41875828-41875850 CCCAGCCACCAACCTAATGCCGG - Intronic
1126846789 15:52767394-52767416 CTCAGCTACCATTCTAGTTCAGG - Intronic
1126961045 15:53994876-53994898 CAGAGCTACCACCTTAGTTCAGG - Intergenic
1127418472 15:58780833-58780855 TACTGCTACTACCCTAGTTCAGG + Intronic
1129016205 15:72471433-72471455 CACTGCCACAACCCTAGTTCAGG + Intergenic
1133889774 16:9868141-9868163 CACAGCCACCACCCTCATCCAGG + Intronic
1134138338 16:11695623-11695645 CACCTCTACCACCCAAGTTCAGG + Intronic
1136400514 16:30015063-30015085 CACAGTTACCATTCTTGTGCAGG - Intronic
1136867216 16:33767968-33767990 CACAGCCATCACCCTGGTCCGGG + Intergenic
1139026567 16:62824985-62825007 AACAGCTCCCACCCTGATGCTGG - Intergenic
1139213751 16:65107406-65107428 CAATGCTTCCACCCTCGTGCTGG + Intronic
1142129436 16:88425995-88426017 TACAGGTACCAACCTCGTGCTGG + Intergenic
1203104946 16_KI270728v1_random:1348235-1348257 CACAGCCATCACCCTGGTCCGGG - Intergenic
1203128568 16_KI270728v1_random:1614133-1614155 CACAGCCATCACCCTGGTCCGGG + Intergenic
1146726988 17:35164421-35164443 CACAGCTGGCACACTGGTGCTGG + Intronic
1149579714 17:57741141-57741163 CACAGCTGCAACCTTAGTCCTGG - Intergenic
1150323614 17:64237563-64237585 CACAGCCACCCCGCTAGTCCGGG - Intronic
1150414679 17:64977028-64977050 CACAGGTCCCACGCTAGTGAGGG - Intergenic
1150796914 17:68246435-68246457 CACAGGTCCCACGCTAGTGAGGG + Intergenic
1150908380 17:69362503-69362525 CACAGCCACCATCTTAGTCCAGG - Intergenic
1152341787 17:79729672-79729694 CACAGCCACCACCCTGGTCCGGG + Intergenic
1157299712 18:46470772-46470794 CACTGCTACCAACCTGGTCCGGG + Intergenic
1157617890 18:48998229-48998251 CACAGCTTCCTCCCTCCTGCTGG + Intergenic
1158172596 18:54616372-54616394 CACTGCTACAATCCTAGTCCAGG - Intergenic
1164817193 19:31213606-31213628 CAAAGGTACCACCCTGGTGGGGG + Intergenic
1165098190 19:33421852-33421874 CACAACTCCCTCCCTGGTGCAGG + Intronic
1165547867 19:36556768-36556790 CAGAGCCACCATTCTAGTGCTGG - Intronic
1168128050 19:54298114-54298136 CACAGTGACCCCCCTGGTGCTGG - Intergenic
927662448 2:25004341-25004363 CATATCTCCCACCCTATTGCTGG - Intergenic
930187129 2:48421337-48421359 CATACCTACCACCCAAGTTCTGG + Intergenic
932365965 2:71153816-71153838 CGCAGCTGCCACCCTAGTGAGGG - Intergenic
934663238 2:96154205-96154227 CACAGCTCCCAGCCCTGTGCTGG - Intergenic
935027649 2:99292527-99292549 CATAGCTACCACAGTAGTTCAGG + Exonic
936565111 2:113576917-113576939 AACCTCTACCACCCAAGTGCTGG - Intergenic
942171923 2:173297728-173297750 CACAGCCACAACCCTGGTGCCGG - Intergenic
942888909 2:180963527-180963549 CATAGCTCCCACCCTAGCACAGG - Intergenic
944486933 2:200216681-200216703 CATAACCACCACCCTAGTGCAGG - Intergenic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
948978819 2:241482187-241482209 CACAGTTACTACCCTAGGGCTGG + Intronic
1168781493 20:495091-495113 CAGAGGCACCACCCTAGGGCTGG - Intronic
1170611629 20:17918487-17918509 CAAATCTACCACCCTGGTACGGG + Intergenic
1170931714 20:20774497-20774519 CAGACCTAGCACCCCAGTGCAGG + Intergenic
1172219782 20:33265825-33265847 CACACAGACCACCCTAGTACAGG + Intergenic
1173093965 20:40006322-40006344 CATTGCTACCATCCTAGTCCAGG - Intergenic
1173115027 20:40233130-40233152 CACAGCAAGCACCCTTATGCTGG - Intergenic
1174420716 20:50397354-50397376 CACAGCTACCACCGAGGTGCAGG + Intergenic
1176033310 20:63024283-63024305 AACAGCCGCCACCCTCGTGCGGG + Intergenic
1178720852 21:35007722-35007744 CACTGCCACCACCCTCGTTCAGG + Intronic
1180906167 22:19413495-19413517 CACAGATACCAGCGCAGTGCTGG + Intronic
1180985104 22:19899392-19899414 CCCAGCTTCCACCCTAGCCCAGG - Intronic
1182051523 22:27316149-27316171 CACAGCCACCACCCAAGTCCAGG + Intergenic
1182263016 22:29089450-29089472 CACAGCTGCCAGCCTAGTCCAGG + Intronic
1183864407 22:40692837-40692859 CACTGCCACCACCCTAATCCAGG - Intergenic
1183977051 22:41518305-41518327 CAGAGCTCACACCCTAGTGCAGG - Intronic
950542038 3:13618562-13618584 CCCAGCTATCTCCCCAGTGCTGG + Intronic
950715105 3:14842329-14842351 CACAGAGACCAACCTGGTGCAGG + Intronic
951292640 3:20892330-20892352 CACAGCTACTGCCCTAGTGTGGG - Intergenic
953836382 3:46349279-46349301 CACAGATTCCTCCCTAGAGCAGG + Intergenic
955677966 3:61469225-61469247 CAAATGTACCACTCTAGTGCAGG - Intergenic
956498495 3:69854977-69854999 CACAGTCACCAACCTAGGGCTGG - Intronic
957528888 3:81415067-81415089 CAAAGCTACCACCCAAGTCAAGG + Intergenic
961483015 3:127196185-127196207 CACAGGGGCCACCCCAGTGCAGG - Intronic
963890089 3:150625522-150625544 AACTGCCACCACCCTAGTCCAGG + Intronic
965164226 3:165174332-165174354 CAATGCTACTACCCTAGTCCAGG + Intergenic
965961391 3:174432163-174432185 AACAGCTACTACCCTAGGGCTGG - Intergenic
968249143 3:197190264-197190286 CACAGATAGCACAGTAGTGCAGG + Intronic
968288479 3:197521785-197521807 AACACCTACCACCCTAGTTCCGG + Intronic
969337484 4:6520206-6520228 CACATCTCCCACCCTGGGGCAGG - Intronic
969564089 4:7967489-7967511 CACAGCTGCCATCCGAGAGCAGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973134020 4:46683436-46683458 CACAGCTCCCAGCCGAGTTCAGG + Intergenic
973140826 4:46765943-46765965 CACGGAGACCATCCTAGTGCTGG - Intronic
973305986 4:48650838-48650860 CACAGCCACTATCCTAGTTCAGG - Intronic
976035143 4:80809542-80809564 AATTGCCACCACCCTAGTGCAGG + Intronic
980391074 4:132147408-132147430 CAAATCTACCACTCAAGTGCAGG + Intergenic
980954198 4:139411453-139411475 CACAACCACCACCCTGGTCCAGG - Intronic
986236183 5:5912964-5912986 CATAGCTTCCACTCTAGTGACGG + Intergenic
986669046 5:10127117-10127139 CACAGGGCCCACCCTTGTGCCGG - Intergenic
988849490 5:35164799-35164821 CACCGCTACCATCCTAATCCTGG - Intronic
989277342 5:39604693-39604715 CAAATCTACCACTCTGGTGCAGG - Intergenic
990890380 5:60642445-60642467 CACAGGGACCACCCTGGTCCAGG + Intronic
990950207 5:61291223-61291245 AACAGCTCCCATCCAAGTGCTGG + Intergenic
992747135 5:79830669-79830691 CACAGCGACCAACCCAGTTCAGG - Intergenic
994203096 5:97001203-97001225 CACAACTTCCACCCTTGTCCAGG - Intronic
995905993 5:117123802-117123824 CAAAGTTACCACCATAGTGGAGG - Intergenic
997247504 5:132362948-132362970 CACAGTTACCACTCTAGTTCAGG + Intergenic
998225930 5:140326206-140326228 CTCTGCTACCACCCTAATTCTGG + Intergenic
998551365 5:143080902-143080924 CACCACTACTACCCTAGTCCAGG - Intronic
998855367 5:146389889-146389911 CACGGTTACCACCCTAATCCAGG + Intergenic
1001065312 5:168530729-168530751 CACAGCTCCCAGGCTACTGCTGG - Intergenic
1006421575 6:33937466-33937488 CACATGTACCACTCTGGTGCAGG - Intergenic
1006642301 6:35495726-35495748 CACATGTTCCACCCCAGTGCTGG - Intronic
1011706098 6:90003013-90003035 CACTGCTATCACCCTGGTGTAGG + Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1017445239 6:154501789-154501811 CACATCTACCACACTAAAGCCGG + Intronic
1017978237 6:159376181-159376203 CACATCTTCCTCCCTAATGCCGG - Intergenic
1018520225 6:164641131-164641153 CACAGCTACCACCCCCATGCTGG + Intergenic
1019402834 7:866397-866419 CACAGCTGCCACTCTCGTGACGG - Intronic
1019614491 7:1952986-1953008 CACAGCTGCCCCCTTTGTGCTGG - Intronic
1019678330 7:2329384-2329406 CACAGTCAGCACCCTATTGCCGG + Intronic
1022802111 7:33786594-33786616 CACTGGCACCACCTTAGTGCGGG - Intergenic
1023024860 7:36041187-36041209 CACTGCTAGCACCCTAATCCAGG - Intergenic
1025250260 7:57347111-57347133 CACAGCTACCACCGAGGTGCAGG - Intergenic
1027463730 7:78487593-78487615 TTCAGCTAACATCCTAGTGCAGG - Intronic
1030723945 7:112902672-112902694 CAAATGTACCACTCTAGTGCTGG + Intronic
1035656527 8:1311433-1311455 CTCAGCTACCACGGTAATGCTGG - Intergenic
1035875442 8:3183856-3183878 CACAACAATCACCCCAGTGCAGG + Intronic
1036755918 8:11471090-11471112 CAGAGCGTCCACCTTAGTGCTGG + Intronic
1038407184 8:27330887-27330909 AGCAGCAACCACCTTAGTGCTGG - Intronic
1039391672 8:37185809-37185831 CCCAGGTACCACCCCAGAGCAGG - Intergenic
1042568320 8:70135030-70135052 CACCACTACCACCCTATTCCAGG - Intronic
1042810691 8:72822531-72822553 CACCTCCACCACCCTAGTCCAGG + Intronic
1043064803 8:75555137-75555159 CATTGCTACCACCCTAGTCCAGG - Intronic
1043142719 8:76609738-76609760 TACTGCCACCACCCTTGTGCAGG - Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1043859881 8:85303839-85303861 CACACCCATCACCCTAGTTCAGG + Intergenic
1046975539 8:120271981-120272003 CATTGCTACCACCCTAGTCCAGG - Intronic
1049226198 8:141451694-141451716 CGCTGCCACCACCCTAGTCCAGG - Intergenic
1049246566 8:141565883-141565905 CACTGCTACCAGCCTGGTACAGG + Intergenic
1050302026 9:4268877-4268899 AACAGCTACTGCCCTAGTGCTGG - Intronic
1057354719 9:94323773-94323795 CCCAGCATCGACCCTAGTGCGGG + Intronic
1057653039 9:96933862-96933884 CCCAGCATCGACCCTAGTGCGGG - Intronic
1059112301 9:111568862-111568884 CCCTGCTACCACCCTGGTCCAGG - Intronic
1061267244 9:129514047-129514069 CACAGCTGCCACCCAAGTTGTGG + Intergenic
1061750364 9:132772869-132772891 CACAGCTACCACCCTGGTCCAGG + Intronic
1062144681 9:134982506-134982528 CGCAGCCAGCACCCTCGTGCTGG + Intergenic
1188455258 X:30356903-30356925 CACAGCTATCACCCTAGCTCAGG - Intergenic
1191709939 X:64139042-64139064 CATTGCTACCACCTTAGTCCAGG + Intergenic
1194277511 X:91903846-91903868 CACCTCTACTACCCTAGTCCTGG - Intronic
1195254565 X:103079732-103079754 CACAGCTCCGACCCTGGTCCAGG - Intronic
1195684651 X:107574745-107574767 ACCAGCCACCACCCTAGTGGAGG + Intronic
1196384190 X:115130578-115130600 CACAACTACCACCCTTTTCCAGG + Intronic
1198137589 X:133769681-133769703 CTTAGCTACCACCTTAGTTCTGG + Intronic
1199985758 X:152948980-152949002 CACAGCTAGTCCCCTAGTCCAGG - Intronic
1200594855 Y:5125935-5125957 CACCTCTACTACCCTAGTCCTGG - Intronic