ID: 1106230187

View in Genome Browser
Species Human (GRCh38)
Location 13:27815476-27815498
Sequence GTGAAGAGGCTGGATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106230187 Original CRISPR GTGAAGAGGCTGGATGAGCC AGG (reversed) Intergenic
900429760 1:2596049-2596071 GTGGAGACGCTGGACGAGCTGGG - Exonic
900488653 1:2935498-2935520 GGGAAGGGGCAGGATGAGCAGGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
900913609 1:5619270-5619292 GTGAAGAGGAAGGCTGAGCCTGG - Intergenic
902203188 1:14849022-14849044 GGGCAGGGGCTGGATGATCCCGG - Intronic
902638233 1:17749254-17749276 GTTCAAAGGCTGAATGAGCCAGG - Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903138419 1:21324296-21324318 GTTAAGAAGCTATATGAGCCCGG - Intronic
903276170 1:22223370-22223392 GTGAAGAGGGTGGGTGACTCAGG + Intergenic
904409544 1:30317193-30317215 GGGAAGAGGCTAAATGAGGCAGG - Intergenic
904977929 1:34472729-34472751 GGGAAAAGGCTGGGTGACCCAGG + Intergenic
905776944 1:40674396-40674418 GTCTAGAGGCTGGAGGGGCCAGG - Intergenic
905881839 1:41468908-41468930 GGGAAGAGGAGGGAGGAGCCAGG - Intergenic
906096967 1:43230512-43230534 GAGAAGAGGCTGGCTGAGCTAGG - Intronic
906346351 1:45017718-45017740 CTGAAGAGGCTGTGTGAGGCAGG + Exonic
907599439 1:55751881-55751903 AGGAACAGGCTGGAGGAGCCAGG - Intergenic
907644229 1:56225367-56225389 GTTAAGAAGCTGACTGAGCCGGG - Intergenic
907903674 1:58764780-58764802 GTGTTGAGGCTGAAAGAGCCTGG + Intergenic
910971722 1:92862599-92862621 GTGGAGAGGGTGGATTAGACAGG - Intronic
912551308 1:110487195-110487217 GACAAGAGGTTGGATGTGCCTGG - Intergenic
915338066 1:155159234-155159256 GAGAAGGGGCTGGGTGAGTCAGG + Intergenic
916677052 1:167072894-167072916 GGGAAGAGGGTGGGTGAGACAGG + Intronic
919777247 1:201202265-201202287 GTGATGAAGCTGGATGAGTTTGG - Intronic
919911468 1:202113487-202113509 GGGGTGAGGCTGGAGGAGCCTGG - Intergenic
920279761 1:204834138-204834160 GAGAATAGGCAGGATGAGGCAGG - Intronic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
923624963 1:235606468-235606490 GTGGTGAGGGTGGAAGAGCCAGG + Intronic
924571609 1:245241896-245241918 GAGATGAGGCTGGGTGAGTCAGG - Intronic
1063006128 10:1972335-1972357 GTGAAGTGGCTGTACGAGGCTGG - Intergenic
1064102766 10:12477594-12477616 GTGAAGGGGCTGGAAGAGACAGG + Intronic
1064669414 10:17695108-17695130 GTTAAGAGACTGGATGTGCTTGG - Exonic
1067057466 10:43060666-43060688 GGGAGGAGGCTGCATGACCCAGG + Intergenic
1067580655 10:47443535-47443557 GTGCAGGGGCTGGGTGAGCTGGG - Intergenic
1067913781 10:50374701-50374723 GGGGAGAGGCTGGATGAGTGAGG - Intronic
1067925390 10:50503455-50503477 CTTTAGAGCCTGGATGAGCCAGG - Intronic
1067963368 10:50881283-50881305 GTTAAGAGGCTAGATGAGGCCGG - Intronic
1068617265 10:59132828-59132850 GGGTAGAGGCTGGAGGAGGCAGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070427598 10:76304579-76304601 GTGCAGAGGCTGACTTAGCCTGG + Intronic
1070617098 10:77977559-77977581 GTGAAGCAGCTTGAAGAGCCCGG + Exonic
1071769205 10:88705891-88705913 GTGATGCAGCTGGATGAGGCAGG + Intergenic
1071778053 10:88811091-88811113 GTCAAGATGCTGGATGAGTTTGG + Intronic
1072429187 10:95356070-95356092 GTGAAGCGGGTGTATGAGGCCGG + Intronic
1072840170 10:98764556-98764578 GTTAAAAGGATGGATAAGCCAGG + Intronic
1072937682 10:99729249-99729271 GTGAGGAGTTTGGATCAGCCTGG + Intronic
1073805638 10:107094839-107094861 GTGAAGGGGCTGGCTGTGTCAGG - Intronic
1075521177 10:123144608-123144630 GGAAATAGGCTGGCTGAGCCGGG - Intergenic
1075635751 10:124029253-124029275 ATCAGGAGGCTGGATGAGACAGG + Intronic
1076135107 10:128040329-128040351 GTGATGAGGCTGCATGAACTAGG + Intronic
1076426228 10:130369514-130369536 GAGGAGAGGCTGGGAGAGCCTGG + Intergenic
1076426465 10:130370773-130370795 GTGAAGACGCTGGCAGAACCCGG - Intergenic
1076670955 10:132120895-132120917 GTGGAGGGGCTGGGAGAGCCAGG + Intronic
1077059841 11:613271-613293 GTGGAGGGGCTGGCGGAGCCTGG + Exonic
1077146904 11:1050504-1050526 GTGGAGAGGCTGGATGCCCTTGG + Intergenic
1078559268 11:12356636-12356658 GAGGTGAGGCTGGGTGAGCCAGG - Intronic
1079094911 11:17503968-17503990 GTGAGGAGGCTGGAGAAGCCTGG + Intronic
1080157646 11:29130729-29130751 GAGATGAGGCTGGGTGAGCCAGG + Intergenic
1080774121 11:35369993-35370015 GTGAAGAGGGAGGATGATTCAGG + Intronic
1083032884 11:59610380-59610402 GTGAAGATGCTGGCAGAGTCAGG - Exonic
1083185828 11:61017396-61017418 GAGAAGAGGCTGGATTTCCCGGG - Intronic
1083958991 11:66003461-66003483 CTGAAGAGGCTGCCAGAGCCTGG + Intronic
1084418414 11:69048154-69048176 GTTAACATCCTGGATGAGCCTGG + Intergenic
1084726579 11:70946149-70946171 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726606 11:70946258-70946280 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726648 11:70946439-70946461 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084726762 11:70946877-70946899 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726771 11:70946914-70946936 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1084726781 11:70946951-70946973 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085412164 11:76297739-76297761 GTGAAGAGACTGGAAGAACAAGG - Intergenic
1085581635 11:77656256-77656278 GTGAATATGCTTGATGAGGCAGG + Intergenic
1089090668 11:115872171-115872193 TTGAAGTGGCTGGATGAGCATGG - Intergenic
1089281236 11:117376100-117376122 GTAAAGAGGATGAATGGGCCAGG - Intronic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1090418695 11:126558515-126558537 ATGAAGTGGCTGGAAGAGCCAGG - Intronic
1090774086 11:129947739-129947761 GTGAAACGGCTGAATGAGCCAGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091909369 12:4216494-4216516 GAGAAAAGGCTGGATAAGTCAGG + Intergenic
1092912986 12:13164624-13164646 GTGAGATGGCTGGAAGAGCCCGG - Intergenic
1093829319 12:23736556-23736578 GTGATGAGGATGGATGTACCTGG + Intronic
1095481456 12:42640409-42640431 GTGAAGAGGCTGGAAGTTCCAGG - Intergenic
1095952233 12:47787887-47787909 ATGGGGAGGCTGGATGAGCTGGG - Intronic
1096808117 12:54152721-54152743 GAGAAGAGGCTGGGATAGCCAGG + Intergenic
1097687284 12:62702922-62702944 GTGAACTGGCTGTATGAACCTGG + Intronic
1097740336 12:63234196-63234218 GAGATGAGGCTGGAAGAGTCAGG - Intergenic
1098753103 12:74321512-74321534 GTGAGGAGACTGAATGAGCTGGG - Intergenic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1103926750 12:124427555-124427577 GTGAAGAGGTTGGATGTGGGCGG - Intronic
1104667161 12:130655913-130655935 GGGAAGATGCTGGGAGAGCCAGG + Intronic
1104915833 12:132263999-132264021 CTGAAGAGGCTGGAGGCCCCCGG - Intronic
1106123682 13:26882745-26882767 GTGAAGAGGCTGGAAGGACGGGG - Intergenic
1106230187 13:27815476-27815498 GTGAAGAGGCTGGATGAGCCAGG - Intergenic
1106607967 13:31249371-31249393 CTGAAAAGACTGGATGAGACAGG - Intronic
1107154051 13:37145929-37145951 GTGAAGGTGATGCATGAGCCTGG + Intergenic
1107677556 13:42812557-42812579 GTGAAGAGGCTTCATCAGCAAGG + Intergenic
1108718973 13:53110561-53110583 GGGAAGTGGCTGGGTCAGCCAGG + Intergenic
1111153705 13:84294707-84294729 GTGAAGAGGCTTGAAGAGAGAGG + Intergenic
1112107635 13:96259204-96259226 GTGCACAGGCTGGAGGACCCGGG + Intronic
1112654070 13:101430089-101430111 CTGAAGAGGATGGGTGAGGCAGG - Intergenic
1113577277 13:111403471-111403493 GTGACCAGGCTGGGGGAGCCGGG + Intergenic
1113677687 13:112218590-112218612 GTGAAGATGATGGAGGTGCCAGG - Intergenic
1113766882 13:112887519-112887541 CTGAAGGGCCTGGAGGAGCCTGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115774666 14:36702269-36702291 CTGAAGAGGTTGAATGAACCAGG - Intronic
1116869927 14:50061088-50061110 GAGAAGAGGCTGGAAGAGGGTGG + Intergenic
1117971976 14:61260688-61260710 GTTAAAAGGCTGGATGAGAGTGG + Intronic
1119423155 14:74519928-74519950 CAGAACAGGCTGGAGGAGCCAGG - Intronic
1119541467 14:75441012-75441034 CTGGGGAGGCTGGATGAACCTGG + Intronic
1121398287 14:93647636-93647658 GGGAAGAGGCAGTGTGAGCCAGG + Intronic
1122064259 14:99160452-99160474 GCAAAGAGGCTGGAGGGGCCTGG + Intergenic
1122298224 14:100717398-100717420 GTGGAGAGGGTGGATGAGTGTGG - Intergenic
1122606983 14:102953284-102953306 GGGAAGAGGCTGGCTGAGGTGGG + Intronic
1122622625 14:103068478-103068500 GTGAAGAGGCTGGCAGTGCCGGG + Intergenic
1122784075 14:104155858-104155880 GGGAAGAGGGTGGAGGGGCCGGG + Intronic
1124661453 15:31553829-31553851 GAGAAGAAGCTGGAAGAGCAGGG - Intronic
1125182128 15:36888917-36888939 GTGAGGAGGCAGGAGGATCCTGG + Intergenic
1125523611 15:40361865-40361887 GTGAGCAGGCTGGGTGAGCCAGG + Intronic
1125540520 15:40467322-40467344 GTGAGGGGGCTGGAGCAGCCTGG + Exonic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1129155821 15:73716957-73716979 TAGAAGAGGCAGGATGATCCAGG - Intergenic
1130299215 15:82667248-82667270 GTAAAGAGGCTGGACAGGCCTGG - Intronic
1130866385 15:87936484-87936506 ATGAAGATGCTGAATGACCCAGG - Intronic
1131829910 15:96347575-96347597 GTGGAGGGGCTGGCGGAGCCTGG - Intergenic
1132548362 16:543936-543958 GTGCACAGGCTGGTGGAGCCTGG + Intronic
1133008843 16:2899020-2899042 GAGAAGAGGGTGGATCAGGCTGG - Intronic
1133282680 16:4676153-4676175 GTGAAGAGGCTGCTGGGGCCTGG + Intronic
1133509136 16:6440876-6440898 GTGAACAGTATGGATGAGCTGGG + Intronic
1134018183 16:10903808-10903830 GCGAAGGGGCTGGTGGAGCCTGG - Exonic
1134080079 16:11319088-11319110 GTGATGAGGATGGAGGAGCTGGG + Intronic
1134680604 16:16122298-16122320 ATGGAGAGGCTTGATGAGCGCGG + Intronic
1135316589 16:21451576-21451598 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1135369512 16:21883821-21883843 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1135442302 16:22487306-22487328 GTGAAGAGACTGGAGGTGCGGGG + Intronic
1136326702 16:29532055-29532077 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1136441392 16:30272039-30272061 GTGAAGAGACTGGAGGTGCGGGG - Intergenic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136590669 16:31216010-31216032 GTGCAGGGGCTGGAGGAGGCGGG + Exonic
1137533843 16:49302234-49302256 GAGAAGAGCCAGGGTGAGCCAGG - Intergenic
1138459012 16:57137117-57137139 GAGAAGAGTCTGGATCAGCCAGG - Intronic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1139348089 16:66317423-66317445 GTTAAGAGGGTGGATGAGGGTGG - Intergenic
1141487382 16:84349759-84349781 GAGAGGAGCCTGGATTAGCCAGG + Intergenic
1141610268 16:85177185-85177207 GGGGTGAGGCTGGAGGAGCCAGG + Intronic
1141664420 16:85458520-85458542 ATGGAGAGGCTGGTTGAGCTGGG + Intergenic
1142218091 16:88839675-88839697 GTGCAGTGGCTGGATGGCCCGGG - Intronic
1142235911 16:88922446-88922468 GGGAAGGGGCTGTATGGGCCTGG + Intronic
1142603197 17:1067281-1067303 GAGTTGAGGCTGGAAGAGCCAGG - Intronic
1142996500 17:3763755-3763777 GTGAACGGGCTGGATGAGGCAGG + Intronic
1144943916 17:18960193-18960215 ATGATGAGGCTGGATGAGGGAGG - Intronic
1144944395 17:18962338-18962360 GGGAAGAGGCAGGATGTGTCTGG + Intronic
1145102168 17:20086382-20086404 GTGAAGAGGCTGGCTGAGGAGGG - Intronic
1146951183 17:36907643-36907665 GCCAGGAGGCTGGATTAGCCGGG - Intergenic
1147298413 17:39503716-39503738 GGGAAGAGGCTGGATGGATCAGG - Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148439014 17:47702287-47702309 GTGTCGAGGCTGGATGACCCAGG + Intronic
1148458076 17:47821541-47821563 GTGAAGGGTCTAGGTGAGCCAGG + Intronic
1149323738 17:55508630-55508652 GTGAAGATGGTGGCTGAGCGCGG + Intergenic
1149865096 17:60147177-60147199 AGGAAGAGCCTGGATGTGCCAGG + Intergenic
1150209309 17:63433565-63433587 GAGCAGAGCCTGGGTGAGCCTGG + Exonic
1150834810 17:68554739-68554761 GTGAAGAGGCTGGGTGGGGGTGG + Intronic
1151538502 17:74751965-74751987 CTGCAAAGGCTGGCTGAGCCTGG - Intronic
1151837161 17:76589475-76589497 GTGAAGAGGCTGGCTCTCCCTGG - Intergenic
1152385914 17:79974706-79974728 GAGAAGAGCCTGGGAGAGCCAGG - Intronic
1152520513 17:80853279-80853301 GTGGAGAGGCTGGAAAAGCCCGG - Intronic
1152567961 17:81108552-81108574 GTGAAGAGGCCGGGTGGGGCAGG + Intronic
1153032989 18:732498-732520 GGGTATAGGGTGGATGAGCCAGG + Intronic
1153879202 18:9405545-9405567 GTGAGGAGGATCGCTGAGCCAGG - Intergenic
1154033352 18:10773534-10773556 GTGAGGAAGTTGGCTGAGCCTGG - Exonic
1154121676 18:11657510-11657532 CTGAGGAGGCTGGGTGGGCCAGG - Intergenic
1155984610 18:32216804-32216826 GTGGAAAGGCTGTCTGAGCCTGG + Intronic
1156031709 18:32720884-32720906 GTGAAGAAGCCTGATGGGCCTGG - Intronic
1157304585 18:46507772-46507794 GGGGAGGGGCTGCATGAGCCAGG - Intronic
1158532745 18:58278353-58278375 GTGAAGAGGCAGGAGGGGCAGGG - Intronic
1158573245 18:58614406-58614428 GTGCAGAGGCTGGATGACATGGG + Intronic
1158580931 18:58682072-58682094 GCAAAGAGGCTGGTTGAGCTTGG + Intronic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1160204404 18:76821862-76821884 GTGGAGAGGCCGGCCGAGCCCGG - Intronic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160528953 18:79552548-79552570 GGGAAGAGGCTGGAGGAGAAAGG + Intergenic
1160621747 18:80176016-80176038 GAGAAGAGGCTGGCTGTACCCGG + Intronic
1160757320 19:764559-764581 GAGACGGGGCTGGAGGAGCCGGG - Intergenic
1160879206 19:1311858-1311880 GCGAGGGGGCTGGGTGAGCCTGG - Intergenic
1161026013 19:2037720-2037742 GTGAAGATCCTGGAGGACCCTGG - Exonic
1161239673 19:3215191-3215213 GAGAAGACACTGGAAGAGCCTGG + Intergenic
1162795672 19:13086323-13086345 GGGGAGAGGATTGATGAGCCTGG + Intronic
1164616850 19:29672411-29672433 GGGAAGAGGCTGCCTGAGCTGGG + Intronic
1166273345 19:41732778-41732800 GTGAACTGGCTGGATGACCCTGG + Intronic
1166278411 19:41772615-41772637 GTGAACTGCCTGGATGATCCTGG + Intergenic
1166414014 19:42579038-42579060 ATGAACTGGCTGGATGATCCTGG - Intergenic
1166429442 19:42711876-42711898 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166450855 19:42899617-42899639 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166462763 19:43003962-43003984 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166468904 19:43060420-43060442 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166480050 19:43163941-43163963 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166489868 19:43249472-43249494 ATGAAGTGGCTGGATGACCCTGG - Intronic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
925084781 2:1099527-1099549 CTGAAGAGGCTGGAGGTCCCAGG + Intronic
925762649 2:7200510-7200532 GTGAAGAGACAGCATGCGCCAGG - Intergenic
925783222 2:7403053-7403075 GTGAAGAGGATGGATTATGCAGG - Intergenic
926465499 2:13181633-13181655 GTGAAGGGGCTGCATAGGCCAGG - Intergenic
929053424 2:37856642-37856664 TGGCAGAGGCTGGATAAGCCTGG - Intergenic
929586035 2:43115048-43115070 GAGAAGAGGCTGGATGGCACAGG - Intergenic
931569110 2:63649690-63649712 GTTAATAGGCTGGCTGAGCAGGG - Intronic
932002020 2:67893841-67893863 GTGAAGAGGCTGCATGTGCAGGG - Intergenic
933439883 2:82298629-82298651 GAGAAGAGGCTGGAAGAGTTTGG - Intergenic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
933943252 2:87262806-87262828 GTGCAGGGGCTGGGTGAGCCTGG + Intergenic
934562197 2:95319225-95319247 GTGCGGAGGCTGGTGGAGCCGGG + Intronic
934569569 2:95360477-95360499 GAGTAGAGGCTGGAAGAGTCTGG - Intronic
936104560 2:109613847-109613869 GTGAAGCGGCTGTATCAGCCCGG + Exonic
936336962 2:111598755-111598777 GTGCAGGGGCTGGGTGAGCCTGG - Intergenic
937151281 2:119687702-119687724 GTGAAGGTGCTGGCTGAGGCTGG - Intergenic
937681994 2:124654077-124654099 GTGAAGGGACAGGATGAGGCAGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941969648 2:171336047-171336069 GTGAACAGGAAGGGTGAGCCTGG + Intronic
942073369 2:172335239-172335261 GTGAAGAAGGTGCAAGAGCCTGG - Intergenic
944112184 2:196144622-196144644 GGGATGATTCTGGATGAGCCAGG + Intronic
944545139 2:200791461-200791483 GAGAGGAGGCTGGATGTTCCTGG - Intergenic
946310968 2:218882450-218882472 GTGGAGATGCTGGATGGGGCAGG - Intronic
946426546 2:219601453-219601475 GGGAAGAGGCAGGATGTGCAAGG + Intronic
946501186 2:220249111-220249133 GGCAAGAAGCTGGAAGAGCCAGG + Intergenic
948509235 2:238452186-238452208 GTGAAGATGTGGGATGAACCTGG + Exonic
948762280 2:240199544-240199566 GTGCAGAGGGTGGGTGGGCCTGG - Intergenic
1169125028 20:3121336-3121358 GGGAAGGAGATGGATGAGCCTGG + Intronic
1170567782 20:17616517-17616539 GTGGAGAGGCTGGAGGAGTTGGG - Intronic
1170809366 20:19661773-19661795 GAGAAGAGGCTGGCTGAGCTGGG - Intronic
1172684929 20:36746215-36746237 GAGAAGATGGTGGCTGAGCCAGG + Intergenic
1172909843 20:38399867-38399889 GTGAAGAGGCTGCAAGAGAGTGG + Intergenic
1173900871 20:46588065-46588087 TTGAAGAGGCTGGCCCAGCCAGG + Exonic
1174186000 20:48706827-48706849 CTGAAGGGGCTAGAGGAGCCAGG + Intronic
1175300815 20:57941466-57941488 GGGAAGAGGCAGGACGTGCCAGG + Intergenic
1175389289 20:58616115-58616137 TTGAAGAGGCTGGGTGAGCTGGG + Intergenic
1175801356 20:61802770-61802792 GAGGAGAGGCTGGAGGAACCGGG + Intronic
1178797157 21:35755577-35755599 GGGAGGAGGCTTGATGAGGCAGG + Intronic
1179080170 21:38163420-38163442 CTGAAGAGGATGGGTGAGCAGGG - Intronic
1179466883 21:41581731-41581753 GCGCAGGGGCTGGATGAGACAGG + Intergenic
1180245878 21:46546855-46546877 GGGCAGAAGCTGGATGCGCCAGG - Intronic
1181364833 22:22367913-22367935 GTGAAAAGGCTGAATAAGACTGG + Intergenic
1181371979 22:22425927-22425949 GGGAAGTGGCTCGGTGAGCCGGG - Intergenic
1182141885 22:27966653-27966675 GTGCAGGGGCTGGCTTAGCCCGG + Intergenic
1182833310 22:33321323-33321345 TGGTAGGGGCTGGATGAGCCAGG + Intronic
1183733752 22:39632209-39632231 GAGAAGAGGCTGGATGAGAAGGG - Intronic
1184251781 22:43264688-43264710 GTGAAGAAGCTGGAACAGCAGGG - Intronic
1185125508 22:49008647-49008669 CTGAAGTGGGTGGATCAGCCTGG - Intergenic
950612325 3:14134359-14134381 CTGGGGAGGCTGGATGATCCTGG + Intronic
954448692 3:50560234-50560256 GCAAAGAGGCTGGATAAGTCAGG + Intronic
954579629 3:51696271-51696293 GTGAAGAGCCTGGGTGGGCCTGG - Intronic
955264621 3:57429464-57429486 GTGAAGAGGATGGCTGGGCACGG - Intronic
956749189 3:72332768-72332790 GTGCAGAGCCTCGAGGAGCCAGG + Intergenic
958676974 3:97277365-97277387 GGGATGAGCCAGGATGAGCCAGG + Intronic
961670076 3:128522733-128522755 GGGAAGAAGCTGGAAGAGACTGG + Intergenic
963750920 3:149179089-149179111 GTGAAGTGCCTGAGTGAGCCGGG - Intronic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
966102966 3:176296444-176296466 GAGAAGAGGCAGGATCATCCTGG - Intergenic
966366264 3:179190976-179190998 GTGAAAAGTCTGTATGGGCCTGG + Intronic
967684515 3:192404580-192404602 GTGAAAAGGCTGTATTAGTCAGG - Intronic
968144382 3:196286335-196286357 GGGAACAGGCTGTATTAGCCTGG - Intronic
968894463 4:3390597-3390619 GTGAAGGCACTGGAAGAGCCTGG - Intronic
968932003 4:3585825-3585847 GAGGAGAGGATGGATGAGCCTGG - Intronic
968984353 4:3867091-3867113 CTGCAGAGGCTGGAAGAGGCAGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969131393 4:4993418-4993440 GTGTGGAGGCTGGAGGATCCAGG - Intergenic
969226802 4:5803920-5803942 GTGATGAGGCTGCCTGAGACAGG - Intronic
970368770 4:15387251-15387273 GAGAAGGTGCTGGATGAGCTGGG + Intronic
971298756 4:25424748-25424770 GTCAGGAGGCTGGGTGAGGCGGG + Intergenic
971510002 4:27412930-27412952 GTCAAGAGGCAGGATGAGTGAGG - Intergenic
971673780 4:29597363-29597385 GTGAAGAGGGTAGATGAGGAGGG - Intergenic
972736620 4:41848234-41848256 GGCAAGAGGCTGGAGGATCCTGG + Intergenic
973308557 4:48680983-48681005 GAGAAGACGGTGGATGAGCAAGG - Intronic
976142581 4:82007808-82007830 CTGAAGGGGCTGGAGGAGCGTGG + Intronic
976688256 4:87839923-87839945 GTAGAGAGGCTTGAGGAGCCTGG - Intronic
977557165 4:98497921-98497943 ATGAAGAGGCTGGTTGGGCGAGG + Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978042155 4:104080621-104080643 GTGAAAGAGATGGATGAGCCTGG + Intergenic
979986162 4:127318465-127318487 GTGAAGAGGGTAGAGGAGCCAGG + Intergenic
980200092 4:129645438-129645460 GAGAAGAGGCTGGGTGATGCTGG - Intergenic
980888497 4:138788840-138788862 GTTTAGAGGCTGGGAGAGCCTGG + Intergenic
980894144 4:138845328-138845350 GAGACAAGGCTGGATCAGCCTGG + Intergenic
983103203 4:163651948-163651970 GGGAAGAGGCTGCATGACCAGGG - Intronic
984858659 4:184217753-184217775 GGGCAGAGGCTGGCTGGGCCAGG + Exonic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985789876 5:1919942-1919964 GGAAAGACGCTGGATGAGGCGGG - Intergenic
987089972 5:14501801-14501823 GAGAGGAGGCTGGATGAGTGGGG + Intronic
990453932 5:55965693-55965715 GTCAAGACGATGAATGAGCCGGG + Intronic
992763977 5:79978038-79978060 GGAAACAGGCTGGAAGAGCCAGG + Intronic
992886738 5:81167048-81167070 GTGAAGAGACGGGATGATCCTGG + Intronic
993083475 5:83332847-83332869 GTGAAGAGCATGGAGGAGACAGG + Intronic
995053762 5:107736164-107736186 GTGAAGAGGCTGCATAAGAATGG - Intergenic
1000051143 5:157563839-157563861 GTTAAGAAGATGGAAGAGCCGGG + Intronic
1000382192 5:160639139-160639161 GTGTAGGGGCTGGATGTGGCAGG - Intronic
1001113727 5:168921311-168921333 GTGAGGTGAATGGATGAGCCTGG - Intronic
1001758733 5:174190416-174190438 GTGATGAGTTTGGAGGAGCCAGG - Intronic
1002576565 5:180177312-180177334 GGGAAGCTGCTGGGTGAGCCGGG - Intronic
1002716959 5:181233957-181233979 GTGGAGTGGCAGGAAGAGCCAGG + Intronic
1006637287 6:35469517-35469539 GTCAAGAAGCTGGGTGAGTCCGG + Exonic
1007162627 6:39804144-39804166 GGGAAGAGTCTGGCAGAGCCTGG + Intronic
1008831334 6:55766461-55766483 TTGAAGAGGGTGGATAACCCAGG - Intronic
1010499188 6:76574402-76574424 GTTAAATGGCTGGCTGAGCCTGG + Intergenic
1012580320 6:100860993-100861015 GTGAAGAAGGTGGATGAGAAAGG + Intronic
1013366540 6:109441713-109441735 GAGAGGAGGCTGGAGGAGACTGG - Intronic
1013462799 6:110391648-110391670 GTAAAGAGGCTTGAGGAGGCTGG - Intergenic
1015969355 6:138728728-138728750 GGGAAGGGGCAGGAGGAGCCTGG + Intergenic
1018357066 6:163028994-163029016 GTGATTAGCCTGGATTAGCCAGG + Intronic
1019364003 7:622008-622030 GTGAAGAGACTGGCTGAGATCGG - Intronic
1019514405 7:1433401-1433423 GTGATGAGGGTGGAGGAGCACGG - Intronic
1020389173 7:7640594-7640616 GAGAAGGGGCTGGATGAGTCCGG + Exonic
1021392297 7:20107832-20107854 GAGAAGAGGCTTTATGAGCTTGG - Intergenic
1021632593 7:22661642-22661664 GTGAGGAGGCTTAAAGAGCCTGG - Intergenic
1022518012 7:30987982-30988004 GGGAAGGGGCTGCAGGAGCCTGG + Intronic
1026198947 7:68197502-68197524 GTGAAGGGGAAGGAGGAGCCAGG - Intergenic
1026444748 7:70474405-70474427 GAGAAGAAACTGGATGAGTCTGG - Intronic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1029654195 7:101913561-101913583 GGGAAGATGCCAGATGAGCCGGG - Intronic
1031023390 7:116652590-116652612 GTGAAGAGGTTGGATGAGAAGGG + Intergenic
1031308636 7:120165339-120165361 GTGTAGAGGCTGGAAGAGTTTGG - Intergenic
1033543239 7:142376304-142376326 GTGAAGAGGCTGGGGCAGCAAGG + Intergenic
1034306487 7:150048440-150048462 GTGAAGAGGGTGGAGGGGCGGGG + Intergenic
1034800360 7:154052203-154052225 GTGAAGAGGGTGGAGGGGCTGGG - Intronic
1034824658 7:154250764-154250786 GAAAAGAGGCTAGAAGAGCCAGG + Intronic
1034859142 7:154581373-154581395 GTAAAGAGCCTGGAAGGGCCAGG + Intronic
1034859658 7:154584304-154584326 CTGAAGAGGCTGGAAGGGCGTGG - Intronic
1036522856 8:9508170-9508192 GTGAAGTGGCTGGATTAGCAAGG - Intergenic
1036614579 8:10378517-10378539 GTGAACAGGCTGGGTGAGACTGG + Intronic
1036966206 8:13301008-13301030 GTGTAGAAGGTGGAGGAGCCTGG + Intronic
1037939978 8:22944035-22944057 GTCAGGAGGCAGGAGGAGCCGGG - Intronic
1038074714 8:24058467-24058489 GTGAAGGGGCTGGCTGAGTGAGG - Intergenic
1038455593 8:27670369-27670391 GTGAAGAGGCTGGGTGATCAGGG + Intronic
1040350268 8:46559531-46559553 GAAAAGAGGCTGAAGGAGCCAGG + Intergenic
1041307548 8:56478205-56478227 GTGAAGCGGCTGTATCAGCCCGG + Intergenic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1045015949 8:98002071-98002093 GTGGAGAGGCTTTATGAGACTGG - Intronic
1045775475 8:105797569-105797591 GAGAAGAGGCTGTAGGAGGCAGG - Intronic
1048264379 8:132972649-132972671 GTGAGGAGAATGGAGGAGCCTGG + Exonic
1049060567 8:140273206-140273228 GTGAAGAGGTTGGACGAGTGTGG - Intronic
1049557800 8:143291707-143291729 GGGAAGAAGCTCGATGAGCTGGG - Exonic
1049640539 8:143713185-143713207 GTGACCAGGGTGGATGGGCCTGG + Intronic
1049721409 8:144117242-144117264 GTGAAGAGGCAGGTTCAGCTGGG - Exonic
1049794612 8:144491116-144491138 GTGCAGAGGCTGCCAGAGCCTGG - Intronic
1051231068 9:14956275-14956297 GTCATGAGGCTGGAACAGCCAGG - Intergenic
1052625285 9:30967505-30967527 GTGAAAAGACTGGAGGAGCAGGG + Intergenic
1054458133 9:65446106-65446128 GAGGAGAGGATGGATGAGCCTGG + Intergenic
1054927255 9:70601464-70601486 GTGAAGAGGCAGGAAGGGCATGG + Intronic
1055248088 9:74271128-74271150 AGGAAGAGGCTGGAGGAGCAAGG + Intergenic
1056559936 9:87721481-87721503 GAGAAGAGGAGGGATGAGGCTGG - Intergenic
1058566948 9:106296267-106296289 TTGAAATGGCTGGGTGAGCCAGG - Intergenic
1059330608 9:113533167-113533189 GTGAAGAGGCAGGAAGGGCATGG - Intronic
1060940550 9:127540826-127540848 CTGGAGAGACCGGATGAGCCAGG - Intronic
1061716388 9:132521041-132521063 GAGGACAGGCTGGAGGAGCCAGG - Intronic
1061941403 9:133886110-133886132 GTGAAGGGGCTGGAGCAGGCGGG + Intronic
1062054708 9:134464717-134464739 GGGGGGAGGCTGGGTGAGCCGGG - Intergenic
1062054782 9:134465002-134465024 GGGGGGAGGCTGGGTGAGCCGGG - Intergenic
1062055020 9:134465857-134465879 GGGGGGAGGCTGGGTGAGCCGGG - Intergenic
1062055064 9:134466028-134466050 GGGGGGAGGCTGGGTGAGCCGGG - Intergenic
1062055112 9:134466199-134466221 GGGGGGAGGCTGGGTGAGCCGGG - Intergenic
1186472441 X:9832163-9832185 TTGAAGAGGCAGGATGACCTTGG + Intronic
1187486503 X:19709185-19709207 GTCATGAGGCTGGACTAGCCTGG - Intronic
1188195707 X:27230265-27230287 TTGAAGATGCTAGATAAGCCAGG + Intergenic
1189719992 X:43906013-43906035 GTGAACAGGCTAGATGGCCCAGG + Intergenic
1191590095 X:62873040-62873062 GTGAAGGAGCTGGGTGAGGCTGG - Intergenic
1191690048 X:63930216-63930238 GTGAAGTGACTGGATGAACATGG + Intergenic
1192508725 X:71708840-71708862 CTGAAGAGACTTGATGGGCCGGG + Intergenic
1192511958 X:71726098-71726120 CTGAAGAGACTTGATGGGCCGGG - Intergenic
1192514739 X:71755407-71755429 CTGAAGAGACTTGATGGGCCGGG + Intergenic
1192517972 X:71772713-71772735 CTGAAGAGACTTGATGGGCCGGG - Intergenic
1194113932 X:89873117-89873139 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1200241827 X:154500199-154500221 GTGAAGAAGCTGGCTGGGCACGG + Intergenic
1200466671 Y:3528473-3528495 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1201400412 Y:13598582-13598604 GAGCAGAGGTTGGAAGAGCCTGG + Intergenic