ID: 1106231813

View in Genome Browser
Species Human (GRCh38)
Location 13:27826487-27826509
Sequence CAGCATGAGATCAATGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106231810_1106231813 11 Left 1106231810 13:27826453-27826475 CCGTTAGGGGGAGCGCGTCCACT 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 161
1106231812_1106231813 -7 Left 1106231812 13:27826471-27826493 CCACTTGCTTGGTTTGCAGCATG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106231813 Original CRISPR CAGCATGAGATCAATGAGCC AGG Intergenic
901376188 1:8841202-8841224 CACCAGGAGATCAATGAGGCTGG - Intergenic
901760578 1:11468771-11468793 CAGCTTCAGACCTATGAGCCAGG + Intergenic
905028076 1:34865083-34865105 CAGCATGTGCTCAATAAACCGGG - Intergenic
905751225 1:40466230-40466252 CTGTATGAGATCACTGAGGCAGG - Intergenic
906822484 1:48944095-48944117 TATCATGAGCTCAATGAGGCAGG - Intronic
908005152 1:59720081-59720103 TAGCATGCCAGCAATGAGCCTGG + Intronic
913336901 1:117717073-117717095 CAGCATGAGAACCCTGGGCCTGG - Intergenic
913342205 1:117769702-117769724 CAGCCTGAGATCAACCTGCCAGG - Intergenic
913570598 1:120116052-120116074 CAGCTTGGGATCACTGAGCATGG - Intergenic
914291405 1:146277031-146277053 CAGCTTGGGATCACTGAGCATGG - Intergenic
914552449 1:148727814-148727836 CAGCTTGGGATCACTGAGCATGG - Intergenic
916486448 1:165264049-165264071 CAGAATGAGATCAACAATCCAGG + Intronic
918388334 1:184033743-184033765 CTGAATGTGATCAATAAGCCAGG + Intronic
918771347 1:188564320-188564342 CAGCGTGAGACCAAGGACCCTGG + Intergenic
920082226 1:203383172-203383194 CAGCCTGGGCTCAATGAGTCAGG - Intergenic
922348825 1:224719029-224719051 CAGGATGAGTTCAATGAGCCTGG - Intronic
923679084 1:236104538-236104560 AAGCATGAGATCCAACAGCCTGG + Intergenic
1070849624 10:79552859-79552881 CAGCAGGACATCCAGGAGCCTGG - Intergenic
1070956256 10:80465403-80465425 CAGCCTGAGATTCAAGAGCCCGG - Intronic
1071458940 10:85873126-85873148 CAGCCTGACATCAGTGAGCAGGG - Intronic
1078283202 11:9923654-9923676 CAGCATGATCTCCATGTGCCAGG - Intronic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1079314139 11:19393253-19393275 CAGCATGAGAAGAATGAAACTGG - Intronic
1079426879 11:20352035-20352057 CAGCTGGAGATCAAAGAGCTTGG - Intergenic
1081798897 11:45843517-45843539 AAGGATGAGATGAATTAGCCAGG - Intergenic
1087812399 11:102622630-102622652 CAGAAAGTGATCAGTGAGCCTGG - Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1092253837 12:6915747-6915769 GAGCCTGAGATCAATGGGCGGGG - Exonic
1092337537 12:7646513-7646535 CAGCAGGAGACCAAAGACCCTGG + Intergenic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1094793248 12:33939220-33939242 TTGCATGGGTTCAATGAGCCTGG - Intergenic
1095073829 12:37892800-37892822 CAGTCTGAGATCAAAGAGCAAGG + Intergenic
1095104523 12:38215977-38215999 TTGCATGGGTTCAATGAGCCTGG - Intergenic
1095952255 12:47787996-47788018 CAGGAGGAGGTCAATGAGGCTGG + Intronic
1096083602 12:48849952-48849974 CAGGATGAGTTCAGTGAGCTGGG + Intronic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1102400788 12:112627975-112627997 GAGCAAGAGATCAAAGGGCCGGG + Intronic
1103824573 12:123727175-123727197 CAGCATGGGATGCAGGAGCCAGG - Intronic
1104642272 12:130475114-130475136 CAGCATGAGCTCATTGTCCCTGG + Intronic
1105036564 12:132928006-132928028 GATCATGAGATGAAAGAGCCTGG + Intronic
1105924843 13:24998506-24998528 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108576920 13:51798875-51798897 CTGCATGAGCTCAACGATCCTGG - Intronic
1113033333 13:106018687-106018709 CAGCATTCGATCACTGAGTCAGG - Intergenic
1116342021 14:43735999-43736021 CATCATCAGATAAATGATCCTGG + Intergenic
1120917061 14:89719629-89719651 CAGCATTAGATCCAGAAGCCAGG + Intergenic
1124109694 15:26773695-26773717 CAGCAGGAGCTCCAGGAGCCCGG + Intronic
1125887677 15:43240759-43240781 CAGAACGAGGTCCATGAGCCTGG - Intronic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127140473 15:55970367-55970389 CAGCAGGAGATGAATTTGCCAGG - Intronic
1127291065 15:57571704-57571726 CAGCATGAGATAAAGGAAGCAGG + Intergenic
1128038116 15:64544776-64544798 TAGCATGAAAGCCATGAGCCAGG + Intronic
1130563856 15:84979064-84979086 GAGCATGAGGTCAATGGGGCTGG - Intergenic
1135190821 16:20353054-20353076 CAGGGTGGGATCAAGGAGCCAGG + Intronic
1138520878 16:57570264-57570286 CAACTTCAGAGCAATGAGCCTGG - Intronic
1138648518 16:58443015-58443037 CAGGATGACATCGGTGAGCCAGG + Intergenic
1139326914 16:66159921-66159943 CACCATGAGAAGACTGAGCCTGG - Intergenic
1139846265 16:69924003-69924025 CAGCTTGAGATCAATGATAAGGG + Intronic
1142064185 16:88051155-88051177 CAGCATGAGATCAAGGCTCCAGG + Intronic
1145734791 17:27220457-27220479 TAGCATGAGATAAGTGAGGCAGG + Intergenic
1146225173 17:31059716-31059738 TAGCATGAGATGAATGAGGCAGG - Intergenic
1149046678 17:52254747-52254769 CAGCAGGAGACCAAGGACCCTGG - Intergenic
1149441437 17:56677902-56677924 CAGCATAAGATCTAACAGCCGGG + Intergenic
1149987236 17:61356550-61356572 CATCATGAGGTCATTGAGCAGGG - Intronic
1152602999 17:81274529-81274551 CAGCCTGAGATCTGTGAGCCTGG - Intronic
1156120797 18:33840735-33840757 CAGCATGTAATAAATGAGCATGG + Intergenic
1157125638 18:44953153-44953175 CAGCACGAGATCAGAGAACCTGG + Exonic
1160444107 18:78914016-78914038 CAGCTGGAGAAGAATGAGCCTGG - Intergenic
1163317871 19:16553916-16553938 CAGAAAGAGAGCAATGAGACAGG + Intronic
1164687828 19:30180272-30180294 CGGCACGAGAGCAACGAGCCTGG + Intergenic
1165975383 19:39671815-39671837 CAGCACGAGACCAAGGACCCTGG + Intergenic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1168394688 19:56038091-56038113 CAGCCTGAAATCTCTGAGCCTGG + Exonic
925044678 2:763850-763872 TAGCCTGAGACCAATGAGACAGG - Intergenic
926572220 2:14542207-14542229 CAGCAGAAGTGCAATGAGCCAGG + Intergenic
926577530 2:14598503-14598525 CAACTTGAAATCAAGGAGCCAGG - Intergenic
926700515 2:15800297-15800319 CTGCATGGGTTCAATGAACCCGG + Intergenic
926933475 2:18063571-18063593 CAGCAAGAGATCAATGAAGGAGG + Intronic
929231770 2:39567633-39567655 CAGCATGAAATCAACTAGCTAGG - Intergenic
929489061 2:42380461-42380483 CAGCCTGGGATAAATGAGTCAGG - Intronic
937276493 2:120687676-120687698 CAGCTTGAAAGTAATGAGCCAGG - Intergenic
940027252 2:149221257-149221279 CAGCAGGAGAGCAAAGAGCAGGG - Intergenic
940724292 2:157317851-157317873 GAACATGAGATAACTGAGCCAGG - Intergenic
943007978 2:182409738-182409760 TTGAATGAGATCAATGAGACTGG - Intronic
945548730 2:211191838-211191860 CAGATTGAGATCAGTGAGACAGG + Intergenic
945553111 2:211246064-211246086 CAGTAAGAGATGAATGAGACAGG - Intergenic
946482698 2:220072467-220072489 CAGCAAGAGAACCATGACCCTGG - Intergenic
1169593968 20:7176976-7176998 CAGCAGGGGATCACTGGGCCTGG + Intergenic
1170265969 20:14467265-14467287 CAGCCTGAGATCAAACAGCAAGG - Intronic
1172585693 20:36082744-36082766 CAGCATGAGCACAGTGAGACAGG - Intergenic
1172803985 20:37598255-37598277 CAGCCTGACCTCAATTAGCCCGG - Intergenic
1173726668 20:45303303-45303325 CAACATCAGACCAATGAGTCTGG - Intronic
1174468717 20:50739081-50739103 CAGCATGAGAGCATCAAGCCTGG + Intronic
1179947657 21:44688917-44688939 CAGCATGAGAGAACTGTGCCTGG - Intronic
1181656013 22:24299487-24299509 CAGCTTGAGATCACTTAGACCGG - Intronic
1182166951 22:28184894-28184916 CAGCATGAGACAGATGAGACGGG + Intronic
1182272526 22:29164320-29164342 CAGATTGAGATCATTGTGCCAGG - Intronic
1183881092 22:40830739-40830761 CAGCATTAAATAAAAGAGCCAGG + Intronic
949220087 3:1621783-1621805 CAGCATGAGATCCATGTCTCAGG + Intergenic
951778799 3:26340245-26340267 CAGCTTGAGTCCAAGGAGCCAGG + Intergenic
955690945 3:61590140-61590162 CAGAATGAGATGGATGGGCCAGG + Intronic
955712733 3:61797124-61797146 CATCATGAGCTCTTTGAGCCAGG + Intronic
955894518 3:63685222-63685244 AAGGATGAGAACCATGAGCCTGG - Intergenic
956799942 3:72748049-72748071 CAGTGTGAGTTCAATCAGCCAGG + Intergenic
957625463 3:82648347-82648369 GAGCAAGAGATCCATGAGGCAGG + Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
961624004 3:128246839-128246861 CATCATCAGATCAATGATCTGGG - Exonic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
962917104 3:139914229-139914251 CAGCTAGAGAGCTATGAGCCAGG - Intergenic
963352198 3:144165879-144165901 TAACATGAGACCATTGAGCCTGG + Intergenic
964032059 3:152149685-152149707 CAGCATGGGTTCAAGGAGACAGG + Intergenic
966738569 3:183210911-183210933 CAGCATAAAAACAATGTGCCAGG + Intronic
968862620 4:3184726-3184748 CAGCATCAGGTGTATGAGCCTGG + Intronic
970059922 4:12021235-12021257 CAGCCTGAGATGAATGAGCAAGG - Intergenic
972646527 4:40973220-40973242 CAGCAAGTGATCAGAGAGCCTGG + Intronic
972783953 4:42310234-42310256 CAGCATGAGACTAAGGACCCTGG - Intergenic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
974913973 4:68157003-68157025 CAGCACGAGATAAAGGACCCTGG - Intergenic
978177345 4:105748290-105748312 TAGCATGAGATCAAAGAGGTGGG + Intronic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
979399173 4:120226855-120226877 CAGCAAGAGAGCAATCAGACAGG - Intergenic
981235111 4:142406273-142406295 CACCATGAAATCAAGGACCCAGG - Intronic
982636775 4:157906837-157906859 CAGCAAGAGAAGAATGAACCAGG + Intergenic
989306129 5:39958764-39958786 AAGAATAAGATCAATGAGCTAGG + Intergenic
992209306 5:74462320-74462342 AATCATGAGATCTATGAGACTGG - Intergenic
994683201 5:102915816-102915838 TAACATGAGAACAATGAGCTTGG - Intronic
996692498 5:126355576-126355598 AAGCATGAGCTAAATGAGGCTGG + Intergenic
996854999 5:127995831-127995853 TAGCATGAGAAGAATGAGCTTGG + Intergenic
997497818 5:134345344-134345366 CAACATGTGAAAAATGAGCCTGG + Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1004804954 6:19193445-19193467 CAACATGAGATCTCTGAGCTGGG - Intergenic
1011270660 6:85576549-85576571 TATCATGAGATGAATGAGACTGG - Intronic
1012198824 6:96379482-96379504 CAACAGGAGGTCAATTAGCCTGG + Intergenic
1015762698 6:136682020-136682042 AAGCATGAGACCAATGTTCCAGG + Intronic
1026847032 7:73704138-73704160 CAGCTGGAGATCAGTGAGCTGGG - Exonic
1027969202 7:85056842-85056864 CAGTATGACATCAATGAGGTGGG - Intronic
1027969471 7:85059991-85060013 CAGTATGACATCAATGAGGTGGG + Intronic
1028590229 7:92485291-92485313 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1028760243 7:94487883-94487905 CATCAAGAGATGAATGAGGCCGG - Intergenic
1029092999 7:98063128-98063150 AAGCCTGAGTTCAATCAGCCTGG + Intergenic
1031428823 7:121640237-121640259 CAGCATTATATCAATTAGCAAGG - Intergenic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1034052566 7:147998436-147998458 CAGCCTGCTATCAATGAGGCAGG - Intronic
1034728293 7:153360887-153360909 CTGGATGAGAACACTGAGCCTGG - Intergenic
1035910494 8:3560464-3560486 CAGCATGAGAAGAATCAGTCTGG - Intronic
1037436340 8:18867642-18867664 CAGCATGAAATGAATGAGAATGG + Intronic
1039909461 8:41812905-41812927 CAGGAAGTGAGCAATGAGCCAGG - Intronic
1041853440 8:62420100-62420122 CAACATATCATCAATGAGCCAGG + Intronic
1042316001 8:67426493-67426515 CAACATGAGACCAATGATCATGG + Intronic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1048604752 8:135956036-135956058 AAGCTTGAGATCCATGAGTCTGG + Intergenic
1048849741 8:138633366-138633388 TAGCATGAGAATAATAAGCCAGG + Intronic
1049269673 8:141687635-141687657 CAGCCTGAGGTCACTCAGCCAGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1052080780 9:24203287-24203309 CAGCATGAGGACCCTGAGCCTGG - Intergenic
1053371841 9:37568064-37568086 CTGCAAGAGATCAAAGGGCCAGG + Intronic
1053903920 9:42822454-42822476 CACAATGAGATCAATGAGGCAGG + Intergenic
1054531067 9:66183060-66183082 CACAATGAGATCAATGAGGCAGG - Intergenic
1058465594 9:105223899-105223921 CAGCAAGAGAAAAATGAGCCAGG - Intergenic
1061432812 9:130542149-130542171 CAGCAAGAGAGCACTGAGCTTGG + Intergenic
1061551041 9:131334913-131334935 CAGCAGGATATTAATAAGCCTGG + Intergenic
1061822265 9:133235257-133235279 CAGCATGGGGTCCATGAGTCAGG + Intergenic
1061832386 9:133304183-133304205 CAACATGGGGTCCATGAGCCAGG - Intergenic
1062237040 9:135515284-135515306 CAGCATGGGGTCCGTGAGCCAGG - Intergenic
1187986028 X:24812062-24812084 CAGTATGAGCACAATGTGCCAGG - Intronic
1190538829 X:51456719-51456741 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1194377329 X:93152032-93152054 CAGCATGGGAACCATGGGCCTGG + Intergenic
1194569073 X:95530832-95530854 CAGCATCTGATCAAAGAGCAGGG + Intergenic
1196636991 X:118013500-118013522 AAACATGACTTCAATGAGCCAGG + Intronic
1197260170 X:124308926-124308948 AAGCAAGACATCAAGGAGCCTGG + Intronic
1197712283 X:129679869-129679891 CAGTATGAAATCAATAGGCCTGG - Intergenic
1198837169 X:140817268-140817290 CAGCATGAGACCAAGGACCCTGG - Intergenic
1200085086 X:153600103-153600125 CATCAGGAGATCAAGGCGCCTGG - Intergenic