ID: 1106231863

View in Genome Browser
Species Human (GRCh38)
Location 13:27826775-27826797
Sequence TAGCTATGGCGGCCACGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106231863_1106231876 24 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231876 13:27826822-27826844 CCCTCCCCAAGGAGCTCCGGAGG 0: 1
1: 0
2: 2
3: 22
4: 248
1106231863_1106231868 -3 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231868 13:27826795-27826817 CTAGGAAGCCTTCCCAAGTCGGG 0: 1
1: 0
2: 1
3: 14
4: 148
1106231863_1106231873 13 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231873 13:27826811-27826833 AGTCGGGAGGACCCTCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 96
1106231863_1106231874 21 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231874 13:27826819-27826841 GGACCCTCCCCAAGGAGCTCCGG 0: 1
1: 0
2: 3
3: 29
4: 216
1106231863_1106231867 -4 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231867 13:27826794-27826816 GCTAGGAAGCCTTCCCAAGTCGG 0: 1
1: 0
2: 3
3: 42
4: 369
1106231863_1106231869 0 Left 1106231863 13:27826775-27826797 CCTGTGCGTGGCCGCCATAGCTA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1106231869 13:27826798-27826820 GGAAGCCTTCCCAAGTCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106231863 Original CRISPR TAGCTATGGCGGCCACGCAC AGG (reversed) Intergenic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
910964130 1:92790626-92790648 AAGCTATGGCCTCCATGCACTGG + Intronic
924932582 1:248743847-248743869 TAGCTCTGGCCCCCACTCACCGG - Intronic
1066408471 10:35142895-35142917 AAGCTATTGAGGCCAAGCACAGG - Intronic
1080711726 11:34754574-34754596 CAGCTCTGGCTGCCACGCAGTGG + Intergenic
1086337439 11:85812954-85812976 TAGCTCTGGAGGGCAGGCACTGG + Intergenic
1097046072 12:56188964-56188986 GAGCTCTGGCGGGCACGCTCCGG + Intronic
1106231863 13:27826775-27826797 TAGCTATGGCGGCCACGCACAGG - Intergenic
1129892286 15:79079145-79079167 TAGCCATGGCGCCCAGGCCCTGG - Intronic
1138296105 16:55886531-55886553 TAGCTATGGTGGCTAAGCATGGG + Intronic
1140267722 16:73434859-73434881 TAGCCATGCCGGCCACTGACTGG - Intergenic
1141950298 16:87335357-87335379 TACCTATGGCAGCCACGGCCTGG - Exonic
1141970032 16:87475103-87475125 TAGCTCTGGAGACCAGGCACAGG + Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1157508474 18:48249942-48249964 TAGCTCTGCCGGCCATGGACAGG - Intronic
1161517352 19:4703848-4703870 TGGCTATGGTGGCCGTGCACAGG + Intronic
1027355607 7:77351651-77351673 CAGCTATTGTGGACACGCACAGG - Intronic
1032789785 7:135233742-135233764 TGGCTGTGGCGGCCAGGGACAGG + Intronic
1040681653 8:49818157-49818179 TAGCTTTGGCAGACACTCACAGG + Intergenic
1055240513 9:74180297-74180319 TAGATATGGCTGCCAGGCAGGGG - Intergenic
1056946684 9:91003680-91003702 TAACTAGGGTGGCCATGCACAGG - Intergenic
1061923388 9:133794462-133794484 TAGCACCGGCGGCCAAGCACTGG + Intronic
1187858644 X:23660879-23660901 TAGCTAAGTGGGCCACCCACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1199865877 X:151849468-151849490 TGGCTTTGGAGGCCACTCACTGG - Intergenic
1200077009 X:153556279-153556301 GAGCTAAGGCGGGCACGCAGGGG - Intronic