ID: 1106232958

View in Genome Browser
Species Human (GRCh38)
Location 13:27836088-27836110
Sequence GTGGCTATAAAAGGGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 7, 3: 33, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106232958 Original CRISPR GTGGCTATAAAAGGGCATCA GGG (reversed) Intergenic
904206802 1:28860862-28860884 CAGGCTATAAAAGGGCACCAGGG - Intronic
905747914 1:40435186-40435208 TAGGCTATAAAAGGGCAGTATGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906917489 1:50026582-50026604 GTGGCTATAGATGCCCATCAAGG - Intergenic
907223615 1:52925367-52925389 TTGGTTATAATAGGGCTTCATGG + Intronic
910038195 1:82814177-82814199 GCGGCTATAAAACGCCATCTTGG - Intergenic
910083844 1:83373959-83373981 GTGACTATAAATGGGTATGAGGG - Intergenic
910686558 1:89923350-89923372 ATGGCTATAAATGGTTATCAAGG - Intronic
913320557 1:117585466-117585488 GTGGATAGAAAAGGGACTCAGGG + Intergenic
916610508 1:166386838-166386860 CTTGCTTCAAAAGGGCATCAAGG - Intergenic
916799689 1:168204785-168204807 GTGGGTAAAAAAGGGCAAAATGG + Intergenic
919149945 1:193683294-193683316 GTGGGGATAAAAGAGCATCCTGG - Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920574172 1:207044583-207044605 ATATGTATAAAAGGGCATCATGG + Exonic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
921600287 1:217099549-217099571 GTGGCTAGAAAATAGCATCCTGG - Intronic
923340260 1:233000730-233000752 GTGCCTAGAAAAGAGCTTCATGG + Intronic
1064692273 10:17930474-17930496 GTGGCTATAATGGTGCAGCATGG + Intergenic
1065144767 10:22757560-22757582 GTGGCTATAAAAGTGTTGCATGG - Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1068183037 10:53546697-53546719 GTGCATCTCAAAGGGCATCATGG - Intergenic
1068289648 10:54986164-54986186 CTAGCTAAAGAAGGGCATCAAGG + Intronic
1069666221 10:70162012-70162034 GAGACTATAAATGTGCATCATGG - Intronic
1071571142 10:86698046-86698068 ATGGCTATAAAAAGGCGGCATGG - Intronic
1072002439 10:91209855-91209877 GTAGCTATCAATGGGCATTAGGG + Intronic
1075796421 10:125123206-125123228 ATGACTATAAAAGGGCAACGGGG + Intronic
1076723138 10:132401453-132401475 ATGGCTCTAAAAGGGCAGCCTGG + Intronic
1076802469 10:132836919-132836941 GTGGCGAAAAACGGCCATCAGGG + Intronic
1078568486 11:12437658-12437680 GTGGGAATAAAAGAGCATCAAGG + Intronic
1078793043 11:14564160-14564182 ATGATTATAAAAGGGCAGCATGG - Intronic
1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG + Intergenic
1079150027 11:17890117-17890139 GTGGCTAAGAAGGGGCAGCAGGG + Intronic
1081184410 11:40024550-40024572 GAGGATATAAAATGGCATCCTGG - Intergenic
1081883851 11:46477747-46477769 GTGGTTCTAAAAGTACATCAAGG + Intronic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1091830700 12:3549125-3549147 TTGACTACAAAAGGGCATGAAGG + Intronic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1093746126 12:22742610-22742632 ATGGCTATAACATGACATCACGG + Intergenic
1097501498 12:60409681-60409703 GTGGCTCTACAAGGTCACCATGG + Intergenic
1100503265 12:95194622-95194644 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100503379 12:95195788-95195810 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100915487 12:99415981-99416003 GTAGCTATAAAAGGGCAATGGGG - Intronic
1101714951 12:107302568-107302590 GTGGCTGCACAAGGCCATCAGGG + Intergenic
1102083812 12:110119767-110119789 TTGGCAATAAAAGGGAATGACGG + Intergenic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1108080234 13:46727644-46727666 GTGTCAATAAAAGGTCAACATGG + Intronic
1108091164 13:46851585-46851607 GTGGCTTTACAAGGGCAGGATGG + Intronic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1110386339 13:74915474-74915496 GTGGCCATAAAATTGCCTCAAGG - Intergenic
1110660151 13:78051213-78051235 GCGGCTATAAAAAGGAATGAGGG + Intergenic
1113456808 13:110455187-110455209 GAAGCCATTAAAGGGCATCAAGG - Intronic
1115252893 14:31368136-31368158 GTCATTATAAAAGGGCTTCACGG + Intronic
1117266857 14:54098089-54098111 GTTGTTATAAAAGGGCTTAATGG - Intergenic
1117768254 14:59106086-59106108 ATGGCTATGAAAGGCCAGCATGG + Intergenic
1117890864 14:60420534-60420556 GTGGGTATATAAGGGAGTCAAGG - Intronic
1117896343 14:60491345-60491367 GTGCCTATAAAAGGGCTTGAGGG - Intronic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1121276184 14:92669503-92669525 GTGGCTCTAAATGGGAATCATGG + Intronic
1122422596 14:101586992-101587014 GTGTCCAGAAAAGGTCATCAGGG + Intergenic
1123215390 14:106804652-106804674 GTTGCTATAAGAGGATATCATGG + Intergenic
1124646745 15:31442323-31442345 GTGACTGCAAAAGGGCATCAAGG - Intergenic
1124711077 15:32012452-32012474 GTGGCTGTAAAAGGACAGTATGG - Intergenic
1127104303 15:55596734-55596756 GTGGCTATAAAGGGCTAACAAGG - Intergenic
1127731979 15:61810075-61810097 GTTTCCAGAAAAGGGCATCATGG + Intergenic
1127913782 15:63439113-63439135 GTGGCTGTAAAAATACATCATGG - Intergenic
1128534123 15:68477900-68477922 GTGGCTCTAAAAGAGCATCATGG + Intergenic
1131192167 15:90325551-90325573 ATGGATATATAAGGGAATCAGGG + Intergenic
1131398589 15:92106512-92106534 GTGGCTTTCAAAGGACATCCTGG + Intronic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1137609845 16:49810937-49810959 GTGGCTAAGGAGGGGCATCAGGG + Intronic
1141644126 16:85358333-85358355 GAGGCCATAAAAACGCATCATGG - Intronic
1144125660 17:12200353-12200375 TTGACTACAAAAGGGCATGAGGG + Intergenic
1146768232 17:35543522-35543544 GTGACTCTAAAAGGGCTGCAAGG - Intergenic
1146964671 17:37015518-37015540 GTCCCTCTAAAAGGGCATGATGG - Intronic
1150100468 17:62418917-62418939 GTGGGTATAACAGGGAATCTAGG + Intergenic
1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG + Intergenic
1153031372 18:716340-716362 TTGACTGTAAAAGGGCATAATGG + Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1155226967 18:23737410-23737432 GGGGCTATGAAAGGTCACCACGG - Intronic
1156578631 18:38349520-38349542 GTGGCTATAAAAGCATATTATGG - Intergenic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
1164913721 19:32032865-32032887 GTGGCTATAAAGAGGAATCTAGG - Intergenic
1165337537 19:35182347-35182369 CTAGCTATAAGAGGGCCTCACGG + Intergenic
1166346411 19:42168885-42168907 GGGGCTACAGGAGGGCATCACGG - Intronic
925235040 2:2270673-2270695 GTGGCCATAAAAGGACATTAAGG + Intronic
928601470 2:32907927-32907949 TTGGCAATAAAAGGGAATAAAGG - Intergenic
930259423 2:49127415-49127437 GTAGCAAGAAAAGTGCATCATGG + Intronic
930828963 2:55723160-55723182 GTGTCTATAGAAGAGCATCCAGG - Intergenic
934789160 2:97043697-97043719 GAGGCTATAAGAGGTCATCGAGG - Intergenic
934817318 2:97338844-97338866 GAGGCTATAAGAGGTCATCGAGG + Intergenic
934820378 2:97369640-97369662 GAGGCTATAAGAGGTCATCGAGG - Intergenic
934987339 2:98897099-98897121 GTGGCTATAAAGGAGCAGCATGG - Intronic
935126315 2:100226597-100226619 GTGGCTATAAAACATCAACAGGG - Intergenic
935470895 2:103459472-103459494 GAGGCTATGAAAATGCATCAGGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
944986184 2:205180338-205180360 GATGCTATAAAAGAGTATCATGG + Intronic
945747310 2:213733910-213733932 GTGGCTATAAAACAGAATAAAGG - Intronic
945810990 2:214549901-214549923 AAGGCAATGAAAGGGCATCAAGG - Intronic
945994275 2:216422697-216422719 GTGGTCAGAAAAAGGCATCATGG - Intronic
1170464271 20:16608704-16608726 GTGGCTAGAAAAAGTCATGAGGG + Intergenic
1170785499 20:19463748-19463770 GTGGCCAGAAAATGGAATCAGGG + Intronic
1175567692 20:59993909-59993931 GTGACTAAAGAAGGGCACCATGG - Intronic
1177641326 21:23847711-23847733 ATGGCTATAAAAGGATAGCATGG - Intergenic
1177793517 21:25747115-25747137 GTGGCTACAAAAGGGTATACTGG + Intronic
1178825755 21:36015219-36015241 ATGACTATAAAATAGCATCATGG - Intergenic
1179024070 21:37666011-37666033 GTGGGTATGAAATGACATCATGG - Intronic
1181377563 22:22472145-22472167 GAAGCTATAAAAGGGCACAATGG + Intergenic
1181736697 22:24887221-24887243 CTGGCTATAAAAGGACAACGTGG - Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
951273258 3:20653804-20653826 GTGGCTATATAATGTCATCAAGG + Intergenic
953841969 3:46396509-46396531 TTGGCTTGAAAAGGGCATCTGGG - Intergenic
953956761 3:47237443-47237465 GTAGCTATCAAAGGGCTCCAGGG + Intronic
957021441 3:75132625-75132647 GTCCCTGAAAAAGGGCATCATGG + Intergenic
959535490 3:107480629-107480651 GTGACTATAAATGAGCATAATGG + Intergenic
959607013 3:108251976-108251998 GTGGCTACAAAAGGTCAGCATGG - Intergenic
959825976 3:110796331-110796353 GTGACTATAAAAGGGTCACAAGG + Intergenic
965900914 3:173640753-173640775 TTGGCCATAAAAAGACATCAGGG - Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
967229159 3:187321127-187321149 GTGGCTTTAAATGGACATCGAGG + Intergenic
967625882 3:191683308-191683330 GTGGGAATAAAAAAGCATCAAGG - Intergenic
967889348 3:194354074-194354096 GTGGCTAGGGAAGGGCAACAAGG + Intergenic
968169137 3:196494725-196494747 GTGGCTATAAATGGCAATCAGGG + Intronic
969501407 4:7555719-7555741 GTTGCTCTAGAAGGGGATCATGG + Intronic
969933980 4:10663152-10663174 GGGGCTAGATAAGGGCATCTTGG - Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
971057840 4:22933509-22933531 TTGGATATAAAAGGGAATAAGGG + Intergenic
971480825 4:27113581-27113603 GTGTCAATAAAAGGGCATCATGG - Intergenic
972425480 4:38928779-38928801 GTGGACATAAAAGGGCACCTGGG + Intronic
985326578 4:188777101-188777123 GTGGCCAGCAAAGGCCATCATGG + Intergenic
985608935 5:875645-875667 GTTGCTATAAAAAAGCATCTGGG - Intronic
986817059 5:11424341-11424363 GTGGCTAAAAAGGGGTAGCACGG + Intronic
987943918 5:24579505-24579527 GTGGATTTAAAAGGGCATACAGG - Intronic
988798369 5:34673699-34673721 GTGGCTATAGCAGGGCCTCAGGG + Intronic
991484641 5:67122024-67122046 GTGTCTACAAAAAGGGATCAAGG - Intronic
991662726 5:68967027-68967049 GTGGCTGTAAAAGGATATCAAGG + Intergenic
993699151 5:91097770-91097792 GTGGGTATGAAATGGTATCACGG + Intronic
996851331 5:127956627-127956649 ATGTTTATAAAAGGGCAACATGG + Intergenic
999196295 5:149783868-149783890 GTGGTTATAAAGGGGTATAAAGG - Intronic
1000323305 5:160152218-160152240 GTGGTTATGAAAGAGCAACATGG - Intergenic
1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG + Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1001744160 5:174077793-174077815 GGGGCTATAAAACTGAATCAGGG - Intronic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1005762381 6:28979317-28979339 GTGGCTGTAAAAGGGCCAAAAGG + Intergenic
1007054317 6:38867308-38867330 GTGGCTATAAAGTAGCATGAGGG - Intronic
1009470164 6:64023006-64023028 GTGGCTAGAGAAGGGCAGAATGG - Intronic
1010138780 6:72587872-72587894 GTAGTTATAAAAGGGCAAAATGG - Intergenic
1011492838 6:87910402-87910424 ATGGCCATTAAAGGGCATGAAGG + Intergenic
1014294479 6:119601890-119601912 GTGGCTATGAGAAGGTATCAGGG - Intergenic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1017482233 6:154869034-154869056 GTGGCTGTAAAAGGTGATAAAGG + Intronic
1017543746 6:155428979-155429001 GTGGCTTTAAAATGGCGCCAGGG - Exonic
1018717995 6:166549666-166549688 GTGTCCATAAAAGGGTACCATGG + Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1023021905 7:36018689-36018711 GTGGGTAGAAGTGGGCATCAGGG + Intergenic
1023721530 7:43100065-43100087 TTAGCAATAAAAGGTCATCAGGG - Intergenic
1024243956 7:47455505-47455527 GTGGATATGAAAGGGAAGCAGGG - Intronic
1027410258 7:77909184-77909206 GTGACTATAAATGAGCTTCAAGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1027592440 7:80134328-80134350 GGGACTAGAAAAGGGCACCAAGG - Intronic
1028861137 7:95651899-95651921 GTGGCTATAAAAGAATAACATGG - Intergenic
1031962640 7:128003826-128003848 TTGGCTGTGAAAGGGCATGATGG - Intronic
1032029605 7:128471761-128471783 GTGGGTATAACAGGGAATCTAGG + Intergenic
1033181584 7:139184569-139184591 GTGACTGTAAAAGGGTAACAAGG + Intronic
1035209859 7:157319816-157319838 CGGGCTCTAAAAGGTCATCAGGG - Intergenic
1035863935 8:3060814-3060836 GTCCCTATAAAAGGGCTTTATGG + Intronic
1036287487 8:7456610-7456632 GTGGCCATAAAACCTCATCAGGG + Intronic
1036333993 8:7854915-7854937 GTGGCCATAAAACCTCATCAGGG - Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1038026978 8:23599794-23599816 GTGACTAAAAAAGAGCAGCATGG - Intergenic
1038105852 8:24432927-24432949 TTCCCTATAAAAGGACATCATGG - Intergenic
1038426002 8:27464143-27464165 GTGGCTATAAATGTGCATGCCGG - Intronic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1043953715 8:86338410-86338432 CAGGCCATAAAAAGGCATCATGG - Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1044344850 8:91093324-91093346 GTGGCAAGAAAGTGGCATCAGGG + Intergenic
1048053109 8:130837892-130837914 TTGGCTATAAAGTGGCATCTAGG + Intronic
1050500357 9:6291936-6291958 ATAAGTATAAAAGGGCATCATGG + Intergenic
1052321496 9:27172376-27172398 GTGGATAGAAGAGGGCATAAAGG - Intronic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1052739593 9:32380770-32380792 GTGGTGAGAAGAGGGCATCAGGG + Intergenic
1055019165 9:71650355-71650377 GTCTCTATAAAAGGGCTTGAGGG + Intergenic
1055051090 9:71982030-71982052 GTGGCTACAAATGAGCATGAGGG - Intronic
1055633366 9:78247677-78247699 GGGGCTATAAAAGGGAAAGAGGG + Intronic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1058119318 9:101120908-101120930 GTGGCTATTACAGGGAAACAAGG + Intronic
1058939725 9:109801833-109801855 GGGGATAAAAATGGGCATCATGG + Intronic
1059297945 9:113289026-113289048 TTGGCTGGAAAAGGGCATGAGGG - Intronic
1059342495 9:113605954-113605976 GTACCTATAAAAGGGTATCGAGG - Intergenic
1061612639 9:131757754-131757776 GTGGCTAGAAAAGGAAACCAGGG + Intergenic
1062193690 9:135260801-135260823 GTGGGTATGGAAGGGCAGCAGGG + Intergenic
1187495607 X:19792993-19793015 ATGGCTATATAAGAGCATCTGGG + Intronic
1187570951 X:20501087-20501109 TTGACTATAAAAGGGCACAAGGG - Intergenic
1191054143 X:56224984-56225006 GTCCTTATAAAAGGGCTTCAGGG - Intergenic
1192334637 X:70207307-70207329 GTGGGTGTAAAATGGTATCATGG - Intergenic
1193041819 X:77011960-77011982 GTGGCTATAACAGCCCCTCAGGG - Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1194054003 X:89107803-89107825 GTGGCTAAAAAAGATCAACAAGG + Intergenic
1194947706 X:100089319-100089341 GTGACTAGAAAGGGGCAACAGGG + Intergenic
1197738593 X:129871898-129871920 GTGGCTATCTAAGGTCTTCAGGG - Intergenic
1199750569 X:150813109-150813131 GTGGTTATAAAATGTAATCATGG + Intronic
1200311110 X:155078451-155078473 TTGGCTTTAAATGGGCATTATGG + Intronic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic